Copyright
        ©The Author(s) 2004.
    
    
        World J Gastroenterol. Feb 15, 2004; 10(4): 509-513
Published online Feb 15, 2004. doi: 10.3748/wjg.v10.i4.509
Published online Feb 15, 2004. doi: 10.3748/wjg.v10.i4.509
            Table 1 Primer sequences and PCR conditions used for synthesis of amplicons applied as probes in Northern blot and RT-PCR
        
    | Genes name | Primer (5’-3’) | PCR fragment size (bp) | Annealing temperature | Number of cycles | 
| Pir51 | F GTGGAAGATGATGTTGGTGGTG | 527 | 58 | 32 | 
| R AAGGCGGAGACTCTGATTGG | ||||
| RbAp48 | F GAACTGCCTTTCTTTCAATC | 826 | 58 | 30 | 
| R ATGGCTCAGACACCTACCTC | ||||
| Beclin 1 | F CTTACCACAGCCCAGGCGAAAC | 814 | 58 | 30 | 
| R GCCAGAGCATGGAGCAGCAA | ||||
| Aldolase b | F GCCACTCTCAACCTCAATGC | 423 | 58 | 32 | 
| R TCTCCTTCCCAACCTACCAC | ||||
| β-actin | F TGACGGGGTCACCCACACTGTGCC | 666 | 60 | 25 | 
| R CTTAGAAGCATTGCGGTGGACGATG | 
            Table 2 Classification of number of known functioning genes differentially expressed (> 4 folds) in HCC
        
    | Gene functions | Number of down-regulated genes in HCC | Number of up-regulated genes in HCC | 
| Cell division | 17 | 14 | 
| Cell, organism defense | 39 | 24 | 
| Metabolic enzymes, transporters ion channels | 17 | 9 | 
| Nuclear proteins (transcription factors, DNA processing enzymes) | 21 | 20 | 
| Cell structure, extracellular matrix | 10 | 6 | 
| Cell signalling, communication | 37 | 26 | 
| EST | 41 | 53 | 
| Other genes | 84 | 102 | 
            Table 3 Genes showing differential expression levels in liver cancerous tissue and adjacent normal liver tissue
        
    | Gene Name | GenBank access number | Density in filter for tumor liver | Density in filter for normal liver | Fold change by microarray | Fold change by Northern blot | 
| Beclin 1 | AF077301 | 6971 | 0 | 99 | 99 | 
| RbAp48 | X74262 | 14029.9 | 0 | 99 | 99 | 
| aldolase b | XM_005563 | 2765 | 26589 | -9.65 | -4.7 | 
| Pir51 | NM_006479 | 8654.61 | 323.2 | 26.8 | 5.7 | 
- Citation: Song H, Xia SL, Liao C, Li YL, Wang YF, Li TP, Zhao MJ. Genes encoding Pir51, Beclin 1, RbAp48 and aldolase b are up or down-regulated in human primary hepatocellular carcinoma. World J Gastroenterol 2004; 10(4): 509-513
- URL: https://www.wjgnet.com/1007-9327/full/v10/i4/509.htm
- DOI: https://dx.doi.org/10.3748/wjg.v10.i4.509

 
         
                         
                 
                 
                 
                 
         
                         
                         
                        