BPG is committed to discovery and dissemination of knowledge
Rapid Communication
Copyright ©2007 Baishideng Publishing Group Co.
World J Gastroenterol. Dec 28, 2007; 13(48): 6581-6587
Published online Dec 28, 2007. doi: 10.3748/wjg.v13.i48.6581
Table 1 Oligonucleotides sequences of β-catenin specific and negative control siRNA
NameSequence of siRNATarget sites
Pgenesil-CAT1AACAGTCTTACCTGGACTCTG0290-0310
Pgenesil-CAT2AAAGGCAATCCTGAGGAAGAG0355-0375
Pgenesil-NegGACTTCATAAGGCGCATGCNo homology
Table 2 Oligonucleotides sequences of primer pairs
Goal geneUpstream primerDownstream primerPCR frag(bp)
β-actin5'-TCCTGTGGATCCACGAAACT-3'5'-GAAGCATTTGCGGTGGACGAT-3'330
β-catenin5'-AGATGCAGCAACTAAACAGGA-3'5'-GTACTACATTTTAAGCCATCT-3'290
C-myc5'-TACCCTCTCAACGACAGCAG-3'5'-TCTTGACA TTCTCCTCGGTG-3'477
CyclinD15'-GCCAACCTCCTCAACGACCGG-3'5'-GTCCATGTTCTGCTGGGCCTG-3'744
Table 3 The mRNA expression intensities of genes in different groups normalized by β-actin
Goal geneBlank ControlNegativeCAT1CAT2
β-catenin0.98 ± 0.020.96 ± 0.030.51 ± 0.030.55 ± 0.01
C-myc0.97 ± 0.010.96 ± 0.020.48 ± 0.040.52 ± 0.01
CyclinD10.98 ± 0.020.97 ± 0.030.47 ± 0.020.50 ± 0.02
PaP > 0.05aP > 0.05aP > 0.05
Table 4 The western blot analysis for genes in different groups normalized by β-actin
Goal geneBlank ControlNegativeCAT1CAT2
β-catenin0.95 ± 0.020.89 ± 0.040.52 ± 0.020.56 ± 0.03
C-myc0.97 ± 0.010.92 ± 0.020.54 ± 0.010.54 ± 0.04
CyclinD10.94 ± 0.030.95 ± 0.010.53 ± 0.020.51 ± 0.01
PaP > 0.05aP < 0.05aP < 0.05
Table 5 The Inhibition rate of cell proliferation in different group
Blank Control (%)Negative (%)CAT1 (%)CAT2 (%)
36 h10142118
48 h13172824
60 h15193933
72 h1821c54a47a
Table 6 Effect of shRNA interference on cell cycle distribution and apoptosis
GroupG0/G1 (%)S (%)G2/M (%)Apoptosis (%)
Blank36.51 ± 2.5247.32 ± 3.3116.45 ± 1.520.78 ± 0.11
Negative40.32 ± 2.74c43.21 ± 2.1216.57 ± 1.831.05 ± 0.15c
CAT181.71 ± 5.73a14.34 ± 1.344.55 ± 0.355.21 ± 0.47a
CAT278.33 ± 5.32a17.51 ± 1.815.31 ± 0.574.89 ± 0.38a