©2007 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 28, 2007; 13(24): 3323-3332
Published online Jun 28, 2007. doi: 10.3748/wjg.v13.i24.3323
Published online Jun 28, 2007. doi: 10.3748/wjg.v13.i24.3323
Table 1 Primer and probe sequences used to validate the microarray analysis by quantitative RT-PCR
| Genes | Primer sequences | Tm | Amplifiedproducts |
| β-actin | FP: CCTGGCACCCAGCACAAT | 58°C | 221 bp |
| RP: GCTGATCCACATCTGCTGGAA | 58°C | ||
| Probe: ATCAAGATCATTGCTCCTCCTGAGCGC | 68°C | ||
| jun | FP: TGCAAAGATGGAAACGACCTT | 58°C | 76 bp |
| RP: GCCGTAGGCGCCACTCT | 59°C | ||
| Probe: TACGACGATGCCCTCAACGCCTC | 68°C | ||
| myc | FP: CCCCTAGTGCTGCATGAAGAG | 59°C | 95 bp |
| RP: TCCACAGACACCACATCAATTTC | 58°C | ||
| Probe: CACCAGCAGCGACTCTGAAGAAGAACA | 68°C | ||
| tp53 | FP: ATGAGGCCTTGGAATTAAAGGAT | 58°C | 98 bp |
| RP: CGTAGACTGGCCCTTCTTGGT | 59°C | ||
| Probe: CAGGGCTCACTCCAGCTACCCGAA | 68°C |
Table 2 Expression abundance of 121 liver tumor-associated genes during liver regeneration
| Name | Gene | Associated | Fold | Comparison | |
| Abbr. | to | difference | LT. | RRL. | |
| The same in gene expression trend | |||||
| Cyclin A2 | *Ccna2 | 2 | 45.1 | ↑ | ↑ |
| WEE1 homolog | Wee1 | 2 | 20.9 | ↑ | ↑ |
| Cyclin E1 | Ccne1 | 2 | 18.5 | ↑ | ↑ |
| Proliferating cell nuclear antigen | Pcna | 2 | 10.6 | ↑ | ↑ |
| Smoothened homolog | Smo | 1,2 | 3 | ↑ | ↑ |
| Protein NIMA-interacting 1 | Pin1 | 2 | 2.5 | ↑ | ↑ |
| Cyclin-dependent kinase 4 | Cdk4 | 2 | 2.5 | ↑ | ↑ |
| NIMA (never in mitosis gene a)-related kinase 6 | Nek6 | 2 | 2.3 | ↑ | ↑ |
| Aryl-hydrocarbon receptor | Ahr | 1 | 2.2 | ↑ | ↑ |
| Serpin peptidase inhibitor, clade E, member 1 | Serpine1 | 2 | 16.7 | ↑ | ↑ |
| Heat shock 27 kDa protein 1 | Hspb1 | 2 | 11 | ↑ | ↑ |
| Transforming growth factor, beta 1 | Tgfb1 | 2 | 4 | ↑ | ↑ |
| Granulin | Grn | 2 | 2.3 | ↑ | ↑ |
| Myeloid cell leukemia sequence 1 | Mcl1 | 2,3 | 4.3 | ↑ | ↑ |
| WNT1 inducible signaling pathway protein 1 | Wisp1 | 2,3 | 14.9 | ↑ | ↑ |
| Selectin E | Sele | 2 | 12.9 | ↑ | ↑ |
| Metastasis associated 1 | Mta1 | 2 | 9.6 | ↑ | ↑ |
| TIMP metallopeptidase inhibitor 1 | Timp1 | 2 | 8.6 | ↑ | ↑ |
| Integrin, alpha V | Itgav | 2 | 5.2 | ↑ | ↑ |
| Discs, large homolog 7 | Dlg7 | 2 | 4.3 | ↑ | ↑ |
| Lectin, galactoside-binding, soluble, 1 | Lgals1 | 2 | 3.7 | ↑ | ↑ |
