©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Feb 7, 2005; 11(5): 634-640
Published online Feb 7, 2005. doi: 10.3748/wjg.v11.i5.634
Published online Feb 7, 2005. doi: 10.3748/wjg.v11.i5.634
Table 1 Antisense accessible regions of survivin mRNA shown by primer extension analysis.
| Primer name | Product size of primerextension (bp) | 3’ end site of primer extension (bp) | 3’ end site of RNase Hcleavage (bp) | Antisense accessiblesites (bp) |
| P1 | 42 | 255 | 254 | 235-254 |
| 60 | 237 | 236 | 217-236 | |
| 70 | 227 | 226 | 207-226 | |
| 82 | 215 | 214 | 195-214 | |
| 90 | 207 | 206 | 187-206 | |
| 104 | 193 | 192 | 173-192 | |
| 118 | 179 | 178 | 159-178 | |
| 151 | 146 | 145 | 126-145 | |
| P2 | 40 | 124 | 123 | 104-123 |
| 70 | 94 | 93 | 74-93 | |
| 100 | 64 | 63 | 44-63 | |
| 118 | 46 | 45 | 26-45 | |
| 140 | 24 | 23 | 4-23 |
Table 2 Antisense accessible sites and their complementary oligonucleotide sequences selected by random oligonucleotide library/RNase H cleavage combined with RNADraw analysis.
| Serial number | Base sequence | Origination-end sites | Base pair |
| ODN1 | AGATGACGACCCCATAGAGG | 207-226 | 20 bp |
| AS-ODN1 | CCTCTATGGGGTCGTCATCT | ||
| ODN2 | GAGCTGGAAGGCTGGGAGCC | 187-206 | 20 bp |
| AS-ODN2 | GGCTCCCAGCCTTCCAGCTC | ||
| ODN3 | CTTCATCCACTGCCCCACTG | 126-145 | 20 bp |
| AS-ODN3 | CAGTGGGGCAGTGGATGAAG | ||
| ODN4 | AGGACCACCGCATCTCTACA | 44-63 | 20 bp |
| AS-ODN4 | TGTAGAGATGCGGTGGTCCT |
- Citation: Tong QS, Zheng LD, Chen FM, Zeng FQ, Wang L, Dong JH, Lu GC. Selection of optimal antisense accessible sites of survivin and its application in treatment of gastric cancer. World J Gastroenterol 2005; 11(5): 634-640
- URL: https://www.wjgnet.com/1007-9327/full/v11/i5/634.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i5.634