BPG is committed to discovery and dissemination of knowledge
Helicobacter Pylori
Copyright ©2007 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 7, 2007; 13(21): 2923-2931
Published online Jun 7, 2007. doi: 10.3748/wjg.v13.i21.2923
Table 1 Sequences of cDNA primers for human IFN-γ, IL-4 and β-actin
TargetSequences (5’→3’)Length of amplicon (bp)
IFN-γForward: CTTTAAAGATGACCAGAGCATCCAA189 (372-560 NM000619.2)
Reverse: GGCGACAGTTCAGCCATCAC
IL-4Forward: GACTGTGCTCCGGCAGTTCTA182 (589-770 NM000589)
Reverse: CCAACGTACTCTGGTTGGCTTC
β-actinForward: ATTGCCGACAGGATGCAGA89 (991-1079 CR609136.1)
Reverse: GAGTACTTGCGCTCAGGAGGA
Table 2 The prevalence of H pylori infection and CagA classification
Pathological diagnosisGenderAgeH pylori positiveH pylori negative
MaleFemale(yr, mean ± SD)Overall (%)CagA+ (%)CagA- (%)
Normal mucosa (n = 61)313044.62 ± 12.4148 (78.69)37 (60.65)11 (18.03)13 (21.31)
Chronic gastritis (n = 268)12114744.53 ± 14.37232 (86.57)170 (63.43)62 (23.13)36 (13.43)
Gastric atrophy (n = 114)734151.60 ± 12.39104 (91.23)88 (77.19)16 (14.03)10 (8.77)
Intestinal metaplasia (n = 104)475750.69 ± 12.8195 (91.35)80 (76.92)15 (14.42)9 (8.65)
Dysplasia (n = 71)452654.23 ± 12.2565 (91.55)57 (80.28)8 (11.26)6 (8.45)
Gastric cancer (n = 93)702364.70 ± 11.3385 (91.40)74 (79.57)11 (11.83)8 (8.60)
Total (n = 711)38732450.18 ± 14.65629 (88.47)506 (71.16)123 (17.30)82 (11.53)
Table 3 Plasma cytokine contents in patients with CagA+ H pylori infection (mean ± SE, pg/mL)
Pathological diagnosisIFN-γIL-4IL-12IL-10IL-6IL-2
Normal mucosa (NM, n = 37)27.46 ± 1.0510.86 ± 0.6281.42 ± 1.8966.92 ± 2.1547.96 ± 1.9954.17 ± 1.09
Chronic gastritis (CG, n = 170)28.94 ± 0.5911.22 ± 0.4572.49 ± 0.9380.65 ± 0.9963.40 ± 1.5745.95 ± 0.49
Gastric atrophy (GA, n = 88)30.48 ± 0.7511.23 ± 0.3353.29 ± 0.79100.80 ± 1.6994.10 ± 2.5739.61 ± 0.69
Intestinal metaplasia (IM, n = 80)31.71 ± 1.0212.08 ± 0.5952.18 ± 0.94104.18 ± 1.90112.03 ± 2.6434.07 ± 0.54
Dysplasia (DP, n = 57)30.14 ± 1.0410.92 ± 0.3943.30 ± 1.10157.72 ± 2.64156.74 ± 3.6632.71 ± 0.81
Gastric cancer (GC, n = 74)31.00 ± 0.8411.03 ± 0.2939.10 ± 0.89196.65 ± 1.83159.32 ± 2.5728.39 ± 0.65
Table 4 Plasma cytokine contents in patients with CagA- H pylori infection (mean ± SE, pg/mL)
Pathological diagnosisIFN-γIL-4IL-12IL-10IL-6IL-2
Normal mucosa (NM, n = 11)
29.28 ± 0.54
11.07 ± 0.89
82.17 ± 4.59
67.29 ± 3.26
48.37 ± 4.01
54.11 ± 2.87
Chronic gastritis (CG, n = 62)
29.19 ± 1.18
10.89 ± 0.27
64.59 ± 3.10
80.25 ± 1.87
57.99 ± 2.61
53.14 ± 1.25
Gastric atrophy (GA, n = 16)
30.25 ± 2.01
10.67 ± 0.67
49.67 ± 3.28
91.28 ± 3.19
92.56 ± 5.79
42.33 ± 2.32
Intestinal metaplasia (IM, n = 15)
28.91 ± 2.23
11.08 ± 0.74
48.19 ± 2.99
98.11 ± 4.08
98.20 ± 5.92
40.98 ± 2.38
Dysplasia (DP, n = 8)
31.08 ± 2.19
11.01 ± 1.27
42.64 ± 5.49
157.09 ± 6.81
147.65 ± 6.89
34.79 ± 3.05
Gastric cancer (GC, n = 11)28.06 ± 2.4512.07 ± 0.9138.97 ± 3.29185.29 ± 9.38154.68 ± 6.7830.29 ± 2.11
Table 5 Plasma cytokine contents in patients without H pylori infection (mean ± SE, pg/mL)
Pathological diagnosisIFN-γIL-4IL-12IL-10IL-6IL-2
Normal mucosa (NM, n = 13)
31.83 ± 0.17
10.57 ± 0.68
80.84 ± 4.81
68.56 ± 3.87
49.53 ± 3.94
53.13 ± 1.48
Chronic gastritis (CG, n = 36)
29.10 ± 1.27
10.37 ± 0.30
68.57 ± 2.43
79.03 ± 1.64
57.66 ± 2.56
52.54 ± 1.41
Gastric atrophy (GA, n = 10)
29.06 ± 1.93
10.49 ± 0.58
51.14 ± 3.47
90.94 ± 3.63
91.08 ± 6.11
41.39 ± 2.18
Intestinal metaplasia (IM, n = 9)
28.57 ± 2.72
11.75 ± 0.61
50.97 ± 1.54
97.60 ± 3.53
96.35 ± 5.19
41.54 ± 0.99
Dysplasia (DP, n = 8)
31.59 ± 1.29
11.46 ± 0.58
43.10 ± 5.02
153.34 ± 6.12
149.92 ± 6.23
35.00 ± 2.04
Gastric cancer (GC, n = 6)27.04 ± 2.3011.91 ± 1.2640.06 ± 2.08181.36 ± 9.02153.04 ± 6.6330.95 ± 1.91