©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Dec 7, 2005; 11(45): 7142-7147
Published online Dec 7, 2005. doi: 10.3748/wjg.v11.i45.7142
Published online Dec 7, 2005. doi: 10.3748/wjg.v11.i45.7142
Table 1 Oligonucleotide primers used for amplification of total DNA extracted from human blood samples and total chromosomal DNA recovered from selected bacterial strains
| Primer designate | Sequences of (+) and (-) primers (nucleotide) | Gene target | Size of amplicon (bp) |
| BG-1 (+ strand) | 5’CTT TGC CTG GTT TCC GGC ACC AGA A- 3’ (201-225) | b-Galactosidase gene of E coli | 762 |
| BG-4 (- strand) | 5’AAC CAC CGC ACG ATA GAG ATT CGG G- 3’ (983-939) | ||
| BD-1 (+ strand) | 5’AGT TTG ATC CTG GCT GAG- 3’ (8-27) | DNA coding for 16S rRNA | 798 |
| BD-2 (- strand) | 5’GGA CTA CCA GGG TAT CTA AT- 3’ (805-787) | ||
| BFR-1 (+ strand) | 5’ACT CTT TGT ATC CCG ACG ATT-3’ (484-504) | Glutamine synthase gene of Bacteroides spp. | 581 |
| BFR-2 (- strand) | 5’GAG GTT GAT GCC TGT ATC GGT-3’ (1 065-1 045) | ||
| F3 (+ strand) | 5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG-3’ | Variable V3 region of 16S rRNA | 233 |
| Rev-2 (- strand) | 5’ATTACCGCGGCTGCTGG-3’ |
Table 2 A summary of the results obtained from testing of blood samples from six patients; CRP and SIRS evaluation, blood culture testing using selective growth media and PCR analysis
| Patient no. | Day | 1 | 2 | 3 | 4 | 8 | Complications |
| 1 | CRP | 135 | 158 | 91 | 70 | 40 | None |
| SIRS | Y | Y | N | N | N | ||
| PCR | Negative | Negative | Positive | ||||
| 2 | CRP | 55 | 83 | 108 | 105 | 94 | None |
| SIRS | N | N | N | N | N | ||
| PCR | Negative | Negative | Negative | ||||
| 3 | CRP | 345 | 301 | 289 | 234 | 142 | None |
| SIRS | Y | Y | Y | N | N | ||
| PCR | Negative | Negative | Negative | ||||
| 4 | CRP | 301 | 284 | 248 | 169 | 122 | None |
| SIRS | Y | Y | Y | Y | N | ||
| PCR | Positive | Negative | Negative | ||||
| 5 | CRP | 59 | 201 | 193 | 155 | 114 | Pneumonia, sepsis |
| SIRS | Y | Y | Y | Y | N | (-ve blood culture) | |
| PCR | Positive | Positive | Negative | ||||
| 6 | CRP | 326 | 209 | 150 | 128 | None | |
| SIRS | Y | Y | Y | Y | |||
| PCR | Negative | Negative |
- Citation: Pearce CB, Zinkevich V, Beech I, Funjika V, Ruiz AG, Aladawi A, Duncan HD. Using the polymerase chain reaction coupled with denaturing gradient gel electrophoresis to investigate the association between bacterial translocation and systemic inflammatory response syndrome in predicted acute severe pancreatitis. World J Gastroenterol 2005; 11(45): 7142-7147
- URL: https://www.wjgnet.com/1007-9327/full/v11/i45/7142.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i45.7142
