©2007 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 21, 2007; 13(47): 6370-6378
Published online Dec 21, 2007. doi: 10.3748/wjg.v13.i47.6370
Published online Dec 21, 2007. doi: 10.3748/wjg.v13.i47.6370
Table 1 Common genes induced by bacterial treatment (Seventeen genes were influenced by both E. coli and L. plantarum and four genes by both E. coli and combination treatment)
| Nr. | Gene symbol | Gene ID NCBI | Gene name | Location | Function | Relative fold modification | ||
| L.p. | E.c. | Mix | ||||||
| 1 | GPR34 | 2857 | G protein-coupled receptor 34 | Integral to plasma membrane | G-protein coupled receptor activity | 2.43 | 3.03 | -0.53 |
| 2 | GTPBP4 | 23560 | GTP binding protein 4 | Nucleus | Ribosome biogenesis - small GTPase mediated signal transduction | 2.00 | 2.91 | -0.30 |
| 3 | TFPI2 | 7980 | Tissue factor pathway inhibitor 2 | Extracellular matrix | Serine-type endopeptidase inhibitor activity | 2.10 | 2.93 | -0.27 |
| 4 | CYP26A1 | 1592 | Cytochrome P450, family 26,subfamily A, polypeptide 1 | Membrane | Metal ion binding | 2.31 | 2.39 | -0.88 |
| 5 | ZNF35 | 7584 | Zinc finger protein 35 (clone HF.10) | Nucleus | Transcription factor activity | 2.18 | 2.19 | -0.66 |
| 6 | RTTN | 25914 | Rotatin | required for left-right specification in mouse embryos | 2.21 | 2.13 | -0.58 | |
| 7 | FXYD3 | 5349 | FXYD domain containing ion transport regulator 3 | Membrane | Chloride channel activity | 2.44 | 2.03 | -0.15 |
| 8 | CYYR1 | 116159 | Cysteine/tyrosine-rich 1 | Integral to membrane | Molecular function unknown | -2.30 | -2.20 | 1.05 |
| 9 | BFAR | 512836 | Bifunctional apoptosis regulator | Apoptosis regulator | -2.40 | -2.17 | 1.06 | |
| 10 | C19orf4 | 25789 | Chromosome 19 open reading frame 4 | Integral to, membrane | Molecular function unknown | -2.51 | -2.28 | 0.19 |
| 11 | KIAA1305 | 57523 | KIAA1305 protein | Hypothetical protein | -2.19 | -2.29 | 0.55 | |
| 12 | PCDH9 | 5101 | Protocadherin 9 | Integral to membrane | Cell adhesion | -2.18 | -2.30 | 0.50 |
| 13 | IKIP | 121457 | IKK interacting protein | -2.23 | -2.33 | 0.83 | ||
| 14 | FLJ21963 | 79611 | FLJ21963 protein | Hypothetical protein | -2.12 | -2.37 | 1.88 | |
| 15 | SCRG1 | 11341 | Scrapie responsive protein 1 | Extracellular space | Nervous system development | -2.14 | -2.54 | 0.74 |
| 16 | ULK2 | 9706 | Unc-51-like kinase 2 (C. elegans) | Similar to a serine/threonine kinase in C. elegans | -2.46 | -2.72 | 0.26 | |
| 17 | LIFR | 3977 | Leukemia inhibitory factor receptor | Integral to plasma membrane | Receptor activity | -2.26 | -2.96 | 0.29 |
| 18 | BMF | 90427 | Bcl-2 modifying factor | Sequestrated by myosin | Apoptotic activator - protein binding | 1.00 | 2.95 | 2.40 |
| 19 | CD248 | 57124 | CD248 antigen, endosialin | Marker of stromal fibroblasts | 0.74 | 2.31 | 2.10 | |
| 20 | PPM1E | 22843 | Protein phosphatase 1E (PP2C domain containing) | Phosphatase | 0.76 | 2.33 | 2.06 | |
| 21 | CARD8 | 22900 | Caspase recruitment domain family, member 8 | Involved in NFκB pathway | -0.59 | -3.26 | 4.07 | |
Table 2 Modulation of gene expression during mixed (E. coli and L. plantarum) infection
| Biological process | Gene symbol | Gene ID NCBI | Gene name | Fold change |
| Category 1: Regulation of transcription | HOXD10 | 3236 | Homeobox D10 | 2.50 |
