©The Author(s) 2004.
World J Gastroenterol. Aug 1, 2004; 10(15): 2250-2253
Published online Aug 1, 2004. doi: 10.3748/wjg.v10.i15.2250
Published online Aug 1, 2004. doi: 10.3748/wjg.v10.i15.2250
Table 1 Primer pairs for RT-PCR
| Marker genes | Primer pairs | PCR fragments |
| M2-PK | 5’ccatctaccacttgcagttattcga3’/ 5’tcatggtacaggcactacacgc3’ | 431 bp |
| L-PK | 5’acctctgccttctggatactgact3’/5’tgcaagactccggttcgtatct3’ | 322 bp |
| Albumin | 5’gagcccgaaagaaacgagtgtt3’/5’ggggaatctctggctcatacg3’ | 389 bp |
| INT-β 1 | 5’tacttcagacttccgcattgg3’/ 5’cagtgactgcaaaaatcgtctg3’ | 488 bp |
| GAPDH | 5’ccatggagaaggctggg3’/5’caaagttgtcatggatgacc3’ | 180 bp |
- Citation: Hong H, Chen JZ, Zhou F, Xue L, Zhao GQ. Influence of serum from liver-damaged rats on differentiation tendency of bone marrow-derived stem cells. World J Gastroenterol 2004; 10(15): 2250-2253
- URL: https://www.wjgnet.com/1007-9327/full/v10/i15/2250.htm
- DOI: https://dx.doi.org/10.3748/wjg.v10.i15.2250
