©2005 Baishideng Publishing Group Co.
World J Gastroenterol. Jan 14, 2005; 11(2): 171-175
Published online Jan 14, 2005. doi: 10.3748/wjg.v11.i2.171
Published online Jan 14, 2005. doi: 10.3748/wjg.v11.i2.171
Table 1 Characteristics of 79 patients with HCC undergoing curative resection.
| Variables | No. of patients (%) |
| Age (mean, yr) | 56.4±12.6 |
| Male | 52 (65.8) |
| Cirrhosis | 57 (72.2) |
| Child-Pugh’s class A | 55 (70.0) |
| Serum AFP <20 ng/mL | 30 (38.0) |
| 20-103 ng/mL | 29 (36.7) |
| >103 ng/mL | 20 (25.3) |
| HBsAg (+) | 60 (57.8) |
| Anti-HCV (+) | 41 (51.9) |
| Size of HCC <3 cm | 24 (30.4) |
| 3-10 cm | 25 (31.6) |
| >10 cm | 30 (38.0) |
| Edmondson-Steiner’s grade I | 4 (5.1) |
| grade II | 30 (38.0) |
| grade III | 42 (53.2) |
| grade IV | 3 (3.8) |
| Complete capsule | 61 (77.3) |
| Vascular permeation | 56 (70.9) |
| Daughter nodules | 44 (55.7) |
| Tumor necrosis | 55 (70.0) |
| Tumor hemorrhage | 24 (30.4) |
Table 2 Nucleotide sequences of the primer sets and specific oligonucleotide probes to each type of connexin 5'-noncoding mRNA.
| Type of connexin mRNA | Primers Probes | Nucleotide sequences |
| Cx32 | Sense | 5 CTGCTCTACCCGGGCTATGC |
| Antisense | 5 CAGGCTGAGCATCGGTCGCTCTT | |
| Cx26 | Sense | 5 CCGAAGTTCATGAAGGGAGAGAT |
| Antisense | 5 GGTCTTTTGGACTTCCCTGAGCA | |
| Cx43 | Sense | 5 TACCATGCGACCAGTGGTGCGCT |
| Antisense | 5 GAATTCTGGTTATCATCGTCGGGGAA |
Table 3 Comparison of characteristics of primary HCC between different levels of connexin 32 mRNA in noncancerous liver tissues.
| Characteristics | Group A (n = 64,%) | Group B (n = 15,%) | P |
| Age (mean, yr) | 52.3 | 48.8 | N.S. |
| Male | 65.6 | 66.7 | N.S. |
| Liver cirrhosis | 68.8 | 73.3 | N.S. |
| Child- Pugh’s class A | 76.6 | 53.3 | N.S. |
| Tumor size <3 cm | 35.9 | 40 | |
| >10 cm | 34.4 | 13.3 | N.S. |
| HBsAg (+) | 53.1 | 46.6 | N.S. |
| Anti-HCV (+) | 78.1 | 66.7 | N.S. |
| Serum AFP <20 ng/mL | 21.9 | 40 | |
| >1000 ng/mL | 37.5 | 40 | N.S. |
| Tumor necrosis | 76.6 | 53.3 | N.S. |
| Tumor hemorrhage | 35.9 | 40 | N.S. |
| Edmondson-Steiner grade Ia | 1.6 | 20 | 0.02 |
| Capsule incomplete or absentb | 78.1 | 40 | 0.009 |
| Daughter nodules | 60.9 | 33.3 | 0.053 |
| Vascular permeationc | 76.6 | 40 | 0.011 |
Table 4 Comparison of recurrence, death, recurrence, free interval and survival between different levels of Cx 32 mRNA in noncancerous liver tissues.
| Outcome | Group A (n = 64) | Group B (n = 15) | P |
| Recurrence (number) (%) | 49 (76.6) | 6 (40.0) | 0.0107 |
| Death1 ( number) (%)2 | 25 (39.0) | 1 (6.7) | 0.0002 |
| Recurrence free interval (median, mo) | 8.5 | 43 | 0.0595 |
| Duration of survival (median, mo) | 11.5 | 41.5 | 0.062 |
| Variables | P | OR | |
| Recurrence | |||
| Vascular permeation | 0.0002 | 5.36 | |
| Cellular dedifferentiation | 0.0203 | 4.18 | |
| Incomplete or absent capsule | 0.016 | 3.1 | |
| Lower Cx 32 mRNA in liver remnant | 0.0203 | 4.18 | |
| Lower Cx 26 mRNA in liver remnant | 0.088 | 2.29 | |
| Higher Cx 43 mRNA in liver remnant | 0.071 | 2.38 | |
| Death | |||
| Vascular permeation | <0.0001 | 8.35 | |
| Lower Cx 32 mRNA in liver remnant | 0.0333 | 3.8 | |
| Lower Cx 26 mRNA in liver remnant | 0.124 | 2.1 | |
| Higher Cx 43 mRNA in liver remnant | 0.0866 | 2.4 |
Table 5 Factors influencing tumor recurrence and death of patients in multivariate analysis.
| Variables | P | OR |
| Recurrence | ||
| Vascular permeation | 0.0002 | 5.36 |
| Cellular dedifferentiation | 0.0203 | 4.18 |
| Incomplete or absent capsule | 0.016 | 3.1 |
| Lower Cx 32 mRNA in liver remnant | 0.0203 | 4.18 |
| Lower Cx 26 mRNA in liver remnant | 0.088 | 2.29 |
| Higher Cx 43 mRNA in liver remnant | 0.071 | 2.38 |
| Death | ||
| Vascular permeation | <0.0001 | 8.35 |
| Lower Cx 32 mRNA in liver remnant | 0.0333 | 3.8 |
| Lower Cx 26 mRNA in liver remnant | 0.124 | 2.1 |
| Higher Cx 43 mRNA in liver remnant | 0.0866 | 2.4 |
- Citation: Sheen IS, Jeng KS, Shih SC, Kao CR, Wang PC, Chen CZ, Chang WH, Wang HY, Shyung LR. Do the expressions of gap junction gene connexin messenger RNA in noncancerous liver remnants of patients with hepatocellular carcinoma correlate with postoperative recurrences? World J Gastroenterol 2005; 11(2): 171-175
- URL: https://www.wjgnet.com/1007-9327/full/v11/i2/171.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i2.171