| ADAM metallopeptidase domain 17 | Adam17 | 2 | 2.7 | ↑ | ↑ |
| Integrin, beta 1 | Itgb1 | 2 | 2.6 | ↑ | ↑ |
| Calponin 1, basic, smooth muscle | Cnn1 | 2 | 7 | ↑ | ↑ |
| Macrophage migration inhibitory factor | Mif | 2 | 3.2 | ↑ | ↑ |
| Collagen, type XVIII, alpha 1 | Col18a1 | 2 | 3.1 | ↑ | ↑ |
| Connective tissue growth factor | *Ctgf | 2 | 13.9 | ↑ | ↑ |
| Hexokinase 2 | Hk2 | 2 | 8.9 | ↑ | ↑ |
| Chemokine (C-C motif) ligand 20 | Ccl20 | 2 | 8 | ↑ | ↑ |
| v-jun sarcoma virus 17 oncogene homolog | *Jun | 2 | 6.9 | ↑ | ↑ |
| Methyl-CpG binding domain protein 2 | Mbd2 | 2 | 3 | ↑ | ↑ |
| TERF1 (TRF1)-interacting nuclear factor 2 | Tinf2 | 1 | 2.8 | ↑ | ↑ |
| FMS-like tyrosine kinase 1 | *Flt1 | 2 | 2.3 | ↑ | ↑ |
| Proteasome 26S subunit, non-ATPase, 10 | Psmd10 | 2 | 2 | ↑ | ↑ |
| Phosphatase and tensin homolog | Pten | 1,2 | 0.5 | ↓ | ↓ |
| Cold shock domain protein A | Csda | 1 | 0.5 | ↓ | ↓ |
| cAMP responsive element binding protein 3-like 3 | Creb3l3 | 1 | 0.4 | ↓ | ↓ |
| v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog | Kit | 2 | 0.4 | ↓ | ↓ |
| Gap junction protein, beta 1, 32 kDa | Gjb1 | 1,2 | 0.2 | ↓ | ↓ |
| Trefoil factor 1 | Tff1 | 3 | 0.1 | ↓ | ↓ |
| Caspase 9, apoptosis-related cysteine peptidase | Casp9 | 2 | 0.5 | ↓ | ↓ |
| Deleted in liver cancer 1 | Dlc1 | 1,2 | 0.5 | ↓ | ↓ |
| B-cell CLL/lymphoma 2 | Bcl2 | 2 | 0.3 | ↓ | ↓ |
| Inhibitor of DNA binding 1 | Id1 | 1,2 | 0.3 | ↓ | ↓ |
| Protein tyrosine phosphatase, receptor type, H | Ptprh | 2 | 0.2 | ↓ | ↓ |
| CD74 molecule, major histocompatibility complex, class II invariant chain | Cd74 | 2 | 0.4 | ↓ | ↓ |
| Hepatocyte growth factor | *Hgf | 1,2 | 0.4 | ↓ | ↓ |
| Mannose-binding lectin (protein C) 2, soluble | Mbl2 | 2 | 0.2 | ↓ | ↓ |
| The contrary in gene expression trend | |||||
| Myelocytomatosis oncogene | Myc | 1,2 | 19.7 | ↓ | ↑ |
| Sprouty homolog 2 | Spry2 | 2 | 8.1 | ↓ | ↑ |
| Growth arrest and DNA-damage-inducible, beta | Gadd45b | 2 | 55.7 | ↓ | ↑ |
| Serine peptidase inhibitor, Kunitz type, 2 | Spint2 | 2 | 7.2 | ↓ | ↑ |
| MAD homolog 4 | Smad4 | 1,2 | 3 | ↓ | ↑ |
| Fibrinogen-like 1 | Fgl1 | 2 | 2.2 | ↓ | ↑ |
| Caspase 8, apoptosis-related cysteine peptidase | Casp8 | 2 | 10.6 | ↓ | ↑ |
| Interferon gamma | Ifng | 1,2 | 6.5 | ↓ | ↑ |
