BPG is committed to discovery and dissemination of knowledge
Brief Reports
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Feb 28, 2005; 11(8): 1200-1203
Published online Feb 28, 2005. doi: 10.3748/wjg.v11.i8.1200
Table 1 Primer sequences used for the amplification of HPV L1, HPV16 E6/E7, and HPV18 E6/E7 genes.
TargetPrimer sequenceApproximate size (bp)
HPV L1 gene(MY09)5' CGTCC{C/A}A{G/A}{G/A}GGA{T/A}ACTGATC 3’450
HPV L1 gene (MY11)5' GC{C/A}CAGGG {T/A} CAT AA{T/C}AATGG 3’450
HPV16 E6/E7 gene (sense)5' GAACAGCAATACAACAAACCCG 3’240
HPV16 E6/E7 gene (antisense)5' CCATGCATGATTACAGCTGG 3’240
HPV18 E6/E7 gene (sense)5' TGCCAGAAACCGTTGAATCC 3’250
HPV18 E6/E7 gene (antisense)5' CAATGTCTTGCAATGTTGCC 3’250