Association of polymorphism of tumor necrosis factor-alpha gene promoter region with outcome of hepatitis B virus infection

Table 1 Nested PCR primer sequences for HBV genotype

Primer sequence
Outer primers
Ps1	5’TCACCATATTCTTGGGAACAAGA3’
Ps2	5’CGAACCACTGAACAAATGGC3’
Inner primers
Group A
B2	5’GGCTCCAGTTCCGGAACAGT3’
BA1R	5’CTCGCGGAGATTGACGAGATG3’
BB1R	5’CAGGTTGGTGAGTGACTGGAG3’
BC1R	5’GGTCCTAGGAATCCTGATGTTG3’
Group B
BD1	5’GCCAACAAGGTAGGAGCT3’
BE1	5’CACCAGAAATCCAGATTGGGACCA3’
BF1	5’GCTACGGTCCAGGGTTACCA3’
B2R	5’GGAGGCGGATVTGCTGGCAA3’

Table 2 Positive rate of HBV DNA in asymptomatic carrier group and chronic HB group

Group	n	HBV DNA positive (%)
Carrier	208	97 (46.6)
Chronic HB	443	221 (49.9)

Table 3 Proportions of HBV genotype in asymptomatic carrier group and chronic HB group

Group	n	A	B	C	B+C
Carrier group	97	2 (2.1)	25 (25.8)	66 (68.0)	4 (4.1)
Chronic HB group	221	2 (0.9)	48 (21.7)	158 (71.5)	13 (5.9)

χ² = 1.66, df = 3, P = 0.647.

Table 4 TNF-238 polymorphism and allele frequencies in chronic HB, asymptomatic carrier and self-limited groups

Group	n	Genotype (%)					Alleles (%)1
		GG	GA	AA	χ2	P	G	A
Chronic HB group	433	402 (90.7)	41 (9.3)	0 (0.00)	845 (95.4)	41 (4.6)
Carrier group	208	187 (89.0	23 (11.0)	0 (0.00)	0.464 (to patient)	0.496 (to patient)	397 (94.5)	23 (5.5)
Self-limited group	244	232 (95.1)	12 (4.9)	0 (0.00)	4.157 (to patient)	0.041 (to patient)	476 (97.5)	12 (2.5)
					5.776 (to carrier)	0.016 (to carrier)

¹χ² = 3.99, P = 0.046. Hardy–Weinberg χ² = 0.155, P = 0.69.

Table 5 TNF-857 polymorphism and allele frequencies in chronic HB, asymptomatic carrier and self-limited groups

Group	n	Genotype (%)					Alleles (%)1
		CC	CT	TT	χ2	P	C	T
Chronic HB	433	345 (79.7)	69 (15.9)	19 (4.4)			759 (87.6)	107 (12.4)
Carrier	208	134 (64.4)	59 (28.4)	15 (7.2)	17.358 (to patient)	<0.001 (to patient)	327 (78.6)	89 (21.4)
Self-limited	244	173 (70.9)	60 (24.6)	11 (4.5)	7.710 (to patient)	0.023 (to patient)	406 (83.2)	82 (16.8)
					2.728 (to carrier)	0.079 (to carrier)

¹χ² = 17.953, P<0.001. Hardy-Weinberg χ² = 3.54, P = 0.059.

Table 6 Frequencies of TNF-238/857 haplotype among chronic HB, carrier and self-limited groups

Number	Haplotype	Self-limited group (%)	Carrier group (%)	Chronic HB group (%)	P (1 to 2)	P (1 to 3)	P (2 to 3)
1	GC	0.8115	0.7297	0.8278	0.035	0.618	0.04
2	AC	0.0205	0.0554	0.0478	0.052	0.069	0.708
3	GT	0.1639	0.2148	0.1246	0.154	0.156	0.03
4	AT	0.0041	0.0002	0.0004	0.367	0.184	0.487

Table 7 Multivariate logistic regression analysis

Variable	elf-limited group to chronic HB group			arrier group to chronic HB group			elf-limited group to carrier group
	χ2	P	OR	χ2	P	OR	χ2	P	OR
Intercept	11.05	0.0009	–	8.86	0.0029	–	11.43	0.0007	–
Sex (male = 1, female = 0)	46.74	0.0001	3.02	34.32	0.0001	3.67	0.6694	0.4133	1.18
Age (yr)	4.06	0.044	0.984	4.22	0.0399	0.903	11.41	0.0007	0.97
-238GA (GA = 1, GG = 0)	4.82	0.036	1.4	4.09	0.0427	1.927	8.91	0.0028	3.19
-857CC (CC = 1, TT+CT = 0)	8.54	0.0035	1.59	9.14	0.0001	2.41	0.664	0.415	1.19