©2006 Baishideng Publishing Group Co.
World J Gastroenterol. Jul 7, 2006; 12(25): 3999-4003
Published online Jul 7, 2006. doi: 10.3748/wjg.v12.i25.3999
Published online Jul 7, 2006. doi: 10.3748/wjg.v12.i25.3999
Table 1 Oligonucleotide primer pairs used for real-time quantitative PCR, binding site and expected size
| Primer | Sequence | GenBank No. | Product size (bp) |
| PAPfw | 5’ TGAATTATGTCAACTGGGAGAGG 3’ | NM-053289.1 | 318 |
| PAPrv | 5’ TTACTGCTTTCCAAGACATGAGG 3’ | ||
| rL13A/Fw | 5’ AAGCAGGTACTGCTGGG 3’ | X68282 | 261 |
| rL13A/Rv | 5’ CCAACACCTTGAGGCGTT 3’ |
Table 2 Histological changes in the pancreas of rats with caerulein-induced acute pancreatitis (mean±SE)
| Period | Zymogen granule depletion | Edema | PMN infiltration | Vacuolization | Acinar disorganization |
| 0 h | 0.25 ± 0.23a,b | 1.25 ± 0.31a,b | 0.00 ± 0.14a | 0.25 ± 0.26a | 0.5 ± 0.36a |
| 9 h | 1.00 ± 0.23b,c | 2.25 ± 0.31b,c | 0.75 ± 0.14b | 2.75 ± 0.26c | 0.75 ± 0.36a,b |
| 24 h | 1.40 ± 0.20c | 3.00 ± 0.28c | 0.60 ± 0.12b | 2.00 ± 0.24b | 1.00 ± 0.32a,b |
| 3 d | 3.00 ± 0.18e | 2.17 ± 0.25b,c | 0.67 ± 0.11b | 2.00 ± 0.22b | 1.33 ± 0.29a,b |
| 5 d | 2.00 ± 0.23c,d | 1.25 ± 0.31a,b | 0.00 ± 0.14a | 1.00 ± 0.26a,b | 0.75 ± 0.36a,b |
| 15 d | 2.57 ± 0.17d,e | 0.86 ± 0.23a | 0.00 ± 0.10a | 0.00 ± 0.20a | 2.14 ± 0.28b |
| 30 d | 1.60 ± 0.20c | 0.60 ± 0.83a | 0.00 ± 0.12a | 0.00 ± 0.24a | 0.80 ± 0.33a,b |
| 60 d | 0.00 ± 0.19a | 0.83 ± 0.25a | 0.00 ± 0.11a | 0.17 ± 0.22a | 0.66 ± 0.29a |
| 90 d | 0.25 ± 0.13a,b | 0.42 ± 0.18a | 0.00 ± 0.07a | 0.00 ± 0.15a | 0.92 ± 0.21a,b |
- Citation: Magaña-Gómez J, López-Cervantes G, Barca AMCL. Caerulin-induced pancreatitis in rats: Histological and genetic expression changes from acute phase to recuperation. World J Gastroenterol 2006; 12(25): 3999-4003
- URL: https://www.wjgnet.com/1007-9327/full/v12/i25/3999.htm
- DOI: https://dx.doi.org/10.3748/wjg.v12.i25.3999
