Copyright
©2007 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 14, 2007; 13(22): 3071-3079
Published online Jun 14, 2007. doi: 10.3748/wjg.v13.i22.3071
Published online Jun 14, 2007. doi: 10.3748/wjg.v13.i22.3071
Table 1 Primers for gene expression analysis in MLN64-overexpressing mouse livers
| Gene | Primers | Fragment size |
| bax | TATTGGTGAGTCGGATTGC (S) | 230 bp |
| TGGACGGTCAGTGTCTGG (AS) | ||
| mdm2 | CCAACATGTCTGTGTCTACCG (S) | 216 bp |
| ACAATGTGCTGCTGCTTCTC (AS) | ||
| mln64 | TCGACATCTTTGTTCTGGCT (S) | 148 bp |
| GAGCAACTCAGAAAGGATGAC (AS) | ||
| 18 S | GTAACCCGTTGAACCCCATT (S) | 151 bp |
| CCATCCAATCGGTAGTAGCG (AS) |
Table 2 Effects of MLN64 recombinant adenoviral infection on serum alanine aminotransferase and alkaline phosphatase (mean ± SE)
Table 3 Effects of MLN64 recombinant adenoviral infection on hepatic cholesterol levels, biliary bile flow, and lipid secretion (mean ± SE)
| Hepatic cholesterol | Biliary lipid secretion | ||||||
| Unesterified | Ester | Bile flow | Cholesterol | Bile salts | Phospholipids | ||
| Group | Liver weight | (mg/g liver weight) | (mg/g liver weight) | (μL/min/100 g body weight) | (nmol/min/100 g body weight) | (nmol/min/100 g body weight) | (nmol/min/100 g body weight) |
| Ad.E1Δ | 1.32 ± 0.04 (n = 11) | 1.97 ± 0.08 | 0.20 ± 0.08 | 9.43 ± 0.76 (n = 8) | 2.75 ± 0.33 | 254.1 ± 34.2 | 84.25 ± 5.5 |
| Ad.MLN64 | 1.14 ± 0.04 (n = 16)a | 2.38 ± 0.08a | 0.21 ± 0.07 | 4.14 ± 0.61a | 1.38 ± 0.19a | 308.5 ± 45.4 | 54.64 ± 13.5 |
- Citation: Tichauer JE, Morales MG, Amigo L, Galdames L, Klein A, Quiñones V, Ferrada C, R AA, Rio MC, Miquel JF, Rigotti A, Zanlungo S. Overexpression of the cholesterol-binding protein MLN64 induces liver damage in the mouse. World J Gastroenterol 2007; 13(22): 3071-3079
- URL: https://www.wjgnet.com/1007-9327/full/v13/i22/3071.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i22.3071
