BPG is committed to discovery and dissemination of knowledge
Basic Research
©2007 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 21, 2007; 13(47): 6370-6378
Published online Dec 21, 2007. doi: 10.3748/wjg.v13.i47.6370
Table 1 Common genes induced by bacterial treatment (Seventeen genes were influenced by both E. coli and L. plantarum and four genes by both E. coli and combination treatment)
Nr.Gene symbolGene ID NCBIGene nameLocationFunctionRelative fold modification
L.p.E.c.Mix
1GPR342857G protein-coupled receptor 34Integral to plasma membraneG-protein coupled receptor activity2.433.03-0.53
2GTPBP423560GTP binding protein 4NucleusRibosome biogenesis - small GTPase mediated signal transduction2.002.91-0.30
3TFPI27980Tissue factor pathway inhibitor 2Extracellular matrixSerine-type endopeptidase inhibitor activity2.102.93-0.27
4CYP26A11592Cytochrome P450, family 26,subfamily A, polypeptide 1MembraneMetal ion binding2.312.39-0.88
5ZNF357584Zinc finger protein 35 (clone HF.10)NucleusTranscription factor activity2.182.19-0.66
6RTTN25914Rotatinrequired for left-right specification in mouse embryos2.212.13-0.58
7FXYD35349FXYD domain containing ion transport regulator 3MembraneChloride channel activity2.442.03-0.15
8CYYR1116159Cysteine/tyrosine-rich 1Integral to membraneMolecular function unknown-2.30-2.201.05
9BFAR512836Bifunctional apoptosis regulatorApoptosis regulator-2.40-2.171.06
10C19orf425789Chromosome 19 open reading frame 4Integral to, membraneMolecular function unknown-2.51-2.280.19
11KIAA130557523KIAA1305 proteinHypothetical protein-2.19-2.290.55
12PCDH95101Protocadherin 9Integral to membraneCell adhesion-2.18-2.300.50
13IKIP121457IKK interacting protein-2.23-2.330.83
14FLJ2196379611FLJ21963 proteinHypothetical protein-2.12-2.371.88
15SCRG111341Scrapie responsive protein 1Extracellular spaceNervous system development-2.14-2.540.74
16ULK29706Unc-51-like kinase 2 (C. elegans)Similar to a serine/threonine kinase in C. elegans-2.46-2.720.26
17LIFR3977Leukemia inhibitory factor receptorIntegral to plasma membraneReceptor activity-2.26-2.960.29
18BMF90427Bcl-2 modifying factorSequestrated by myosinApoptotic activator - protein binding1.002.952.40
19CD24857124CD248 antigen, endosialinMarker of stromal fibroblasts0.742.312.10
20PPM1E22843Protein phosphatase 1E (PP2C domain containing)Phosphatase0.762.332.06
21CARD822900Caspase recruitment domain family, member 8Involved in NFκB pathway-0.59-3.264.07
Table 2 Modulation of gene expression during mixed (E. coli and L. plantarum) infection
Biological processGene symbolGene ID NCBIGene nameFold change
Category 1: Regulation of transcriptionHOXD103236Homeobox D102.50
PHF751533PHD finger protein 7 (Zinc ion binding)2.44
EGR11958Early growth response 1-2.08
TRIM248805Tripartite motif-containing 24 (Zinc ion and DNA binding)-2.15
ENO12023Enolase 1, (alpha) (DNA binding)-2.34
Category 2: RNA processingSSB6741Sjogren syndrome antigen B (autoantigen La)-2.08
FUSIP110772FUS interacting protein (serine/arginine-rich) 1-2.21
NOLA510528Nucleolar protein 5A (56 kDa with KKE/D repeat)-2.27
DDX51655DEAD (Asp-Glu-Ala-Asp) box polypeptide 5-2.71
Category 3: Protein biosynthesis, folding, binding and transportNEURL9148Neuralized homolog (Intracellular protein transport)2.91
WDR36134430WD repeat domain 362.37
MTFMT123263Mitochondrial methionyl-tRNA formyltransferase2.04
ARF4378ADP-ribosylation factor 4-2.03
CEP579702Centrosomal protein 57 kDa-2.11
ETF12107Eukaryotic translation termination factor 1-2.27
HSPA1A3303Heat shock 70 kDa protein 1A-2.28
LGALS33958Lectin, galactoside-binding, soluble, 3 (galectin 3)-2.75
HSPH110808Heat shock 105 kDa/110 kDa protein 1-2.93
HSPA83312Heat shock 70 kDa protein 8-2.97
Category 4: Structural proteinAMPH273Amphiphysin (Actin cytoskeleton)3.04
MAP1B4131Microtubule-associated protein 1B2.13
ABCC1089845ATP-binding cassette, sub-family C (CFTR/MRP), member 10-2.05
