©2005 Baishideng Publishing Group Co.
World J Gastroenterol. Jan 14, 2005; 11(2): 275-279
Published online Jan 14, 2005. doi: 10.3748/wjg.v11.i2.275
Published online Jan 14, 2005. doi: 10.3748/wjg.v11.i2.275
Table 1 Primers used in PCR amplification and DNA sequencing experiments.
| Exon | Sequence (5'→3') | Annealing t (°C) | Product size (bp) | |
| 11 | F: ACACCACCCCCACCCACAGAT | 62 | 273 | |
| R: AAGCTTGAAGGCATCCACGG | ||||
| 13 | F: GACCTGGTATGGTCATGGA | 58 | 253 | |
| R: AAGAGGGAGAACAGGGCTGTA | ||||
| 15 | F: GACTCGTGCTATTTTTCCTAC | 60 | 234 | |
| R: TATCTTTCCTAGGCTTCCC | ||||
| 17 | F: CCCCACTAGATGTATAAGGG | 59 | 232 | |
| R: TCACTGGTCCTTTCACTCTCT |
Table 2 Mutated sites observed in RET proto-oncogenes in 48 sporadic HD patients.
| Case | Sex | Range of aganglionic segment | Exon | Nucleotide change | Amino acid change | Mutation types |
| 1 | M | Long-segment | 11 | G15165→A | G667S | Missense mutation |
| 2 | M | Short-segment | 11 | G15165→A | G667S | Missense mutation |
| 3 | F | Long-segment | 11 | G15165→A | G667S | Missense mutation |
| 4 | M | Long-segment | 13 | T18888→G | L745L | Silent mutation |
| 5 | M | Long-segment | 13 | A18919→G | K756E | Missense mutation |
| 6 | M | Long-segment | 13 | 18974insG | - - - - | Frameshift mutation |
| 7 | M | Short-segment | 13 | 18974insG | - - - - | Frameshift mutation |
| 8 | M | Short-segment | 15 | G20692→A | Q916Q | Silent mutation |
- Citation: Guan T, Li JC, Li MJ, Tou JF. Polymerase chain reaction-single strand conformational polymorphism analysis of rearranged during transfection proto-oncogene in Chinese familial hirschsprung’s disease. World J Gastroenterol 2005; 11(2): 275-279
- URL: https://www.wjgnet.com/1007-9327/full/v11/i2/275.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i2.275
