BPG is committed to discovery and dissemination of knowledge
Rapid Communication
©2006 Baishideng Publishing Group Co.
World J Gastroenterol. Jan 14, 2006; 12(2): 306-312
Published online Jan 14, 2006. doi: 10.3748/wjg.v12.i2.306
Table 1 Primers for PCR analysis of transplastomic plants
NameSequence (5’-3’)Position
Hel-19atgtcaccacaaacagag57 595-57 6121
Hel-24atccaaaacgtccactgc59 005-59 0021
Hel-294agcccgtcatacttgaagctagac6 563-6 5872, 5 191-5 2153
Hel-297ataccaatgtcaaccaagccagcc2 008-2 0323
Hel-348gatgatcatagaagcccctttacc199-2222, 38 524-38 5471
Hel-354tgcaagcacgatttggggagag1 806-1 8273
Hel-355cagatcaatgtcgatcgtggctg6 856-6 8782, 4 900-4 9223
Hel-399tggcaaaacaagatgttgcggag38 341-38 3631
Hel-401gttctttaaattccgtgggtggtg36 683-36 7061
Hel-403agaaccaatttcgggattgggcac40 312-40 3351
Hel-720gtagaatgctagatgccc4 300-4 3173
Hel-721agctttggcgagctagttg7 388-7 4062
Table 2 Accumulation of pE2 leaves and seeds of WT and transplastomic plants (mean±SD)
PlantTissuepE2
(ng/µg TSP)(µg/g fresh weight)
WTLeavesndnd
Seedsndnd
E2-1Leaves1.090 ± 0.18213.273 ± 2.217
Seeds0.015 ± 0.0040.261 ± 0.060
E2-2Leaves0.630 ± 0.1335.912 ± 1.251
Seeds0.018 ± 0.0050.460 ± 0.093
Table 3 Antigenicity of plastid-derived pE2 in mice
GroupA450
Expt AExpt B
PBS0.1170.137
WT TSP0.1380.134
E2-1 TSP0.3870.779
E. coli TSP1.3672.62