©2006 Baishideng Publishing Group Co.
World J Gastroenterol. Jan 14, 2006; 12(2): 306-312
Published online Jan 14, 2006. doi: 10.3748/wjg.v12.i2.306
Published online Jan 14, 2006. doi: 10.3748/wjg.v12.i2.306
Table 1 Primers for PCR analysis of transplastomic plants
| Name | Sequence (5’-3’) | Position |
| Hel-19 | atgtcaccacaaacagag | 57 595-57 6121 |
| Hel-24 | atccaaaacgtccactgc | 59 005-59 0021 |
| Hel-294 | agcccgtcatacttgaagctagac | 6 563-6 5872, 5 191-5 2153 |
| Hel-297 | ataccaatgtcaaccaagccagcc | 2 008-2 0323 |
| Hel-348 | gatgatcatagaagcccctttacc | 199-2222, 38 524-38 5471 |
| Hel-354 | tgcaagcacgatttggggagag | 1 806-1 8273 |
| Hel-355 | cagatcaatgtcgatcgtggctg | 6 856-6 8782, 4 900-4 9223 |
| Hel-399 | tggcaaaacaagatgttgcggag | 38 341-38 3631 |
| Hel-401 | gttctttaaattccgtgggtggtg | 36 683-36 7061 |
| Hel-403 | agaaccaatttcgggattgggcac | 40 312-40 3351 |
| Hel-720 | gtagaatgctagatgccc | 4 300-4 3173 |
| Hel-721 | agctttggcgagctagttg | 7 388-7 4062 |
Table 2 Accumulation of pE2 leaves and seeds of WT and transplastomic plants (mean±SD)
| Plant | Tissue | pE2 | |
| (ng/µg TSP) | (µg/g fresh weight) | ||
| WT | Leaves | nd | nd |
| Seeds | nd | nd | |
| E2-1 | Leaves | 1.090 ± 0.182 | 13.273 ± 2.217 |
| Seeds | 0.015 ± 0.004 | 0.261 ± 0.060 | |
| E2-2 | Leaves | 0.630 ± 0.133 | 5.912 ± 1.251 |
| Seeds | 0.018 ± 0.005 | 0.460 ± 0.093 | |
Table 3 Antigenicity of plastid-derived pE2 in mice
| Group | A450 | |
| Expt A | Expt B | |
| PBS | 0.117 | 0.137 |
| WT TSP | 0.138 | 0.134 |
| E2-1 TSP | 0.387 | 0.779 |
| E. coli TSP | 1.367 | 2.62 |
- Citation: Zhou YX, Lee MYT, Ng JMH, Chye ML, Yip WK, Zee SY, Lam E. A truncated hepatitis E virus ORF2 protein expressed in tobacco plastids is immunogenic in mice. World J Gastroenterol 2006; 12(2): 306-312
- URL: https://www.wjgnet.com/1007-9327/full/v12/i2/306.htm
- DOI: https://dx.doi.org/10.3748/wjg.v12.i2.306
