©2005 Baishideng Publishing Group Co.
World J Gastroenterol. Jan 14, 2005; 11(2): 216-220
Published online Jan 14, 2005. doi: 10.3748/wjg.v11.i2.216
Published online Jan 14, 2005. doi: 10.3748/wjg.v11.i2.216
Table 1 Primer sequences and PCR reaction conditions.
| Gene | Primers | Products size | Annealing Temp/Time | Cycles |
| VEGF (all isoforms) | Upper: CCTGGTGGACATCTTCCAGGAGTACC | 196 bp | 58°C/30 s | 30 |
| Lower: GAAGCTCATCTCTCCTATGTGCTGGC | ||||
| G3PDH | Upper: ACCACAGTCCATGCCATCAC | 450 bp | 58°C/30 s | 30 |
| Lower: TCCACCACCCTGTTGCTGTA |
Table 2 Comparison of serum concentrations of ALT and AFP and TNF-α between groups (mean±SD).
| Groups | ALT (IU/L) | AFP (mg/L) | TNF-α(ng/L) |
| Control (n = 12) | 102.35±39.29 | 25.68±14.38 | 42.69±6.99 |
| Therapy (n = 12) | 87.88±35.38 | 19.40±13.58 | 28.64±4.64a |
- Citation: Zhang ZL, Liu ZS, Sun Q. Effects of thalidomide on angiogenesis and tumor growth and metastasis of human hepatocellular carcinoma in nude mice. World J Gastroenterol 2005; 11(2): 216-220
- URL: https://www.wjgnet.com/1007-9327/full/v11/i2/216.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i2.216