| PHF7 | 51533 | PHD finger protein 7 (Zinc ion binding) | 2.44 | |
| EGR1 | 1958 | Early growth response 1 | -2.08 | |
| TRIM24 | 8805 | Tripartite motif-containing 24 (Zinc ion and DNA binding) | -2.15 | |
| ENO1 | 2023 | Enolase 1, (alpha) (DNA binding) | -2.34 | |
| Category 2: RNA processing | SSB | 6741 | Sjogren syndrome antigen B (autoantigen La) | -2.08 |
| FUSIP1 | 10772 | FUS interacting protein (serine/arginine-rich) 1 | -2.21 | |
| NOLA5 | 10528 | Nucleolar protein 5A (56 kDa with KKE/D repeat) | -2.27 | |
| DDX5 | 1655 | DEAD (Asp-Glu-Ala-Asp) box polypeptide 5 | -2.71 | |
| Category 3: Protein biosynthesis, folding, binding and transport | NEURL | 9148 | Neuralized homolog (Intracellular protein transport) | 2.91 |
| WDR36 | 134430 | WD repeat domain 36 | 2.37 | |
| MTFMT | 123263 | Mitochondrial methionyl-tRNA formyltransferase | 2.04 | |
| ARF4 | 378 | ADP-ribosylation factor 4 | -2.03 | |
| CEP57 | 9702 | Centrosomal protein 57 kDa | -2.11 | |
| ETF1 | 2107 | Eukaryotic translation termination factor 1 | -2.27 | |
| HSPA1A | 3303 | Heat shock 70 kDa protein 1A | -2.28 | |
| LGALS3 | 3958 | Lectin, galactoside-binding, soluble, 3 (galectin 3) | -2.75 | |
| HSPH1 | 10808 | Heat shock 105 kDa/110 kDa protein 1 | -2.93 | |
| HSPA8 | 3312 | Heat shock 70 kDa protein 8 | -2.97 | |
| Category 4: Structural protein | AMPH | 273 | Amphiphysin (Actin cytoskeleton) | 3.04 |
| MAP1B | 4131 | Microtubule-associated protein 1B | 2.13 | |
| ABCC10 | 89845 | ATP-binding cassette, sub-family C (CFTR/MRP), member 10 | -2.05 | |
| SLC26A2 | 1836 | Solute carrier family 26 (sulfate transporter), member 2 | -2.06 | |
| TUBB2A | 7280 | Tubulin, beta 2A | -2.15 | |
| Category 5: Metabolism | C5orf14 | 79770 | Chromosome 5 open reading frame 14 | 2.91 |
| NAV2 | 89797 | Neuron navigator 2 | 2.83 | |
| SLC24A4 | 123041 | Solute carrier family 24 (sodium/potassium/calcium), member 4 | 2.35 | |
| PLEKHM2 | 23207 | Pleckstrin homology domain containing, family M, member 2 | 2.10 | |
| TWF1 | 5756 | Twinfilin, actin-binding protein, homolog 1 (Tyrosin kinase) | -2.01 | |
| AKR1C1 | 1645 | Aldo-keto reductase 1, member C1 (Bile acid binding) | -2.09 | |
| HMGCR | 3156 | 3-hydroxy-3-methylglutaryl-Coenzyme A reductase | -2.10 | |
| DC2 | 58505 | DC2 protein (Glycotransferase activity) | -2.12 | |
| GSTA1 | 2938 | Glutathione S-transferase A1 | -2.15 | |
| GAPD | 2597 | Glyceraldehyde-3-phosphate dehydrogenase | -2.16 | |
| GCLC | 2729 | Glutamate-cysteine ligase, catalytic subunit | -2.21 | |
| SRM | 6723 | Spermidine synthase | -2.39 | |
| HSP90AA1 | 3320 | Heat shock protein 90 kDa alpha (cytosolic), class A member 1 | -2.46 | |
| AHCY | 191 | S-adenosylhomocysteine hydrolase | -2.48 | |
| MAT2A | 4144 | Methionine adenosyltransferase II, alpha | -2.74 | |
| Category 6: Cell physiology | NCF4 | 4689 | Neutrophil cytosolic factor 4, 40 kDa | 2.39 |
| CYCS | 54205 | Cytochrome c, somatic | -2.02 | |
| DBI | 1622 | GABA receptor modulator, acyl-Coenzyme A binding protein | -2.25 | |
| ATP5G3 | 518 | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 | -2.26 | |
| HSPA1L | 3305 | Heat shock 70 kDa protein 1-like | -2.26 | |
| Category 7: Cell proliferation | FOSL1 | 8061 | FOS-like antigen 1 (transcription factor activity) | -2.09 |
| FGG | 2266 | Fibrinogen gamma chain | -2.36 | |
| FGG | 2244 | Fibrinogen beta chain | -2.45 | |
