Copyright
©2006 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 28, 2006; 12(24): 3878-3882
Published online Jun 28, 2006. doi: 10.3748/wjg.v12.i24.3878
Published online Jun 28, 2006. doi: 10.3748/wjg.v12.i24.3878
Primer | Forward | Reverse | Product size |
Sequence 5’-3’ | Sequence 5’-3’ | ||
c-met | tgatgatgaggtggacaca | ctatggcaaggagcaaaga | 149 |
β-actin | aaatctggcaccacaccttc | ggggtgttgaaggtctcaaa | 139 |
- Citation: Yu J, Ohuchida K, Mizumoto K, Ishikawa N, Ogura Y, Yamada D, Egami T, Fujita H, Ohashi S, Nagai E, Tanaka M. Overexpression of c-met in the early stage of pancreatic carcinogenesis; altered expression is not sufficient for progression from chronic pancreatitis to pancreatic cancer. World J Gastroenterol 2006; 12(24): 3878-3882
- URL: https://www.wjgnet.com/1007-9327/full/v12/i24/3878.htm
- DOI: https://dx.doi.org/10.3748/wjg.v12.i24.3878