©The Author(s) 2005.
World J Gastroenterol. Sep 7, 2005; 11(33): 5213-5217
Published online Sep 7, 2005. doi: 10.3748/wjg.v11.i33.5213
Published online Sep 7, 2005. doi: 10.3748/wjg.v11.i33.5213
Table 1 Nested PCR primer sequences for HBV genotype
| Primer sequence | |
| Outer primers | |
| Ps1 | 5’TCACCATATTCTTGGGAACAAGA3’ |
| Ps2 | 5’CGAACCACTGAACAAATGGC3’ |
| Inner primers | |
| Group A | |
| B2 | 5’GGCTCCAGTTCCGGAACAGT3’ |
| BA1R | 5’CTCGCGGAGATTGACGAGATG3’ |
| BB1R | 5’CAGGTTGGTGAGTGACTGGAG3’ |
| BC1R | 5’GGTCCTAGGAATCCTGATGTTG3’ |
| Group B | |
| BD1 | 5’GCCAACAAGGTAGGAGCT3’ |
| BE1 | 5’CACCAGAAATCCAGATTGGGACCA3’ |
| BF1 | 5’GCTACGGTCCAGGGTTACCA3’ |
| B2R | 5’GGAGGCGGATVTGCTGGCAA3’ |
Table 2 Positive rate of HBV DNA in asymptomatic carrier group and chronic HB group
| Group | n | HBV DNA positive (%) |
| Carrier | 208 | 97 (46.6) |
| Chronic HB | 443 | 221 (49.9) |
Table 3 Proportions of HBV genotype in asymptomatic carrier group and chronic HB group
| Group | n | A | B | C | B+C |
| Carrier group | 97 | 2 (2.1) | 25 (25.8) | 66 (68.0) | 4 (4.1) |
| Chronic HB group | 221 | 2 (0.9) | 48 (21.7) | 158 (71.5) | 13 (5.9) |
Table 4 TNF-238 polymorphism and allele frequencies in chronic HB, asymptomatic carrier and self-limited groups
| Group | n | Genotype (%) | Alleles (%)1 | |||||
| GG | GA | AA | χ2 | P | G | A | ||
| Chronic HB group | 433 | 402 (90.7) | 41 (9.3) | 0 (0.00) | 845 (95.4) | 41 (4.6) | ||
| Carrier group | 208 | 187 (89.0 | 23 (11.0) | 0 (0.00) | 0.464 (to patient) | 0.496 (to patient) | 397 (94.5) | 23 (5.5) |
| Self-limited group | 244 | 232 (95.1) | 12 (4.9) | 0 (0.00) | 4.157 (to patient) | 0.041 (to patient) | 476 (97.5) | 12 (2.5) |
| 5.776 (to carrier) | 0.016 (to carrier) | |||||||
Table 5 TNF-857 polymorphism and allele frequencies in chronic HB, asymptomatic carrier and self-limited groups
| Group | n | Genotype (%) | Alleles (%)1 | |||||
| CC | CT | TT | χ2 | P | C | T | ||
| Chronic HB | 433 | 345 (79.7) | 69 (15.9) | 19 (4.4) | 759 (87.6) | 107 (12.4) | ||
| Carrier | 208 | 134 (64.4) | 59 (28.4) | 15 (7.2) | 17.358 (to patient) | <0.001 (to patient) | 327 (78.6) | 89 (21.4) |
| Self-limited | 244 | 173 (70.9) | 60 (24.6) | 11 (4.5) | 7.710 (to patient) | 0.023 (to patient) | 406 (83.2) | 82 (16.8) |
| 2.728 (to carrier) | 0.079 (to carrier) | |||||||
Table 6 Frequencies of TNF-238/857 haplotype among chronic HB, carrier and self-limited groups
| Number | Haplotype | Self-limited group (%) | Carrier group (%) | Chronic HB group (%) | P (1 to 2) | P (1 to 3) | P (2 to 3) |
| 1 | GC | 0.8115 | 0.7297 | 0.8278 | 0.035 | 0.618 | 0.04 |
| 2 | AC | 0.0205 | 0.0554 | 0.0478 | 0.052 | 0.069 | 0.708 |
| 3 | GT | 0.1639 | 0.2148 | 0.1246 | 0.154 | 0.156 | 0.03 |
| 4 | AT | 0.0041 | 0.0002 | 0.0004 | 0.367 | 0.184 | 0.487 |
Table 7 Multivariate logistic regression analysis
| Variable | elf-limited group to chronic HB group | arrier group to chronic HB group | elf-limited group to carrier group | ||||||
| χ2 | P | OR | χ2 | P | OR | χ2 | P | OR | |
| Intercept | 11.05 | 0.0009 | – | 8.86 | 0.0029 | – | 11.43 | 0.0007 | – |
| Sex (male = 1, female = 0) | 46.74 | 0.0001 | 3.02 | 34.32 | 0.0001 | 3.67 | 0.6694 | 0.4133 | 1.18 |
| Age (yr) | 4.06 | 0.044 | 0.984 | 4.22 | 0.0399 | 0.903 | 11.41 | 0.0007 | 0.97 |
| -238GA (GA = 1, GG = 0) | 4.82 | 0.036 | 1.4 | 4.09 | 0.0427 | 1.927 | 8.91 | 0.0028 | 3.19 |
| -857CC (CC = 1, TT+CT = 0) | 8.54 | 0.0035 | 1.59 | 9.14 | 0.0001 | 2.41 | 0.664 | 0.415 | 1.19 |
- Citation: Li HQ, Li Z, Liu Y, Li JH, Dong JQ, Gao JR, Gou CY, Li H. Association of polymorphism of tumor necrosis factor-alpha gene promoter region with outcome of hepatitis B virus infection. World J Gastroenterol 2005; 11(33): 5213-5217
- URL: https://www.wjgnet.com/1007-9327/full/v11/i33/5213.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i33.5213
