Copyright
©The Author(s) 2005.
World J Gastroenterol. Sep 7, 2005; 11(33): 5151-5155
Published online Sep 7, 2005. doi: 10.3748/wjg.v11.i33.5151
Published online Sep 7, 2005. doi: 10.3748/wjg.v11.i33.5151
Table 1 Primer sets for reverse transcription-PCR
| Gene | 5’-Forward | 3’-Reverse |
| Homeo box a4 | ATGACCATGAGCTCGTTTTTGAT | TATGGAGGAGGGAACGGGTG |
| Mads box transcription factor 2b | ATGGGGAGGAAAAAAATCCAGA | CTGTTGGGTCTTCTCTGAAGA |
| G3PDH | ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA |
Table 2 Gene transcripts displaying a two fold or higher increase or decrease in expression level that was significant at the P<0.05 level
| Accession number | Gene name | AI in controls | AI in UC | Control/UC | P |
| NM_002141 | Homeo box a4 (Hoxa4) | 356 193.4 | 144 705.0 | 2.46 | 0.005 |
| NM_005919 | Mads box transcription enhancer factor 2, polypeptide b (MEF2b) | 283 291.9 | 113 174.8 | 2.5 | 0.009 |
| XM_001566 | Calcium activated chloride channel 3 precursor (CLCA3) | 5 308.8 | 1 188.9 | 4.46 | 0.01 |
| NM_032946 | Nuclear rna export factor 5 (NXF5) | 4 416.7 | 1 681.3 | 2.63 | 0.014 |
| NM_022061 | Ribosomal protein l17 isolog (RPL7) | 299 317.9 | 143 755.9 | 2.08 | 0.027 |
| NM_016638 | Srp25 nuclear protein (SRP25) | 2 872.1 | 6 576.4 | 0.43 | 0.043 |
- Citation: Toiyama Y, Mizoguchi A, Kimura K, Araki T, Yoshiyama S, Sakaguchi K, Miki C, Kusunoki M. Persistence of gene expression changes in noninflamed and inflamed colonic mucosa in ulcerative colitis and their presence in colonic carcinoma. World J Gastroenterol 2005; 11(33): 5151-5155
- URL: https://www.wjgnet.com/1007-9327/full/v11/i33/5151.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i33.5151