| Category 8: Cell adhesion | NELL2 | 4753 | NEL-like 2 (Calcium ion binding) | 2.25 |
| ITGB3 | 3690 | Integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) | 2.11 | |
| RHOB | 388 | Ras homolog gene family, member B | -2.19 | |
| ADRM1 | 11047 | Adhesion regulating molecule 1 | -2.25 | |
| Category 9: Ubiquitination | UBE2N | 7334 | Ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) | -2.02 |
| UBE2S | 27338 | Ubiquitin-conjugating enzyme E2S | -2.05 | |
| ANAPC7 | 51434 | Anaphase promoting complex subunit 7 | -2.15 | |
| CACYBP | 27101 | Calcyclin binding protein | -2.18 | |
| UBA52 | 7311 | Ubiquitin A-52 residue ribosomal protein fusion product 1 | -2.29 | |
| COL6A3 | 1293 | Collagen, type VI, alpha 3 | 2.33 | |
| RPS3A | 6189 | Ribosomal protein S3A | -2.08 | |
| TWF1 | 5756 | Twinfilin, actin-binding protein, homolog 1 (Tyrosin kinase) | -2.01 | |
| AKR1C1 | 1645 | Aldo-keto reductase 1, member C1 (Bile acid binding) | -2.09 |
Table 3 Primers used for RT-PCR
| Gene symbol | Gene ID (NCBI) | Gene name | Gene role | Primer | Primer sequence 5’-3’ |
| BMF | 90427 | Bcl2 modifying factor, transcript variant 1 | Has a single Bcl2 homology domain 3 (BH3), binds Bclk2 proteins and functions as an apoptotic activator | F | GCTTCAGTTGCATTGCAGACCAGTT |
| R | AGAGCCCTTGGGAATTCTCACCAT | ||||
| CD248 | 57124 | CD248 antigen = endosialin | A gene regulated by the cell density in vitro. Has a calcium binding domain | F | TCAACTACGTTGGTGGCTTCGAGT |
| R | AGTTGGGATAATGGGAAGCTGGGT | ||||
| PPM1E | 22843 | Protein phosphatase 1E | Member of the PP2C family of Ser/Thr phosphatases known to be negative regulators of stress response pathways | F | ATGCCTCCATTCACCTCCACGTTA |
| R | TGTCATAGAAGCCATCACAGGCCA | ||||
| FXYD3 | 5349 | FXY domain containing ion transport reg. 3 | The protein encoded by this gene may function as a chloride channel or as a chloride channel regulator | F | AATGCAAGTTTGGCCAGAAGTCCG |
| R | TTGCATATGAGGTCCCATGGCTGA | ||||
| OAS2 | 4939 | 2’-5’-oligoadenylate synthetase 2 | This enzyme family plays a significant role in the inhibition of cellular protein synthesis | F | AGAAGCCAACGTGACATCCTCGAT |
| R | TGCTGGAGTTCAGTGAAGCAGACT | ||||
| FY | 2532 | Duffy blood group antigen | Helps in leukocyte recruitment to sites of inflammation by facilitating movement of chemokines across the endothelium | F | TGACTCTGCACTGCCCTTCTTCAT |
| R | TTGACAACAGCAACAGCTTGGACC | ||||
| CERK | 64781 | Ceramide kinase | Integral to membranes, has roles in arachidonic acid release and production of eicosanoids | F | TGAGAAGAAACGGTGGTTGGGTCT |
| R | AGCATTTCCGGATGAGGATGAGGT | ||||
| HPSE | 10855 | Heparanase | Cell surface expression and secretion markedly promote tumor angiogenesis and metastasis | F | ACCTTTGCAGCTGGCTTTATGTGG |
| R | CTTGCACGCTTGCCATTAACACCT | ||||
| GAPDH | 2597 | Glyceraldehyde-3-phosphate dehydrogenase | Used as reference | F | GACCACAGTCCATGCCATCAC |
| R | GAGCTTCAGAAAGTGGTCGTTGA |
-
Citation: Panigrahi P, Braileanu GT, Chen H, Stine OC. Probiotic bacteria change
Escherichia coli -induced gene expression in cultured colonocytes: Implications in intestinal pathophysiology. World J Gastroenterol 2007; 13(47): 6370-6378 - URL: https://www.wjgnet.com/1007-9327/full/v13/i47/6370.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i47.6370