Copyright
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Feb 14, 2005; 11(6): 771-777
Published online Feb 14, 2005. doi: 10.3748/wjg.v11.i6.771
Published online Feb 14, 2005. doi: 10.3748/wjg.v11.i6.771
Table 1 Sequence of sense and antisense primers in reverse transcription-polymerase chain reaction (RT-PCR) analysis for MetAP-2, Bcl-2 and telomerase mRNA expression.
| Name | Sequence | Direction | Expected product size (bp) | PCR conditions for pair of primers |
| MetAP-2-S | TGGCGGGCGTGGAAGAGG | Sense | 282 | 1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min |
| MetAP-2-AS | GCACCATCACCATCACCATCTCC | Antisense | 282 | 1 cycle: 72 °C, 10 min; 4 °C overnight |
| Bcl-2-S | AGATGAAGACTCCGCGCCCCTCAGG | Sense | 566 | 1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min |
| Bcl-2-AS | CCAGGTATGCACCCAGAGTGATG | Antisense | 566 | 1 cycles: 72 °C, 1 min; 4 °C overnight |
| Telomerase-S | GACATGGAGAACAAGCTGTTTGC | Sense | 185 | 1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min |
| Telomerase-AS | ACAGGGAAGTTCACCACTGTC | Antisense | 185 | 1 cycle: 72 °C, 10 min; 4 °C overnight |
| GAPDH-S | ACCACAGTCCATGCCATCAC | Sense | 485 | 1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min |
| GAPDH-AS | TCCACCACCCTGTTGCTGTA | Antisense | 485 | 1 cycle: 72 °C, 10 min; 4 °C overnight |
Table 2 Body weight of rats at wk 20 and 24.
| Rats (n = 10) | Body weight (g) | ||
| 20th wk | 24th wk | ||
| Group B | DEN only | 398 | 400 |
| [386-409] | [384-411] | ||
| Group C | DEN + Fumagillin | 397 | 398 |
| [380-410] | [382-414] | ||
| P value | NS | NS | |
Table 3 Inhibitory effect of fumagillin on hepatic tumor growth and metastasis in LEW rats at wk 20 and 24.
| Treatment groups | Liver tumor (B/C-A) (g, median) | No. of HCC-involved organs1 | ||
| 20th wk | 24th wk | 20th wk | 24th wk | |
| Group B DEN only (n = 5) | 0.641 | 0.791 | 3 | 3 |
| [0.58-0.70] | [0.70-0.90] | [2-3] | [3-3] | |
| Group C DEN + Fumagillin (n = 5) | 0.37 | 0.39 | 1 | 1 |
| [0.35-0.42] | [0.35-0.47] | [1-2] | [1-2] | |
| P value | 0.009 | 0.009 | 0.007 | 0.004 |
Table 4 Comparison of MetAP-2 mRNA, Bcl-2 mRNA, telomerase mRNA and telomerase activity among the 3 groups of rats at wk 24.
| Parameters | Group | P value | ||||
| A (n = 3) | B (n = 5) | C (n = 5) | A vs B | A vs C | B vs C | |
| MetAP-2 mRNA | 0.34 | 0.5 | 0.58 | 0.025 | 0.025 | 0.047 |
| (0.32-0.36) | (0.33-0.70) | (0.40-0.73) | ||||
| Bcl-2 mRNA | 0 | 0.45 | 0.38 | 0.024 | 0.608 | 0.072 |
| (0-0.19) | (0.22-0.63) | (0-0.42) | ||||
| Telomerase mRNA | 0.3 | 0.43 | 0.34 | 0.025 | 0.655 | 0.016 |
| (0.29-0.32) | (0.35-0.47) | (0.29-0.37) | ||||
| Telomerase | 47.6 | 225 | 203.5 | 0.025 | 0.025 | 0.046 |
| Activity (%) | (46-71) | (187-310) | (94-292) | |||
-
Citation: Sheen IS, Jeng KS, Jeng WJ, Jeng CJ, Wang YC, Gu SL, Tseng SY, Chu CM, Lin CH, Chang KM. Fumagillin treatment of hepatocellular carcinoma in rats: An
in vivo study of antiangiogenesis. World J Gastroenterol 2005; 11(6): 771-777 - URL: https://www.wjgnet.com/1007-9327/full/v11/i6/771.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i6.771
