©The Author(s) 2004.
World J Gastroenterol. Apr 1, 2004; 10(7): 1010-1014
Published online Apr 1, 2004. doi: 10.3748/wjg.v10.i7.1010
Published online Apr 1, 2004. doi: 10.3748/wjg.v10.i7.1010
Table 1 Nucleotide sequences of primers and band sizes
| Primers | Sequences (5’-3’) | Band sizes | |
| mRNA | sense | CTTATTCCAGGGGTCTGTTTC | 324 bp |
| antisense | TCGTTTCTCTCAGGCTCTTCT | ||
| G3PDH | sense | CATCATCCCTGCTTCTACCC | 160 bp |
| antisense | CCTGCTTCACCACTTTCTTG | ||
Table 2 Viability and 24 hours attaching efficiency of thawed hepatocytes (%)
Table 3 Change of albumin mRNA expression in culture pig hepatocytes (mean ± SD)
- Citation: Liu HL, Wang YJ, Guo HT, Wang YM, Liu J, Yu YC. Cryopreservation and gel collagen culture of porcine hepatocytes. World J Gastroenterol 2004; 10(7): 1010-1014
- URL: https://www.wjgnet.com/1007-9327/full/v10/i7/1010.htm
- DOI: https://dx.doi.org/10.3748/wjg.v10.i7.1010