SLC26A21836Solute carrier family 26 (sulfate transporter), member 2-2.06
TUBB2A7280Tubulin, beta 2A-2.15
Category 5: MetabolismC5orf1479770Chromosome 5 open reading frame 142.91
NAV289797Neuron navigator 22.83
SLC24A4123041Solute carrier family 24 (sodium/potassium/calcium), member 42.35
PLEKHM223207Pleckstrin homology domain containing, family M, member 22.10
TWF15756Twinfilin, actin-binding protein, homolog 1 (Tyrosin kinase)-2.01
AKR1C11645Aldo-keto reductase 1, member C1 (Bile acid binding)-2.09
HMGCR31563-hydroxy-3-methylglutaryl-Coenzyme A reductase-2.10
DC258505DC2 protein (Glycotransferase activity)-2.12
GSTA12938Glutathione S-transferase A1-2.15
GAPD2597Glyceraldehyde-3-phosphate dehydrogenase-2.16
GCLC2729Glutamate-cysteine ligase, catalytic subunit-2.21
SRM6723Spermidine synthase-2.39
HSP90AA13320Heat shock protein 90 kDa alpha (cytosolic), class A member 1-2.46
AHCY191S-adenosylhomocysteine hydrolase-2.48
MAT2A4144Methionine adenosyltransferase II, alpha-2.74
Category 6: Cell physiologyNCF44689Neutrophil cytosolic factor 4, 40 kDa2.39
CYCS54205Cytochrome c, somatic-2.02
DBI1622GABA receptor modulator, acyl-Coenzyme A binding protein-2.25
ATP5G3518ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3-2.26
HSPA1L3305Heat shock 70 kDa protein 1-like-2.26
Category 7: Cell proliferationFOSL18061FOS-like antigen 1 (transcription factor activity)-2.09
FGG2266Fibrinogen gamma chain-2.36
FGG2244Fibrinogen beta chain-2.45
Category 8: Cell adhesionNELL24753NEL-like 2 (Calcium ion binding)2.25
ITGB33690Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)2.11
RHOB388Ras homolog gene family, member B-2.19
ADRM111047Adhesion regulating molecule 1-2.25
Category 9: UbiquitinationUBE2N7334Ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)-2.02
UBE2S27338Ubiquitin-conjugating enzyme E2S-2.05
ANAPC751434Anaphase promoting complex subunit 7-2.15
CACYBP27101Calcyclin binding protein-2.18
UBA527311Ubiquitin A-52 residue ribosomal protein fusion product 1-2.29
COL6A31293Collagen, type VI, alpha 32.33
RPS3A6189Ribosomal protein S3A-2.08
TWF15756Twinfilin, actin-binding protein, homolog 1 (Tyrosin kinase)-2.01
AKR1C11645Aldo-keto reductase 1, member C1 (Bile acid binding)-2.09
Table 3 Primers used for RT-PCR
Gene symbolGene ID (NCBI)Gene nameGene rolePrimerPrimer sequence 5’-3’
BMF90427Bcl2 modifying factor, transcript variant 1Has a single Bcl2 homology domain 3 (BH3), binds Bclk2 proteins and functions as an apoptotic activatorFGCTTCAGTTGCATTGCAGACCAGTT
RAGAGCCCTTGGGAATTCTCACCAT
CD24857124CD248 antigen = endosialinA gene regulated by the cell density in vitro. Has a calcium binding domainFTCAACTACGTTGGTGGCTTCGAGT
RAGTTGGGATAATGGGAAGCTGGGT
PPM1E22843Protein phosphatase 1EMember of the PP2C family of Ser/Thr phosphatases known to be negative regulators of stress response pathwaysFATGCCTCCATTCACCTCCACGTTA
RTGTCATAGAAGCCATCACAGGCCA
FXYD35349FXY domain containing ion transport reg. 3The protein encoded by this gene may function as a chloride channel or as a chloride channel regulatorFAATGCAAGTTTGGCCAGAAGTCCG
RTTGCATATGAGGTCCCATGGCTGA
OAS249392’-5’-oligoadenylate synthetase 2This enzyme family plays a significant role in the inhibition of cellular protein synthesisFAGAAGCCAACGTGACATCCTCGAT
RTGCTGGAGTTCAGTGAAGCAGACT
FY2532Duffy blood group antigenHelps in leukocyte recruitment to sites of inflammation by facilitating movement of chemokines across the endotheliumFTGACTCTGCACTGCCCTTCTTCAT
RTTGACAACAGCAACAGCTTGGACC
CERK64781Ceramide kinaseIntegral to membranes, has roles in arachidonic acid release and production of eicosanoidsFTGAGAAGAAACGGTGGTTGGGTCT
RAGCATTTCCGGATGAGGATGAGGT
HPSE10855HeparanaseCell surface expression and secretion markedly promote tumor angiogenesis and metastasisFACCTTTGCAGCTGGCTTTATGTGG
RCTTGCACGCTTGCCATTAACACCT
GAPDH2597Glyceraldehyde-3-phosphate dehydrogenaseUsed as referenceFGACCACAGTCCATGCCATCAC
RGAGCTTCAGAAAGTGGTCGTTGA


Write to the Help Desk