Copyright
©2006 Baishideng Publishing Group Co.
World J Gastroenterol. Jun 7, 2006; 12(21): 3344-3351
Published online Jun 7, 2006. doi: 10.3748/wjg.v12.i21.3344
Published online Jun 7, 2006. doi: 10.3748/wjg.v12.i21.3344
Table 1 Sense (S) and antisense (AS) primers used in quantitative RT-PCR analyses
Primer | Exon | Sequence (5’-3’) | Amplicon |
LCN2 (Lipocalin2) S | 1 | TGATCCCAGCCCCACCT | 74 bp |
LCN2 (Lipocalin2) AS | 2 | CCACTTCCCCTGAATTGGT | |
PLAT (tPA) S | 2 | TGGAGAGAAAACCTCTGCGAG | 72 bp |
PLAT (tPA) AS | 3 | CCATGATTGCTTCACAGCGT | |
KRT7 (Keratin7) S | 7 | CTCTGTGATGAATTCCACTGGTG | 72 bp |
KRT7 (Keratin7) AS | 8 | CCCATGGTTCCCCCGA | |
18S S | AAACGGCTACCACATCCAAG | 155 bp | |
18S AS | CCTCCAATGGATCCTCGTTA |
Table 2 Significantly overexpressed genes (over 2-fold) in malignant pancreas
Gene symbol | Gene description | Mean fold expression ratios | ||
Malignant | PCL/ | PT/ | ||
Panc/others | CCL | NormPanc | ||
PLAT | Plasminogen activator, tissue-type | 6.22 | 4.36 | 6.74 |
KRT7 | Keratin 7 | 5.72 | 4.92 | 3.97 |
CD74 | CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) | 5.44 | 1.61 | 8.00 |
MMP7 | Matrix metalloproteinase 7 (matrilysin, uterine) | 5.36 | 3.73 | 5.70 |
LCN2 | Lipocalin 2 (oncogene 24p3), NGAL | 5.25 | 8.32 | 3.36 |
HLA-G | HLA-G histocompatibility antigen, class I, G | 4.04 | 1.57 | 4.32 |
IGHG3 | Immunoglobulin heavy constant gamma 3 | 3.95 | 0.94 | 11.81 |
HLA-DRA | Major histocompatibility complex, class II, DR alpha | 3.70 | 1.57 | 7.01 |
TIMP1 | Tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor) | 3.50 | 1.61 | 9.20 |
ITGA3 | Integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) | 3.48 | 3.00 | 2.40 |
ITGB4 | Integrin, beta 4 | 3.36 | 1.16 | 4.34 |
KRT19 | Keratin 19 | 3.27 | 1.34 | 2.98 |
CTSD | Cathepsin D (lysosomal aspartyl protease) | 3.21 | 2.75 | 2.89 |
CASP4 | Caspase 4, apoptosis-related cysteine protease | 3.10 | 2.43 | 1.80 |
IGFBP3 | Insulin-like growth factor binding protein 3 | 3.08 | 3.53 | 1.87 |
PLAU | Plasminogen activator, urokinase | 3.08 | 2.83 | 2.01 |
MMP11 | Matrix metalloproteinase 11 (stromelysin 3) | 2.96 | 1.11 | 7.22 |
DTR | Diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor) | 2.84 | 1.74 | 3.33 |
CDKN1A | Cyclin-dependent kinase inhibitor 1A (p21, Cip1) | 2.76 | 1.65 | 3.17 |
LAMA4 | Laminin, alpha 4 | 2.74 | 2.14 | 3.30 |
ITGB8 | Integrin, beta 8 | 2.59 | 2.31 | 4.44 |
IFITM1 | Interferon induced transmembrane protein 1 (9-27) | 2.41 | 5.47 | 7.10 |
AXL | AXL receptor tyrosine kinase | 2.35 | 1.63 | 2.91 |
ITGAE | Integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide) | 2.31 | 1.58 | 3.56 |
CD59 | CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30, EL32 and G344) | 2.26 | 2.11 | 2.95 |
KRT10 | Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) | 2.09 | 2.18 | 1.60 |
CYR61 | Cysteine-rich, angiogenic inducer, 61 | 2.03 | 2.41 | 1.22 |
PTGES | Prostaglandin E synthase | 2.03 | 2.84 | 1.11 |
HIF1A | Hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) | 2.01 | 1.24 | 2.87 |
Table 3 Relative mRNA levels presented as 2[Ct(18S)-Ct(gene of interest)] (mean x 10-2±SEM)
- Citation: Laurell H, Bouisson M, Berthelémy P, Rochaix P, Déjean S, Besse P, Susini C, Pradayrol L, Vaysse N, Buscail L. Identification of biomarkers of human pancreatic adenocarcinomas by expression profiling and validation with gene expression analysis in endoscopic ultrasound-guided fine needle aspiration samples. World J Gastroenterol 2006; 12(21): 3344-3351
- URL: https://www.wjgnet.com/1007-9327/full/v12/i21/3344.htm
- DOI: https://dx.doi.org/10.3748/wjg.v12.i21.3344