| Tumor protein p53 | Tp53 | 1,2,3 | 2.9 | ↓ | ↑ |
| Early growth response 1 | *Egr1 | 2 | 18.6 | ↓ | ↑ |
| Transcription factor 1, hepatic | Tcf1 | 2 | 6.8 | ↓ | ↑ |
| O-6-methylguanine-DNA methyltransferase | Mgmt | 2 | 4.3 | ↓ | ↑ |
| Glutathione S-transferase theta 1 | Gstt1 | 2 | 3.2 | ↓ | ↑ |
| Glutathione S-transferase M1 | Gstm1 | 2 | 2.2 | ↓ | ↑ |
| Wingless-type MMTV integration site family, member 1 | Wnt1 | 2 | 0.5 | ↑ | ↓ |
| SHC (Src homology 2 domain containing) | Shc1 | 2 | 0.5 | ↑ | ↓ |
| Transforming protein 1 | |||||
| Inhibitor of kappaB kinase beta | Ikbkb | 1,2 | 0.3 | ↑ | ↓ |
| FK506 binding protein 4, 59 kDa | Fkbp4 | 2 | 0.3 | ↑ | ↓ |
| Transcription factor 7-like 2 | Tcf7l2 | 2 | 0.2 | ↑ | ↓ |
| v-erb-b2 erythroblastic leukemia viral oncogene | Erbb2 | 3 | 0.1 | ↑ | ↓ |
| Homolog 2 | |||||
| Heat shock 70kDa protein 1A | Hspa1a | 2 | 0.2 | ↑ | ↓ |
| Heat shock 70kDa protein 5 | Hspa5 | 1,2 | 0.1 | ↑ | ↓ |
| High mobility group AT-hook 1 | Hmga1 | 2 | 0.4 | ↑ | ↓ |
| Ras homolog gene family, member C | Rhoc | 2 | 0.3 | ↑ | ↓ |
| Cortactin | Cttn | 2 | 0.1 | ↑ | ↓ |
| Serpin peptidase inhibitor, clade B, member 3 | Serpinb3 | 2 | 0.1 | ↑ | ↓ |
| Ephrin-B1 | Efnb1 | 2 | 0.4 | ↑ | ↓ |
| Coagulation factor II | F2 | 1,2 | 0.3 | ↑ | ↓ |
| Trefoil factor 3 | Tff3 | 2 | 0.3 | ↑ | ↓ |
| Forkhead box A2 | Foxa2 | 2 | 0.4 | ↑ | ↓ |
| Glycogen synthase kinase 3 beta | Gsk3b | 1,2 | 0.4 | ↑ | ↓ |
| ATP-binding cassette, sub-family B, member 1A | *Abcb1a | 1 | 0.2 | ↑ | ↓ |
| Solute carrier family 2 , member 1 | *Slc2a1 | 2 | 0.2 | ↑ | ↓ |
| Apolipoprotein E | *Apoe | 2 | 0.1 | ↑ | ↓ |
| The comparable in gene expression trend | |||||
| Lysosomal-associated protein transmembrane 4B | Laptm4b | 2 | 2.3,0.5 | ↑ | ↑↓ |
| Met proto-oncogene | *Met | 1,2,3 | 2.3,0.4 | ↑ | ↑↓ |
| Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105) | Nfkb1 | 2 | 2.3,0.4 | ↑ | ↑↓ |
| Acyl-CoA synthetase long-chain family member 4 | Acsl4 | 2 | 2.1,0.4 | ↑ | ↑↓ |
| X-box binding protein 1 | Xbp1 | 1 | 4.3,0.3 | ↑ | ↑↓ |
| Nerve growth factor, beta polypeptide | Ngfb | 2 | 3.7,0.5 | ↑ | ↑↓ |
| Stearoyl-Coenzyme A desaturase 1 | Scd1 | 1,2 | 3.5,0.3 | ↑ | ↑↓ |
| Telomerase reverse transcriptase | Tert | 1,2,3 | 5.3,0.3 | ↑ | ↑↓ |
| Telomeric repeat binding factor (NIMA-interacting) 1 | Terf1 | 1 | 2.2,0.4 | ↑ | ↑↓ |
