Herpes simplex virus type 1 in peptic ulcer disease: An inverse association with Helicobacter pylori

Table 1 Characteristics and nucleotide base sequences of primers used for nested PCR and control assays

Gene target	GenBankaccession number	Productsize (bp)	Sequences1	Tm(°C)
			Outer sense agcagcgactctgaggcggagaccg	69.1
		450
			Outer antisense tgcgggtctgggggtcgttcacga	71.4
HSV-1: RL2	X14112		Inner sense cccggcagttgcgggggcgc	73.4
		110
			Inner antisense aaggtgtcgcagcggcaggtg	60.8
b-actin			Forward gtgatctccttctgcatcc	53.2
		200		52.7
			Reverse ctcttccagccttccttc

T_m, melting temperature.

¹Sequences shown are in the 5’ to 3’ direction.

Table 2 Association between H pylori and HSV-1 in patients with peptic ulcer

	H pylori (+), %	H pylori (–)	P	Odds ratio (95%CI)
Peptic ulcer	76/90 (84.4)	14/90	0.002	3.7 (1.6–8.1)
Controls	30/50 (60)	20/50
Gastric ulcer	25/34 (73.5)	9/34	0.036	3.67 (1.1–12.11)
Duodenal ulcer	51/56 (91.1)	5/56
HSV-1 (+)	19/28 (67.9)	9/28	0.009	5.4 (1.61–18.11)
HSV-1 (–)	57/62 (91.9)	5/62
HSV-1 (+)/GU	4/11 (36.4)	7/11	0.002	18.37 (2.75–122.94)
HSV-1 (–)/ GU	21/23 (91.3)	2/23
HSV-1 (+)/Duodenal ulcer	15/17 (88.2)	2/17
HSV-1(–)/Duodenal ulcer	36/39 (92.3)	3/39	0.634	-

HSV-1 (+)/gastric ulcer, patients with gastric ulcer positive for HSV-1; HSV-1 (–)/gastric ulcer, patients with gastric ulcer negative for HSV-1; HSV-1 (+)/duodenal ulcer, patients with duodenal ulcer positive for HSV-1; HSV-1 (–)/duodenal ulcer, patients with duodenal ulcer negative for HSV-1; CI, confidence interval.

Table 3 Association between H pylori and HSV-1 in relation with the site of peptic ulcer

	H pylori (+), %	H pylori (-)	P-value	Odds ratio (95% CI)
HSV-1(+)/ gastric ulcer	4/11 (36.4)	5/11
			0.010	13.13 (1.92–89.5)
HSV-1(–)/ duodenal ulcer	15/17 (88.2)	2/17

HSV-1 (+), patients positive for HSV-1; CI, confidence interval.

Table 4 Risk factors and peptic ulcer disease

	Peptic ulcer patients (%)	Controls (%)	Odds ratio	P
History of H labialis
Yes	24/90 (26.7)	9/50 (18.0)	-	0.302
No	66/90 (73.3)	41/50 (82.0)
Alcohol consumption
Yes	32/90 (35.6)	14/50 (28.0)	-	0.469
No	58/90 (64.4)	36/50 (72.0)
NSAID use
Yes	23/90 (25.6)	8/50 (16.0)	-	0.275
No	67/90 (74.4)	42/50 (84.0)
Smoking
Yes	45/90 (50.0)	14/50 (28.0)	2–57	0.019
No	45/90 (50.0)	36/50 (72.0)
Family history of peptic ulcer
Yes	30/90 (33.3) 60/90 (66.7)	9/50 (18.0) 41/50 (82.0)	2.3	0.076
No

Table 5 Contribution of other risk factors to peptic ulcer deve-lopment

	B	S.E	df	Sig.	Odds ratio	95%CI for Odds ratio
Smoking	0.963	0.394	1	0.015	2.619	1.209–5.673
H pylori infection	1.2	0.473	1	0.011	3.32	1.313–8.389
Age	0.011	0.014	1	0.432
Sex	0.144	0.442	1	0.745
History of H labialis	0.721	0.484	1	0.137
Alcohol	0.021	0.492	1	0.966
NSAID use	0.286	0.494	1	0.562
Family history	0.44	0.48	1	0.359
Constant	–0.741	0.393	1	0.06

CI, confidence interval.