Copyright
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 28, 2005; 11(48): 7615-7619
Published online Dec 28, 2005. doi: 10.3748/wjg.v11.i48.7615
Published online Dec 28, 2005. doi: 10.3748/wjg.v11.i48.7615
Table 1 Standard strains used in the present study
Genus or species | Standard strain(s)1 |
Salmonella | 50 001, 50 004, 50 009, 50 013, 50 014, 50 018, 50 019, 50 020, 50 021, 50 023, 50 029, 50 041, 50 042, 50 043, 50 047, 50 051, 50 073, 50 082, 50 083, 50 086, 50 093, 50 096, 50 098, 50 099, 50 100, 50 104, 50 105, 50 106, 50 109, 50 112, 50 115, 50 120, 50 124, 50 128, 50 145, 50 191, 50 200, 50 201, 50 220, 50 304, 50 306, 50 307, 50 309, 50 310, 50 313, 50 315, 50 320, 50 321, 50 322, 50 326, 50 327, 50 333, 50 335, 50 337, 50 338, 50 354, 50 355, 50 358, 50 360, 50 362, 50 402, 50 707, 50 708, 50 709, 50 710, 50 711, 50 712, 50 718, 50 719, 50 730, 50 731, 50 732, 50 733, 50 735, 50 736, 50 739, 50 746, 50 761, 50 774, 50 783, 50 825, 50 835, 50 846, 50 853, 50 854, 50 864, 50 913 |
Shigella | 51 081, 51 100, 51 207, 51 227, 51 233, 51 252, 51 253, 51 255, 51 258, 51 259, 51 262, 51 307, 51 315, 51 334, 51 335, 51 336, 51 424, 51 464, 51 570, 51 571, 51 572, 51 573, 51 575, 51 582, 51 583, 51 584, 51 585, 51 610 |
Escherichia coli | 44 102, 44 105, 44 109, 44 110, 44 113, 44 126, 44 127, 44 149, 44 155, 44 156, 44 186, 44 216, 44 336, 44 338, 44 344, 44 505, 44 710, 44 719, 44 752, 44 813, 44 824, 44 825 |
Proteus | 49 027, 49 101, 49 102, 49 103 |
Staphylococcus | 26 001, 26 003, 26 005, 26 101, 26 111, 26 113, 26 517 |
Yersinia enterocolitica | 52 202, 52 203, 52 206, 52 207, 52 211, 52 215, 52 217, 52 219, 52 302 |
Listeria monocytogenes | 54 003, 54 005, 54 006, 54 007 |
Vibrio | 20 502, 20 506, 20 507, 20 511, 02-12 |
Enterococcus faecalis | 32 221, 32 223 |
Campylobacter jejuni | 26 277 |
Bacillus cereus | 63 301 |
Table 2 Oligonucleotide probes used in the present study
No. | Sequence (5' to 3') | Target |
1 | gtacaaggcccgggaacgtattcacc | All known eubacteria (universal bacterial probe) |
2 | gacataaggggcatgatgatttgacgt | All Gram-positive bacteria |
3 | gtcgtaagggccatgatgacttgacgt | All Gram-negative bacteria |
4 | gtcatgaatcacaaagtggtaagcgc | All enteric bacterial |
5 | acgacgcactttatgaggtccgcttg | Escherichia coli, Shigella sp. and Salmonella sp. |
6 | gctcctaaaaggttactccaccggct | Staphylococcus aureus |
7 | cgacggctagctccaaatggttactg | Coagulase-negative Staphylococcus |
9 | tcacggtcttgcgtcttattgtacctac | Clostridium botulinum |
11 | gaactgagactggtttttaagtttggct | Clostridium perfringens |
15 | cgaactgggacatattttatagatttgc | Campylobacter jejuni |
16 | aggtcgccccttcgccgccctctgtatc | Legionella pneumophila |
17 | cgatccgaactgagaccggcttttaagg | Mycobacterium tuberculosis |
18 | tactcgtaagggccatgatacgacttaa | Proteus sp. |
19 | cgcggcttggcaaccctttgtaccgacc | Pseudomonas aeruginosa |
20 | actgagaatagttttatgggattagg | Listeria monocytogenes |
21 | gctccaccttcgcggtattcgctgccct | Vibrio cholerae |
22 | tcactttcgcaagttggccgccctctgt | Vibrio fluvialis |
23 | tggtaagcgtccccccgtagttgaaac | Vibrio parahaemolyticus |
24 | tacgacagactttatgtggtccgcttgc | Yersinia enterocolitica |
25 | cctcgcggtctagcagctcgttgtgctt | Enterococcus faecalis |
26 | ggattcgctcactatcgctagcttgcag | Aeromonas hydrophila |
27 | ccgacttcgggtgttacaaactctcg | Bacillus cereus, P. |
28 | gcttcatgcactcgagttgcagagtg | cocovenenans subsp. farinofermentans |
30 | atccccaccttcctccagtt | Positive control |
31 | cccccagaggcagagattgca | virA gene of Shigella sp. |
32 | cgccaataacgaattgcccga | invA gene of Salmonella sp. |
Table 3 Comparison of identifications based on hybridization assay and conventional methods for 26 cultures
No. | Hybridization assay | Conventional methods | Consistency |
1 | Staphylococcus aureus | Staphylococcus aureus | Y1 |
2 | Coagulase-negative Staphylococcus | Staphylococcus epidermidis | Y |
3 | Staphylococcus aureus | Staphylococcus aureus | Y |
4 | Staphylococcus aureus | Staphylococcus aureus | Y |
5 | Staphylococcus aureus | Staphylococcus aureus | Y |
6 | Pseudomonas aeruginosa | Pseudomonas aeruginosa | Y |
7 | -3 | Salmonella typhimurium | -2 |
8 | Escherichia coli | Escherichia coli | Y |
9 | Staphylococcus aureus | Staphylococcus aureus | Y |
10 | Pseudomonas aeruginosa | Pseudomonas aeruginosa | Y |
11 | Shigella sp. | Shigella flexneri | Y |
12 | Shigella sp. | Shigella flexneri | Y |
13 | Shigella sp. | Shigella flexneri | Y |
14 | Shigella sp. | Shigella flexneri | Y |
15 | Vibrio parahaemolyticus | Vibrio parahaemolyticus | Y |
16 | Yersinia enterocolitica | Yersinia enterocolitica | Y |
17 | Pseudomonas aeruginosa | Pseudomonas aeruginosa | Y |
18 | Shigella sp. | Shigella flexneri | Y |
19 | Shigella sp. | Shigella flexneri | Y |
20 | Vibrio parahaemolyticus | Vibrio parahaemolyticus | Y |
21 | Escherichia coli | Escherichia coli | Y |
22 | Escherichia coli | Escherichia coli | Y |
23 | Salmonella sp. | Salmonella typhimurium | Y |
24 | Campylobacter jejuni | Campylobacter jejuni | Y |
25 | Salmonella sp. | Salmonella typhimurium | Y |
26 | Salmonella sp. | Salmonella typhimurium | Y |
- Citation: Jin LQ, Li JW, Wang SQ, Chao FH, Wang XW, Yuan ZQ. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays. World J Gastroenterol 2005; 11(48): 7615-7619
- URL: https://www.wjgnet.com/1007-9327/full/v11/i48/7615.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i48.7615