Correlation analysis of liver tumor-associated genes with liver regeneration

Table 1 Primer and probe sequences used to validate the microarray analysis by quantitative RT-PCR

Genes	Primer sequences	Tm	Amplifiedproducts
β-actin	FP: CCTGGCACCCAGCACAAT	58°C	221 bp
	RP: GCTGATCCACATCTGCTGGAA	58°C
	Probe: ATCAAGATCATTGCTCCTCCTGAGCGC	68°C
jun	FP: TGCAAAGATGGAAACGACCTT	58°C	76 bp
	RP: GCCGTAGGCGCCACTCT	59°C
	Probe: TACGACGATGCCCTCAACGCCTC	68°C
myc	FP: CCCCTAGTGCTGCATGAAGAG	59°C	95 bp
	RP: TCCACAGACACCACATCAATTTC	58°C
	Probe: CACCAGCAGCGACTCTGAAGAAGAACA	68°C
tp53	FP: ATGAGGCCTTGGAATTAAAGGAT	58°C	98 bp
	RP: CGTAGACTGGCCCTTCTTGGT	59°C
	Probe: CAGGGCTCACTCCAGCTACCCGAA	68°C

FP: forward primer; RP: reverse primer.

Table 2 Expression abundance of 121 liver tumor-associated genes during liver regeneration