| Cadherin 17 | Cdh17 | 2 | 26.1,0.2 | ↑ | ↑↓ |
| Glycoprotein (transmembrane) nmb | Gpnmb | 2 | 9.2,0.3 | ↑ | ↑↓ |
| Claudin 10 | Cldn10 | 2 | 6.5,0.3 | ↑ | ↑↓ |
| Plasminogen activator, urokinase | Plau | 2 | 3,0.4 | ↑ | ↑↓ |
| Secreted phosphoprotein 1 | Spp1 | 2,3 | 2.7,0.5 | ↑ | ↑↓ |
| Alpha-2-macroglobulin | *A2m | 2 | 46.2,0.4 | ↑ | ↑↓ |
| Chemokine (C-C motif) receptor 1 | Ccr1 | 2 | 27.9,0.4 | ↑ | ↑↓ |
| Matrix metallopeptidase 9 | Mmp9 | 1,2 | 9.5,0.5 | ↑ | ↑↓ |
| Angiopoietin 1 | *Angpt1 | 2 | 9.2,0.2 | ↑ | ↑↓ |
| Mucin 1, cell surface associated | Muc1 | 2,3 | 6.8,0.2 | ↑ | ↑↓ |
| Heparanase | *Hpse | 2 | 6.3,0.3 | ↑ | ↑↓ |
| Megalencephalic leukoencephalopathy with subcortical cysts 1 | Mlc1 | 2 | 4.3,0.4 | ↑ | ↑↓ |
| Kinase insert domain protein receptor | *Kdr | 2 | 2.4,0.4 | ↑ | ↑↓ |
| Prostaglandin-endoperoxide synthase 2 | Ptgs2 | 1,2,3 | 2.1,0.1 | ↑ | ↑↓ |
| Dual specificity phosphatase 1 | Dusp1 | 2 | 6,0.4 | ↓ | ↑↓ |
| Cyclin-dependent kinase inhibitor 1C | Cdkn1c | 2 | 2.8,0.1 | ↓ | ↑↓ |
| Growth arrest and DNA-damage-inducible, gamma | Gadd45g | 2 | 8,0.4 | ↓ | ↑↓ |
| Hepatic nuclear factor 4, alpha | Hnf4a | 2 | 4.5,0.1 | ↓ | ↑↓ |
| Runt-related transcription factor 3 | Runx3 | 1,2 | 4.3,0.5 | ↓ | ↑↓ |
| Insulin-like growth factor binding protein 3 | Igfbp3 | 1,2 | 2.7,0.4 | ↓ | ↑↓ |
| Suppressor of cytokine signaling 3 | *Socs3 | 2 | 2.5,0.1 | ↓ | ↑↓ |
| Suppressor of cytokine signaling 1 | *Socs1 | 1,2 | 2.4,0.5 | ↓ | ↑↓ |
| Fibroblast growth factor 2 | Fgf2 | 1,2 | 2.1,0.5 | ↓ | ↑↓ |
| Fragile histidine triad gene | Fhit | 1,2 | 7.8,0.1 | ↓ | ↑↓ |
| Gamma-glutamyltransferase 1 | Ggt1 | 2 | 3.4,0.2 | ↓ | ↑↓ |
| Bone morphogenetic protein 7 | Bmp7 | 2 | 3,0.4 | ↓ | ↑↓ |
| E74-like factor 1 (ets domain transcription factor) | Elf1 | 2 | 3,0.4 | ↓ | ↑↓ |
| CD80 molecule | Cd80 | 2 | 3,0.3 | ↓ | ↑↓ |
| Glycine N-methyltransferase | Gnmt | 2 | 2.5,0.4 | ↓ | ↑↓ |
| Acyl-Coenzyme A oxidase 1, palmitoyl | Acox1 | 2 | 2.3,0.5 | ↓ | ↑↓ |
- Citation: Xu CS, Zhang SB, Chen XG, Rahman S. Correlation analysis of liver tumor-associated genes with liver regeneration. World J Gastroenterol 2007; 13(24): 3323-3332
- URL: https://www.wjgnet.com/1007-9327/full/v13/i24/3323.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i24.3323