Copyright
©The Author(s) 2004.
World J Gastroenterol. Dec 1, 2004; 10(23): 3514-3517
Published online Dec 1, 2004. doi: 10.3748/wjg.v10.i23.3514
Published online Dec 1, 2004. doi: 10.3748/wjg.v10.i23.3514
Gene and oligonucleotide | Sequence | PCR product size (bp) |
GAPDH | ||
Upper primer | 5’-GAAGGTGAAGGTCGGAGTC-3’ | |
Lower primer | 5’-GAAGATGGTGATGGGATTTC-3’ | 226 |
Probe | 5’-(FAM) CAAGCTTCCCGTTCTCAGCC (TAMRA)-3’ | |
hTERT | ||
Upper primer | 5’-TGACACCTCACCTCACCCAC-3’ | |
Lower primer | 5’-CACTGTCTTCCGCAAGTTCAC-3’ | 95 |
Probe | 5’-(FAM) ACCCTGGTCCGAGGTGTGTCCCTGA (TAMRA)-3’ |
Parameter | n | NhTERT | P | |
Low (n = 17) | High (n = 18) | |||
Age (yr) | ||||
< 50 | 13 | 7 | 6 | |
≥ 50 | 22 | 10 | 12 | 0.73 |
Gender | ||||
Male | 25 | 13 | 12 | |
Female | 10 | 4 | 6 | 0.71 |
Size of diameter (cm) | ||||
< 5 | 19 | 11 | 8 | |
≥ 5 | 16 | 6 | 10 | 0.31 |
Location | ||||
Cardia | 14 | 8 | 6 | |
Body and antrum Degree of differentiation | 21 | 9 | 12 | 0.50 |
Well and moderately differentiated | 16 | 12 | 4 | |
Poorly differentiated and undifferentiated | 19 | 5 | 14 | 0.007 |
Lymph node metastasis | ||||
N0 | 8 | 4 | 4 | |
N1 | 13 | 8 | 5 | |
N2 | 14 | 5 | 9 | 0.40 |
Depth of invasion | ||||
T1 and T2 | 24 | 13 | 11 | |
T3 and T4 | 11 | 4 | 7 | 0.43 |
Metastasis | ||||
M0 | 20 | 12 | 8 | |
M1 | 15 | 5 | 10 | 0.17 |
- Citation: Hu LH, Chen FH, Li YR, Wang L. Real-time determination of human telomerase reverse transcriptase mRNA in gastric cancer. World J Gastroenterol 2004; 10(23): 3514-3517
- URL: https://www.wjgnet.com/1007-9327/full/v10/i23/3514.htm
- DOI: https://dx.doi.org/10.3748/wjg.v10.i23.3514