Copyright
©The Author(s) 2004.
World J Gastroenterol. Dec 1, 2004; 10(23): 3475-3479
Published online Dec 1, 2004. doi: 10.3748/wjg.v10.i23.3475
Published online Dec 1, 2004. doi: 10.3748/wjg.v10.i23.3475
Table 1 Primer sequence for c-Kit exons 9, 11, 13, and 17 and the corresponding annealing temperature (TA) and the size of expected PCR size products
| c-Kit exon No. | Primers | Primer sequence 5’->3’ | TA (°C) | Product size (bp) |
| 9 | hEx9-F | TTCCTAGAGTAAGCCAGGG | 53 | 298 |
| hEx9-R | AATCATGACTGATATGGT | |||
| 11 | hEx11-F | CAGGTAACCATTTATTTGT | 53 | 326 |
| hEx11-R | TCATTGTTTCAGGTGGAAC | |||
| 13 | hEx13-F | ATCAGTTTGCCAGTTGTGCT | 53 | 250 |
| hEx13-R | TTTATAATCTAGCATTGCC | |||
| 17 | hEx17-F | GTTTTCACTCTTTACAAGT | 53 | 277 |
| hEx17-R | TTACATTATGAAAGTCACAGGAAAC |
Table 2 Comparison of clinicopathologic parameters accord-ing to the risk groups of gastrointestinal stromal tumors
| Parameter\Risk group | Very low and low (n = 36) | Intermediate and high (n = 19) | P | |
| Cellularity | Low | 11 | 0 | |
| Intermediate | 22 | 15 | 0.019 | |
| High | 3 | 4 | ||
| Nuclear atypia | Mild | 22 | 5 | |
| Moderate | 12 | 9 | 0.019 | |
| Severe | 2 | 5 | ||
| Necrosis | Absent | 34 | 10 | 0.000 |
| Present | 2 | 9 | ||
| Hemorrhage | Absent | 28 | 10 | 0.055 |
| Present | 8 | 9 | ||
| Infiltrative | Absent | 22 | 8 | 0.178 |
| Growth pattern | Present | 14 | 11 | |
| Tumor cell type | Spindle | 29 | 11 | 0.001 |
| Epithelioid | 7 | 8 | ||
Table 3 Comparison of clinicopathologic parameters accord-ing to c-Kit mutations
| Parameter | Mutations | P | |
| Negative (n = 20) | Positive (n = 35) | ||
| Sex (M:F) | 11:9 | 14:21 | 0.283 |
| Age (mean, yr) | 58.2 | 61.0 | 0.360 |
| Mean tumor size (cm) | 3.8 | 6.2 | 0.020 |
| Mean mitoses counts | 7.8 | 13.4 | 0.360 |
| Risk group: Very low/low | 14 | 22 | 0.592 |
| Intermediate/high | 6 | 13 | |
| Cellularity: Low | 5 | 6 | 0.741 |
| Intermediate | 13 | 24 | |
| High | 2 | 5 | |
| Nuclear atypia Mild | 10 | 17 | 0.898 |
| Moderate | 7 | 14 | |
| Severe | 3 | 4 | |
| Necrosis Absent | 18 | 26 | 0.161 |
| Present | 2 | 9 | |
| Hemorrhage Absent | 17 | 21 | 0.054 |
| Present | 3 | 14 | |
| Infiltrative growth Absent | 12 | 18 | 0.539 |
| Present | 8 | 17 | |
| Tumor cell type Spindle | 13 | 27 | 0.330 |
| Epithelioid | 7 | 8 | |
Table 4 Comparison of clinicopathologic parameters accord-ing to DNA ploidy
| Parameter | Diploid (n = 45) | Aneuploid (n = 10) | P |
| Sex (M:F) | 21:24 | 4:6 | 0.702 |
| Age (mean, yr) | 60.8 | 56.1 | 0.225 |
| Mean tumor size (cm) | 4.1 | 10.5 | 0.007 |
| Mean mitoses counts | 5.0 | 40.0 | 0.022 |
| Risk group: Very low/low | 34 | 2 | 0.001 |
| Intermediate/high | 11 | 8 | |
| Cellularity: Low | 11 | 0 | 0.008 |
| Intermediate | 31 | 6 | |
| High | 3 | 4 | |
| Nuclear atypia Mild | 24 | 3 | 0.016 |
| Moderate | 18 | 3 | |
| Severe | 3 | 4 | |
| Necrosis Absent | 38 | 6 | 0.080 |
| Present | 7 | 4 | |
| Hemorrhage Absent | 33 | 5 | 0.149 |
| Present | 12 | 5 | |
| Infiltrative growth Absent | 27 | 3 | 0.085 |
| Present | 18 | 7 | |
| Tumor cell type Spindle | 36 | 4 | 0.010 |
| Epithelioid | 9 | 6 |
Table 5 Correlation of c-Kit mutation and DNA ploidy
| DNA ploidy1 | c-Kit mutation | |
| Negative | Positive | |
| Diploid | 19 | 26 |
| Aneuploid | 1 | 9 |
-
Citation: Lee JH, Zhang X, Jung WY, Chae YS, Park JJ, Kim I. DNA ploidy and
c-Kit mutation in gastrointestinal stromal tumors. World J Gastroenterol 2004; 10(23): 3475-3479 - URL: https://www.wjgnet.com/1007-9327/full/v10/i23/3475.htm
- DOI: https://dx.doi.org/10.3748/wjg.v10.i23.3475
