©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Mar 7, 2005; 11(9): 1283-1286
Published online Mar 7, 2005. doi: 10.3748/wjg.v11.i9.1283
Published online Mar 7, 2005. doi: 10.3748/wjg.v11.i9.1283
Table 1 Primer sequences for conventional PCR.
| Primers | Sense primer (5’-3’) | Antisense primer (5’-3’) |
| TEM-1 | gtggcttcgagtgttattg | gaagagctccggatatttg |
| TEM-2 | agccatgatgaagactttgt | cttgaggtcactgttgacg |
| TEM-6 | acccgtgacgtcattttc | tgtacttgcttcgagcatc |
| TEM-7 | ggagcaggtcacgatgag | gtgaaactgcccttgtctt |
| TEM-7R | cttgattggcagtatggagt | gagatgtacatggtcccact |
| TEM-8 | catttcaagttgtcgtgaga | gacgcatattgttgttgaga |
Table 2 Primer sequences for quantitative PCR.
| Molecules | Sense primer (5’-3’) | Z primer (5’-3’) |
| TEM-1 | cttgcccactgggatgat | Actgaacgtgaccgtacaacctatgaatcctctgatgg |
| TEM-2 | agtctcaccttgagtgtggt | Actgaacctgaccgtacactcctccacagcatctctta |
| TEM-6 | acccgtgaggtcattttc | Actgaacctgaccgtacattcaaccttcccatagtcag |
| TEM-7 | agaacgaccacatcacctt | Actgaacctgaccgtacatggagagagttggagtcaa |
| TEM-7R | cttgattggcagtatggagt | Actgaacctgaccgtacagtctaccgccttgagaaag |
| TEM-8 | acagggtcctctgcagctt | Actgaacctgaccgtacactttcatgccaacttgttt |
Table 3 Expression of TEMs in colon tissues (percentage positive), using conventional PCR.
| Normal tissues (%) | Tumor tissues (%) | P | |
| TEM-1 | 38 | 95.5 | <0.01 |
| TEM-2 | 45 | 58.3 | >0.05 |
| TEM-6 | 35 | 56 | <0.04 |
| TEM-7 | 15 | 77.5 | <0.04 |
| TEM-7R | 12.5 | 79.5 | <0.03 |
| TEM-8 | 1 | 85 | <0.001 |
- Citation: Rmali K, Puntis M, Jiang W. Prognostic values of tumor endothelial markers in patients with colorectal cancer. World J Gastroenterol 2005; 11(9): 1283-1286
- URL: https://www.wjgnet.com/1007-9327/full/v11/i9/1283.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i9.1283
