BPG is committed to discovery and dissemination of knowledge
Basic Research
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 28, 2005; 11(48): 7615-7619
Published online Dec 28, 2005. doi: 10.3748/wjg.v11.i48.7615
Table 1 Standard strains used in the present study
Genus or speciesStandard strain(s)1
Salmonella50 001, 50 004, 50 009, 50 013, 50 014, 50 018, 50 019, 50 020, 50 021, 50 023, 50 029, 50 041, 50 042, 50 043, 50 047, 50 051, 50 073, 50 082, 50 083, 50 086, 50 093, 50 096, 50 098, 50 099, 50 100, 50 104, 50 105, 50 106, 50 109, 50 112, 50 115, 50 120, 50 124, 50 128, 50 145, 50 191, 50 200, 50 201, 50 220, 50 304, 50 306, 50 307, 50 309, 50 310, 50 313, 50 315, 50 320, 50 321, 50 322, 50 326, 50 327, 50 333, 50 335, 50 337, 50 338, 50 354, 50 355, 50 358, 50 360, 50 362, 50 402, 50 707, 50 708, 50 709, 50 710, 50 711, 50 712, 50 718, 50 719, 50 730, 50 731, 50 732, 50 733, 50 735, 50 736, 50 739, 50 746, 50 761, 50 774, 50 783, 50 825, 50 835, 50 846, 50 853, 50 854, 50 864, 50 913
Shigella51 081, 51 100, 51 207, 51 227, 51 233, 51 252, 51 253, 51 255, 51 258, 51 259, 51 262, 51 307, 51 315, 51 334, 51 335, 51 336, 51 424, 51 464, 51 570, 51 571, 51 572, 51 573, 51 575, 51 582, 51 583, 51 584, 51 585, 51 610
Escherichia coli44 102, 44 105, 44 109, 44 110, 44 113, 44 126, 44 127, 44 149, 44 155, 44 156, 44 186, 44 216, 44 336, 44 338, 44 344, 44 505, 44 710, 44 719, 44 752, 44 813, 44 824, 44 825
Proteus49 027, 49 101, 49 102, 49 103
Staphylococcus26 001, 26 003, 26 005, 26 101, 26 111, 26 113, 26 517
Yersinia enterocolitica52 202, 52 203, 52 206, 52 207, 52 211, 52 215, 52 217, 52 219, 52 302
Listeria monocytogenes54 003, 54 005, 54 006, 54 007
Vibrio20 502, 20 506, 20 507, 20 511, 02-12
Enterococcus faecalis32 221, 32 223
Campylobacter jejuni26 277
Bacillus cereus63 301
Table 2 Oligonucleotide probes used in the present study
No.Sequence (5' to 3')Target
1gtacaaggcccgggaacgtattcaccAll known eubacteria (universal bacterial probe)
2gacataaggggcatgatgatttgacgtAll Gram-positive bacteria
3gtcgtaagggccatgatgacttgacgtAll Gram-negative bacteria
4gtcatgaatcacaaagtggtaagcgcAll enteric bacterial
5acgacgcactttatgaggtccgcttgEscherichia coli, Shigella sp. and Salmonella sp.
6gctcctaaaaggttactccaccggctStaphylococcus aureus
7cgacggctagctccaaatggttactgCoagulase-negative Staphylococcus
9tcacggtcttgcgtcttattgtacctacClostridium botulinum
11gaactgagactggtttttaagtttggctClostridium perfringens
15cgaactgggacatattttatagatttgcCampylobacter jejuni
16aggtcgccccttcgccgccctctgtatcLegionella pneumophila
17cgatccgaactgagaccggcttttaaggMycobacterium tuberculosis
18tactcgtaagggccatgatacgacttaaProteus sp.
19cgcggcttggcaaccctttgtaccgaccPseudomonas aeruginosa
20actgagaatagttttatgggattaggListeria monocytogenes
21gctccaccttcgcggtattcgctgccctVibrio cholerae
22tcactttcgcaagttggccgccctctgtVibrio fluvialis
23tggtaagcgtccccccgtagttgaaacVibrio parahaemolyticus
24tacgacagactttatgtggtccgcttgcYersinia enterocolitica
25cctcgcggtctagcagctcgttgtgcttEnterococcus faecalis
26ggattcgctcactatcgctagcttgcagAeromonas hydrophila
27ccgacttcgggtgttacaaactctcgBacillus cereus, P.
28gcttcatgcactcgagttgcagagtgcocovenenans subsp. farinofermentans
30atccccaccttcctccagttPositive control
31cccccagaggcagagattgcavirA gene of Shigella sp.
32cgccaataacgaattgcccgainvA gene of Salmonella sp.
Table 3 Comparison of identifications based on hybridization assay and conventional methods for 26 cultures
No.Hybridization assayConventional methodsConsistency
1Staphylococcus aureusStaphylococcus aureusY1
2Coagulase-negative StaphylococcusStaphylococcus epidermidisY
3Staphylococcus aureusStaphylococcus aureusY
4Staphylococcus aureusStaphylococcus aureusY
5Staphylococcus aureusStaphylococcus aureusY
6Pseudomonas aeruginosaPseudomonas aeruginosaY
7-3Salmonella typhimurium-2
8Escherichia coliEscherichia coliY
9Staphylococcus aureusStaphylococcus aureusY
10Pseudomonas aeruginosaPseudomonas aeruginosaY
11Shigella sp.Shigella flexneriY
12Shigella sp.Shigella flexneriY
13Shigella sp.Shigella flexneriY
14Shigella sp.Shigella flexneriY
15Vibrio parahaemolyticusVibrio parahaemolyticusY
16Yersinia enterocoliticaYersinia enterocoliticaY
17Pseudomonas aeruginosaPseudomonas aeruginosaY
18Shigella sp.Shigella flexneriY
19Shigella sp.Shigella flexneriY
20Vibrio parahaemolyticusVibrio parahaemolyticusY
21Escherichia coliEscherichia coliY
22Escherichia coliEscherichia coliY
23Salmonella sp.Salmonella typhimuriumY
24Campylobacter jejuniCampylobacter jejuniY
25Salmonella sp.Salmonella typhimuriumY
26Salmonella sp.Salmonella typhimuriumY