Copyright
©2007 Baishideng Publishing Group Co.
World J Gastroenterol. Apr 14, 2007; 13(14): 2094-2099
Published online Apr 14, 2007. doi: 10.3748/wjg.v13.i14.2094
Published online Apr 14, 2007. doi: 10.3748/wjg.v13.i14.2094
Table 1 Nucleotide sequences of specific primers and PCR conditions
| Target genes | GenBank accession | PCR products | Primer sequences | PCR conditions |
| Gastrin | M38653 | 315 bp | F: 5'- CCTACTGCCACAACAGTTAA -3' | 94°C, 30 s; 52°C, 30 s; 72 °C, 60 s; 32 cycles |
| R: 5'- CATCCATCCGTATGCTTC -3' | ||||
| Somatostatin | M25890 | 330 bp | F: 5'- ATGCTGTCCTGCCGTCTC -3' | 94°C, 30 s; 60°C, 30 s; 72 °C, 60 s; 30 cycles |
| R: 5'- CAGCCAGCTTTGCGTTCC -3' | ||||
| β-actin | AF122902 | 200 bp | F: 5'- CCCTGTGCTGCTCACCGA -3' | - |
| R: 5'- ACAGTGTGGGTGACCCCGTC -3' |
Table 2 G cells of gastric mucosa in adult rats (n = 8, mean ± SE)
Table 3 D cells of gastric mucosa in adult rats (n = 8, mean ± SE)
- Citation: Zong YF, Chen WH, Zhang YS, Zou SX. Effects of intra-gastric beta-casomorphin-7 on somatostatin and gastrin gene expression in rat gastric mucosa. World J Gastroenterol 2007; 13(14): 2094-2099
- URL: https://www.wjgnet.com/1007-9327/full/v13/i14/2094.htm
- DOI: https://dx.doi.org/10.3748/wjg.v13.i14.2094