Name	Gene	Associated	Fold	Comparison
	Abbr.	to	difference	LT.	RRL.
The same in gene expression trend
Cyclin A2	*Ccna2	2	45.1	↑	↑
WEE1 homolog	Wee1	2	20.9	↑	↑
Cyclin E1	Ccne1	2	18.5	↑	↑
Proliferating cell nuclear antigen	Pcna	2	10.6	↑	↑
Smoothened homolog	Smo	1,2	3	↑	↑
Protein NIMA-interacting 1	Pin1	2	2.5	↑	↑
Cyclin-dependent kinase 4	Cdk4	2	2.5	↑	↑
NIMA (never in mitosis gene a)-related kinase 6	Nek6	2	2.3	↑	↑
Aryl-hydrocarbon receptor	Ahr	1	2.2	↑	↑
Serpin peptidase inhibitor, clade E, member 1	Serpine1	2	16.7	↑	↑
Heat shock 27 kDa protein 1	Hspb1	2	11	↑	↑
Transforming growth factor, beta 1	Tgfb1	2	4	↑	↑
Granulin	Grn	2	2.3	↑	↑
Myeloid cell leukemia sequence 1	Mcl1	2,3	4.3	↑	↑
WNT1 inducible signaling pathway protein 1	Wisp1	2,3	14.9	↑	↑
Selectin E	Sele	2	12.9	↑	↑
Metastasis associated 1	Mta1	2	9.6	↑	↑
TIMP metallopeptidase inhibitor 1	Timp1	2	8.6	↑	↑
Integrin, alpha V	Itgav	2	5.2	↑	↑
Discs, large homolog 7	Dlg7	2	4.3	↑	↑
Lectin, galactoside-binding, soluble, 1	Lgals1	2	3.7	↑	↑
ADAM metallopeptidase domain 17	Adam17	2	2.7	↑	↑
Integrin, beta 1	Itgb1	2	2.6	↑	↑
Calponin 1, basic, smooth muscle	Cnn1	2	7	↑	↑
Macrophage migration inhibitory factor	Mif	2	3.2	↑	↑
Collagen, type XVIII, alpha 1	Col18a1	2	3.1	↑	↑
Connective tissue growth factor	*Ctgf	2	13.9	↑	↑
Hexokinase 2	Hk2	2	8.9	↑	↑
Chemokine (C-C motif) ligand 20	Ccl20	2	8	↑	↑
v-jun sarcoma virus 17 oncogene homolog	*Jun	2	6.9	↑	↑
Methyl-CpG binding domain protein 2	Mbd2	2	3	↑	↑
TERF1 (TRF1)-interacting nuclear factor 2	Tinf2	1	2.8	↑	↑
FMS-like tyrosine kinase 1	*Flt1	2	2.3	↑	↑
Proteasome 26S subunit, non-ATPase, 10	Psmd10	2	2	↑	↑
Phosphatase and tensin homolog	Pten	1,2	0.5	↓	↓
Cold shock domain protein A	Csda	1	0.5	↓	↓
cAMP responsive element binding protein 3-like 3	Creb3l3	1	0.4	↓	↓
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	Kit	2	0.4	↓	↓
Gap junction protein, beta 1, 32 kDa	Gjb1	1,2	0.2	↓	↓
Trefoil factor 1	Tff1	3	0.1	↓	↓
Caspase 9, apoptosis-related cysteine peptidase	Casp9	2	0.5	↓	↓
Deleted in liver cancer 1	Dlc1	1,2	0.5	↓	↓
B-cell CLL/lymphoma 2	Bcl2	2	0.3	↓	↓
Inhibitor of DNA binding 1	Id1	1,2	0.3	↓	↓
Protein tyrosine phosphatase, receptor type, H	Ptprh	2	0.2	↓	↓
CD74 molecule, major histocompatibility complex, class II invariant chain	Cd74	2	0.4	↓	↓
Hepatocyte growth factor	*Hgf	1,2	0.4	↓	↓
Mannose-binding lectin (protein C) 2, soluble	Mbl2	2	0.2	↓	↓
The contrary in gene expression trend
Myelocytomatosis oncogene	Myc	1,2	19.7	↓	↑
Sprouty homolog 2	Spry2	2	8.1	↓	↑
Growth arrest and DNA-damage-inducible, beta	Gadd45b	2	55.7	↓	↑
Serine peptidase inhibitor, Kunitz type, 2	Spint2	2	7.2	↓	↑
MAD homolog 4	Smad4	1,2	3	↓	↑
Fibrinogen-like 1	Fgl1	2	2.2	↓	↑
Caspase 8, apoptosis-related cysteine peptidase	Casp8	2	10.6	↓	↑
Interferon gamma	Ifng	1,2	6.5	↓	↑
Tumor protein p53	Tp53	1,2,3	2.9	↓	↑
Early growth response 1	*Egr1	2	18.6	↓	↑
Transcription factor 1, hepatic	Tcf1	2	6.8	↓	↑
O-6-methylguanine-DNA methyltransferase	Mgmt	2	4.3	↓	↑
Glutathione S-transferase theta 1	Gstt1	2	3.2	↓	↑
Glutathione S-transferase M1	Gstm1	2	2.2	↓	↑
Wingless-type MMTV integration site family, member 1	Wnt1	2	0.5	↑	↓
SHC (Src homology 2 domain containing)	Shc1	2	0.5	↑	↓
Transforming protein 1
Inhibitor of kappaB kinase beta	Ikbkb	1,2	0.3	↑	↓
FK506 binding protein 4, 59 kDa	Fkbp4	2	0.3	↑	↓
Transcription factor 7-like 2	Tcf7l2	2	0.2	↑	↓
