©2006 Baishideng Publishing Group Co.
World J Gastroenterol. Feb 7, 2006; 12(5): 686-690
Published online Feb 7, 2006. doi: 10.3748/wjg.v12.i5.686
Published online Feb 7, 2006. doi: 10.3748/wjg.v12.i5.686
Table 1 Primer sequence and fragment length
| Primer | Sequence | Fragment length (bp) | Annealin Temp (°C) |
| p125FAK | A: 5’TTCTTCTATCAACAGGTGAAG3’ | 632 | 55 |
| B: 5’CTGCGAGGTTCCATTCACCAG3’ | |||
| β-actin ’ | A: 5’GGCATGGGTCAGAAGGATTCC3 | 500 | 55 |
| B: 5’ATGTCACGCACGATTTCCCGC3’ |
Table 2 Effect of RZ on colony formation of BGC-823 cells
| Groups | CFE (%) | CIE (%) |
| Control group | 51.24 ± 6.8a | |
| Liposome group | 46.43 ± 8.6a | 9.38 |
| Keno-vector group | 45.32 ± 5.2a | 11.55 |
| Ribozyme group | 16.14 ± 3.5a | 68.5 |
- Citation: Guan GX, Jian HX, Lei DY, Lu HS, Zhang XF. Construction of retroviral vector of p125FAK specific ribozyme genes and its effects on BGC-823 cells. World J Gastroenterol 2006; 12(5): 686-690
- URL: https://www.wjgnet.com/1007-9327/full/v12/i5/686.htm
- DOI: https://dx.doi.org/10.3748/wjg.v12.i5.686
