Copyright
©2007 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 7, 2007; 13(21): 2923-2931
Published online Jun 7, 2007. doi: 10.3748/wjg.v13.i21.2923
Published online Jun 7, 2007. doi: 10.3748/wjg.v13.i21.2923
Table 1 Sequences of cDNA primers for human IFN-γ, IL-4 and β-actin
| Target | Sequences (5’→3’) | Length of amplicon (bp) |
| IFN-γ | Forward: CTTTAAAGATGACCAGAGCATCCAA | 189 (372-560 NM000619.2) |
| Reverse: GGCGACAGTTCAGCCATCAC | ||
| IL-4 | Forward: GACTGTGCTCCGGCAGTTCTA | 182 (589-770 NM000589) |
| Reverse: CCAACGTACTCTGGTTGGCTTC | ||
| β-actin | Forward: ATTGCCGACAGGATGCAGA | 89 (991-1079 CR609136.1) |
| Reverse: GAGTACTTGCGCTCAGGAGGA |
Table 2 The prevalence of H pylori infection and CagA classification
| Pathological diagnosis | Gender | Age | H pylori positive | H pylori negative | |||
| Male | Female | (yr, mean ± SD) | Overall (%) | CagA+ (%) | CagA- (%) | ||
| Normal mucosa (n = 61) | 31 | 30 | 44.62 ± 12.41 | 48 (78.69) | 37 (60.65) | 11 (18.03) | 13 (21.31) |
| Chronic gastritis (n = 268) | 121 | 147 | 44.53 ± 14.37 | 232 (86.57) | 170 (63.43) | 62 (23.13) | 36 (13.43) |
| Gastric atrophy (n = 114) | 73 | 41 | 51.60 ± 12.39 | 104 (91.23) | 88 (77.19) | 16 (14.03) | 10 (8.77) |
| Intestinal metaplasia (n = 104) | 47 | 57 | 50.69 ± 12.81 | 95 (91.35) | 80 (76.92) | 15 (14.42) | 9 (8.65) |
| Dysplasia (n = 71) | 45 | 26 | 54.23 ± 12.25 | 65 (91.55) | 57 (80.28) | 8 (11.26) | 6 (8.45) |
| Gastric cancer (n = 93) | 70 | 23 | 64.70 ± 11.33 | 85 (91.40) | 74 (79.57) | 11 (11.83) | 8 (8.60) |
| Total (n = 711) | 387 | 324 | 50.18 ± 14.65 | 629 (88.47) | 506 (71.16) | 123 (17.30) | 82 (11.53) |
Table 3 Plasma cytokine contents in patients with CagA+ H pylori infection (mean ± SE, pg/mL)
| Pathological diagnosis | IFN-γ | IL-4 | IL-12 | IL-10 | IL-6 | IL-2 |
| Normal mucosa (NM, n = 37) | 27.46 ± 1.05 | 10.86 ± 0.62 | 81.42 ± 1.89 | 66.92 ± 2.15 | 47.96 ± 1.99 | 54.17 ± 1.09 |
| Chronic gastritis (CG, n = 170) | 28.94 ± 0.59 | 11.22 ± 0.45 | 72.49 ± 0.93 | 80.65 ± 0.99 | 63.40 ± 1.57 | 45.95 ± 0.49 |
| Gastric atrophy (GA, n = 88) | 30.48 ± 0.75 | 11.23 ± 0.33 | 53.29 ± 0.79 | 100.80 ± 1.69 | 94.10 ± 2.57 | 39.61 ± 0.69 |
| Intestinal metaplasia (IM, n = 80) | 31.71 ± 1.02 | 12.08 ± 0.59 | 52.18 ± 0.94 | 104.18 ± 1.90 | 112.03 ± 2.64 | 34.07 ± 0.54 |