v-erb-b2 erythroblastic leukemia viral oncogene	Erbb2	3	0.1	↑	↓
Homolog 2
Heat shock 70kDa protein 1A	Hspa1a	2	0.2	↑	↓
Heat shock 70kDa protein 5	Hspa5	1,2	0.1	↑	↓
High mobility group AT-hook 1	Hmga1	2	0.4	↑	↓
Ras homolog gene family, member C	Rhoc	2	0.3	↑	↓
Cortactin	Cttn	2	0.1	↑	↓
Serpin peptidase inhibitor, clade B, member 3	Serpinb3	2	0.1	↑	↓
Ephrin-B1	Efnb1	2	0.4	↑	↓
Coagulation factor II	F2	1,2	0.3	↑	↓
Trefoil factor 3	Tff3	2	0.3	↑	↓
Forkhead box A2	Foxa2	2	0.4	↑	↓
Glycogen synthase kinase 3 beta	Gsk3b	1,2	0.4	↑	↓
ATP-binding cassette, sub-family B, member 1A	*Abcb1a	1	0.2	↑	↓
Solute carrier family 2 , member 1	*Slc2a1	2	0.2	↑	↓
Apolipoprotein E	*Apoe	2	0.1	↑	↓
The comparable in gene expression trend
Lysosomal-associated protein transmembrane 4B	Laptm4b	2	2.3,0.5	↑	↑↓
Met proto-oncogene	*Met	1,2,3	2.3,0.4	↑	↑↓
Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105)	Nfkb1	2	2.3,0.4	↑	↑↓
Acyl-CoA synthetase long-chain family member 4	Acsl4	2	2.1,0.4	↑	↑↓
X-box binding protein 1	Xbp1	1	4.3,0.3	↑	↑↓
Nerve growth factor, beta polypeptide	Ngfb	2	3.7,0.5	↑	↑↓
Stearoyl-Coenzyme A desaturase 1	Scd1	1,2	3.5,0.3	↑	↑↓
Telomerase reverse transcriptase	Tert	1,2,3	5.3,0.3	↑	↑↓
Telomeric repeat binding factor (NIMA-interacting) 1	Terf1	1	2.2,0.4	↑	↑↓
Cadherin 17	Cdh17	2	26.1,0.2	↑	↑↓
Glycoprotein (transmembrane) nmb	Gpnmb	2	9.2,0.3	↑	↑↓
Claudin 10	Cldn10	2	6.5,0.3	↑	↑↓
Plasminogen activator, urokinase	Plau	2	3,0.4	↑	↑↓
Secreted phosphoprotein 1	Spp1	2,3	2.7,0.5	↑	↑↓
Alpha-2-macroglobulin	*A2m	2	46.2,0.4	↑	↑↓
Chemokine (C-C motif) receptor 1	Ccr1	2	27.9,0.4	↑	↑↓
Matrix metallopeptidase 9	Mmp9	1,2	9.5,0.5	↑	↑↓
Angiopoietin 1	*Angpt1	2	9.2,0.2	↑	↑↓
Mucin 1, cell surface associated	Muc1	2,3	6.8,0.2	↑	↑↓
Heparanase	*Hpse	2	6.3,0.3	↑	↑↓
Megalencephalic leukoencephalopathy with subcortical cysts 1	Mlc1	2	4.3,0.4	↑	↑↓
Kinase insert domain protein receptor	*Kdr	2	2.4,0.4	↑	↑↓
Prostaglandin-endoperoxide synthase 2	Ptgs2	1,2,3	2.1,0.1	↑	↑↓
Dual specificity phosphatase 1	Dusp1	2	6,0.4	↓	↑↓
Cyclin-dependent kinase inhibitor 1C	Cdkn1c	2	2.8,0.1	↓	↑↓
Growth arrest and DNA-damage-inducible, gamma	Gadd45g	2	8,0.4	↓	↑↓
Hepatic nuclear factor 4, alpha	Hnf4a	2	4.5,0.1	↓	↑↓
Runt-related transcription factor 3	Runx3	1,2	4.3,0.5	↓	↑↓
Insulin-like growth factor binding protein 3	Igfbp3	1,2	2.7,0.4	↓	↑↓
Suppressor of cytokine signaling 3	*Socs3	2	2.5,0.1	↓	↑↓
Suppressor of cytokine signaling 1	*Socs1	1,2	2.4,0.5	↓	↑↓
Fibroblast growth factor 2	Fgf2	1,2	2.1,0.5	↓	↑↓
Fragile histidine triad gene	Fhit	1,2	7.8,0.1	↓	↑↓
Gamma-glutamyltransferase 1	Ggt1	2	3.4,0.2	↓	↑↓
Bone morphogenetic protein 7	Bmp7	2	3,0.4	↓	↑↓
E74-like factor 1 (ets domain transcription factor)	Elf1	2	3,0.4	↓	↑↓
CD80 molecule	Cd80	2	3,0.3	↓	↑↓
Glycine N-methyltransferase	Gnmt	2	2.5,0.4	↓	↑↓
Acyl-Coenzyme A oxidase 1, palmitoyl	Acox1	2	2.3,0.5	↓	↑↓

Asterisks represent the reported genes associated with liver regeneration; LT: liver tumor; RRL: rat regenerating liver; 1: hepatocarcinogenesis; 2: hepatocellular carcinoma; 3: cholangiocarcinoma. ↑ represents genes up-regulated, ↓ down-regulated, and ↑↓ up-regulated at some time points and down-regulated at others during liver regeneration. Gene expression changes in liver tumors were obtained from scientific articles, and expression changes during liver regeneration were the result of microarray detection.