Fumagillin treatment of hepatocellular carcinoma in rats: An in vivo study of antiangiogenesis

Table 1 Sequence of sense and antisense primers in reverse transcription-polymerase chain reaction (RT-PCR) analysis for MetAP-2, Bcl-2 and telomerase mRNA expression.

Name	Sequence	Direction	Expected product size (bp)	PCR conditions for pair of primers
MetAP-2-S	TGGCGGGCGTGGAAGAGG	Sense	282	1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min
MetAP-2-AS	GCACCATCACCATCACCATCTCC	Antisense	282	1 cycle: 72 °C, 10 min; 4 °C overnight
Bcl-2-S	AGATGAAGACTCCGCGCCCCTCAGG	Sense	566	1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min
Bcl-2-AS	CCAGGTATGCACCCAGAGTGATG	Antisense	566	1 cycles: 72 °C, 1 min; 4 °C overnight
Telomerase-S	GACATGGAGAACAAGCTGTTTGC	Sense	185	1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min
Telomerase-AS	ACAGGGAAGTTCACCACTGTC	Antisense	185	1 cycle: 72 °C, 10 min; 4 °C overnight
GAPDH-S	ACCACAGTCCATGCCATCAC	Sense	485	1 cycles: 94 °C, 7 min 50 cycles: 94 °C, 40 s; 54 °C, 40; 72 °C, 1 min
GAPDH-AS	TCCACCACCCTGTTGCTGTA	Antisense	485	1 cycle: 72 °C, 10 min; 4 °C overnight

Table 2 Body weight of rats at wk 20 and 24.

	Rats (n = 10)	Body weight (g)
		20th wk	24th wk
Group B	DEN only	398	400
		[386-409]	[384-411]
Group C	DEN + Fumagillin	397	398
		[380-410]	[382-414]
P value		NS	NS

Weight: median [range]; P value: non-parametric test (Mann-Whitney U test) Group A (control): 372 [350-380] g at wk 20 and 380 [351-394] g at wk 24.

Table 3 Inhibitory effect of fumagillin on hepatic tumor growth and metastasis in LEW rats at wk 20 and 24.

Treatment groups	Liver tumor (B/C-A) (g, median)		No. of HCC-involved organs1
	20th wk	24th wk	20th wk	24th wk
Group B DEN only (n = 5)	0.641	0.791	3	3
	[0.58-0.70]	[0.70-0.90]	[2-3]	[3-3]
Group C DEN + Fumagillin (n = 5)	0.37	0.39	1	1
	[0.35-0.42]	[0.35-0.47]	[1-2]	[1-2]
P value	0.009	0.009	0.007	0.004

Weight: median [range] of 5 rats in each step; P value: non-parametric test (Mann-Whitney U test);

¹organs involved: 1 (liver only), or 2 to 3 (lung or/and peritoneum, in addition to liver). Liver tumor (B/C-A): B rat liver tumor weight = liver weight of group B rat minus that of group A rat; C rat liver tumor weight = liver weight of group C rat minus that of group A rat.

Table 4 Comparison of MetAP-2 mRNA, Bcl-2 mRNA, telomerase mRNA and telomerase activity among the 3 groups of rats at wk 24.

Parameters	Group			P value
	A (n = 3)	B (n = 5)	C (n = 5)	A vs B	A vs C	B vs C
MetAP-2 mRNA	0.34	0.5	0.58	0.025	0.025	0.047
(0.32-0.36)	(0.33-0.70)	(0.40-0.73)
Bcl-2 mRNA	0	0.45	0.38	0.024	0.608	0.072
(0-0.19)	(0.22-0.63)	(0-0.42)
Telomerase mRNA	0.3	0.43	0.34	0.025	0.655	0.016
	(0.29-0.32)	(0.35-0.47)	(0.29-0.37)
Telomerase	47.6	225	203.5	0.025	0.025	0.046
Activity (%)	(46-71)	(187-310)	(94-292)

Non-parametric test: Mann-Whitney and Kruskal-Wallis tests.