| Dysplasia (DP, n = 57) | 30.14 ± 1.04 | 10.92 ± 0.39 | 43.30 ± 1.10 | 157.72 ± 2.64 | 156.74 ± 3.66 | 32.71 ± 0.81 |
| Gastric cancer (GC, n = 74) | 31.00 ± 0.84 | 11.03 ± 0.29 | 39.10 ± 0.89 | 196.65 ± 1.83 | 159.32 ± 2.57 | 28.39 ± 0.65 |
Table 4 Plasma cytokine contents in patients with CagA- H pylori infection (mean ± SE, pg/mL)
| Pathological diagnosis | IFN-γ | IL-4 | IL-12 | IL-10 | IL-6 | IL-2 |
| Normal mucosa (NM, n = 11) | 29.28 ± 0.54 | 11.07 ± 0.89 | 82.17 ± 4.59 | 67.29 ± 3.26 | 48.37 ± 4.01 | 54.11 ± 2.87 |
| Chronic gastritis (CG, n = 62) | 29.19 ± 1.18 | 10.89 ± 0.27 | 64.59 ± 3.10 | 80.25 ± 1.87 | 57.99 ± 2.61 | 53.14 ± 1.25 |
| Gastric atrophy (GA, n = 16) | 30.25 ± 2.01 | 10.67 ± 0.67 | 49.67 ± 3.28 | 91.28 ± 3.19 | 92.56 ± 5.79 | 42.33 ± 2.32 |
| Intestinal metaplasia (IM, n = 15) | 28.91 ± 2.23 | 11.08 ± 0.74 | 48.19 ± 2.99 | 98.11 ± 4.08 | 98.20 ± 5.92 | 40.98 ± 2.38 |
| Dysplasia (DP, n = 8) | 31.08 ± 2.19 | 11.01 ± 1.27 | 42.64 ± 5.49 | 157.09 ± 6.81 | 147.65 ± 6.89 | 34.79 ± 3.05 |
| Gastric cancer (GC, n = 11) | 28.06 ± 2.45 | 12.07 ± 0.91 | 38.97 ± 3.29 | 185.29 ± 9.38 | 154.68 ± 6.78 | 30.29 ± 2.11 |
Table 5 Plasma cytokine contents in patients without H pylori infection (mean ± SE, pg/mL)
| Pathological diagnosis | IFN-γ | IL-4 | IL-12 | IL-10 | IL-6 | IL-2 |
| Normal mucosa (NM, n = 13) | 31.83 ± 0.17 | 10.57 ± 0.68 | 80.84 ± 4.81 | 68.56 ± 3.87 | 49.53 ± 3.94 | 53.13 ± 1.48 |
| Chronic gastritis (CG, n = 36) | 29.10 ± 1.27 | 10.37 ± 0.30 | 68.57 ± 2.43 | 79.03 ± 1.64 | 57.66 ± 2.56 | 52.54 ± 1.41 |
| Gastric atrophy (GA, n = 10) | 29.06 ± 1.93 | 10.49 ± 0.58 | 51.14 ± 3.47 | 90.94 ± 3.63 | 91.08 ± 6.11 | 41.39 ± 2.18 |
| Intestinal metaplasia (IM, n = 9) | 28.57 ± 2.72 | 11.75 ± 0.61 | 50.97 ± 1.54 | 97.60 ± 3.53 | 96.35 ± 5.19 | 41.54 ± 0.99 |
| Dysplasia (DP, n = 8) | 31.59 ± 1.29 | 11.46 ± 0.58 | 43.10 ± 5.02 | 153.34 ± 6.12 | 149.92 ± 6.23 | 35.00 ± 2.04 |
| Gastric cancer (GC, n = 6) | 27.04 ± 2.30 | 11.91 ± 1.26 | 40.06 ± 2.08 | 181.36 ± 9.02 | 153.04 ± 6.63 | 30.95 ± 1.91 |
-
Citation: Wang SK, Zhu HF, He BS, Zhang ZY, Chen ZT, Wang ZZ, Wu GL. CagA+
H pylori infection is associated with polarization of T helper cell immune responses in gastric carcinogenesis. World J Gastroenterol 2007; 13(21): 2923-2931 - URL: https://www.wjgnet.com/1007-9327/full/v13/i21/2923.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i21.2923
