BPG is committed to discovery and dissemination of knowledge
Colorectal Cancer Open Access
©The Author(s) 2003. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Sep 15, 2003; 9(9): 1976-1980
Published online Sep 15, 2003. doi: 10.3748/wjg.v9.i9.1976
Effects of DNA methylation on expression of tumor suppressor genes and proto-oncogene in human colon cancer cell lines
Jing-Yuan Fang, Juan Lu, Ying-Xuan Chen, Li Yang, Shanghai Institute of Digestive Diseases, Renji Hospital, Shanghai Second Medical University, Shanghai 200001, China
Author contributions: All authors contributed equally to the work.
Supported by the National Natural Science Foundation of China, No. 30170413, and PhD Funds from the Ministry of Education of China, No. 199946, and the Key Subject Funds of Shanghai Education Committee to Jing-Yuan Fang
Correspondence to: Dr. Jing-Yuan Fang, Shanghai Institute of Digestive Diseases, 145 Shandong Zhong Road, Shanghai 200001, China. jingyuanfang@yahoo.com
Telephone: +86-21-63200874 Fax: +86-21-63266027
Received: December 22, 2002
Revised: January 5, 2003
Accepted: January 14, 2003
Published online: September 15, 2003

Abstract

AIM: To investigate the effects of DNA methylation on the expression of tumor suppressor genes and proto-oncogene in human colon cancer cell lines.

METHODS: Three colon cancer cell lines (HT-29, SW1116 and Colo-320) treated with different concentrations of DNA methyltransferase inhibitor, 5-aza-2’-deoxycytidine (5-aza-dC) were used to induce DNA demethylation. The expressions of p16INK4A, p21WAF1, APC and c-myc genes were observed by using RT-PCR. The methylation status of p16INK4A promoter in HT-29 cells was also determined by methylation-specific PCR (MSP).

RESULTS: Weak expressions of p16INK4A and APC in the three colon cancer cells were detected, and p21WAF1 expression was not found in SW1116 and Colo-320 cells before treatment. After treatment of 1 μmol/L but not 10 μmol/L of 5-aza-dC, the methylation level of p16INK4A gene promoter decreased significantly, and the hypomethylation led to the up-regulation of p16INK4A gene transcription in HT-29 cells. In the cell lines of SW1116 and Colo-320, p16INK4A and APC mRNA expressions were obviously enhanced after treatment of either 10 μmol/L or 5 μmol/L 5-aza-dC for 24 h. However, no evidence was found that methylation regulated the expression of p21WAF1 and c-myc genes in human colon cancer cell lines.

CONCLUSION: Expression of p16INK4A and APC genes is regulated by DNA methylation in three human colon cancer cell lines.




INTRODUCTION

DNA methylation is the main epigenetic modification after replication in humans[1]. DNA (cytosine-5)-methyltransferase (DNMT) catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (SAM) to C5 of cytosine within CpG dinucleotide sequences in genomic DNA of higher eukaryotes. The expression of some genes can be frequently inactivated by reversible epigenetic events rather than genetic events[2,3].

Colon cancer is one of the most common tumors worldwide. The loss of p21WAF1, p16INK4A and adenomatous polyposis coli (APC) gene expression, or/and the over-expression of c-myc gene are believed to play a crucial role in colon carcinogenesis[4]. As described in our previous review[5], mutation of p16INK4A was not found but the frequency of hypermethylation was 10%-53% in colon cancer. Previous studies by two independent groups of investigators have demonstrated that inactivation of p16INK4A in human colon tissue might be due to de novo methylation of promoter-associated CpG island[6-8]. Colon cancer cell lines, Colo-320[9-11] and SW1116[12-14], were frequently used in molecular biological experiments.

To date, most of these studies were focused on aberrant methylation in a single gene. However, little is known about the regulation of methylation on the expression of several tumor suppressor genes and proto-oncogenes in the same human colon cancer cell line. Furthermore, several clinical trials indicated that methylation inhibitor, 5-aza-2’-deoxycytidine (5-aza-dC) was devoid of antitumour activity in adult patients with colon cancer[15-17]. We want to know whether 5-aza-dC induces over-expression of proto-oncogene while regulates the transcription of tumor suppressor gene.

In this study, we investigated the transcriptional level of p16INK4A, p21WAF1, APC tumor suppressor genes, and c-myc proto-oncogenes. We examined whether the expression of these genes was influenced by methylation in colon cancer cell lines. The focus of this work was to gain a better understanding of the factors involved in regulating DNA methylation.

MATERIALS AND METHODS
Cell culture

Colon cancer-derived cell lines HT-29, Colo-320 and SW1116 were maintained by serial passages in MEM containing 10% heat-inactivated FCS, 20 mmol/L of L-glutamine, 62.5 mg/L of penicillin, and incubated at 37 °C using standard tissue culture incubators as described previously[18]. The cells were plated as 106 cells onto per 100-mm dish.

Treatment with 5-aza-dC

5-aza-dC was a DNMT inhibitor[19]. To assess the expression of p16INK4A, p21WAF1, APC and c-myc genes by 5-aza-dC, colon cancer cell lines were exposed to different concentrations (1 μmol/L and 10 μmol/L for HT-29 cells; 2 μmol/L, 5 μmol/L and 10 μmol/L for Colo-320 and SW1116 cells) of 5-aza-dC (Sigma, St. Louis, MO) for 24 hours and 72 hours. The control cultures were treated simultaneously with PBS. The media were changed, DNA and RNA were harvested at various time points, respectively. We did not find cytotoxics reactions from 5-aza-dC, even at 10 μmol/L concentration.

Reverse transcription polymerase chain reaction (RT-PCR)

Total RNA was isolated by using a commercial kit (Trizol) according to the manufacturer’s instructions (Gibco BRL). Reverse transcription reactions using 5 μg of total RNA in a total reaction volume of 20 μl were performed with Superscript II reverse transcriptase (Life Technologies, Inc.). The mRNA transcription levels of p16INK4A, p21WAF1, APC and c-myc genes were evaluated by using RT-PCR. Primer sequence and PCR reaction for each primer are shown in Table 1. For control of RT-PCR, a 612 bp (322 bp for p16INK4A RT-PCR in HT-29) fragment of β-actin cDNA was also amplified. The density of bands in RT-PCR were quantitated by using a molecular dynamics phosphorImager (Nucleo Tech Inc., San Mateo, CA), which were normalized to the amount of total RNA as determined by the density of β-actin band from RT-PCR[16]. RT-PCR was performed three times at least.

Table 1 Sequences of primers and program of PCR.
PrimersSense(5’→3’)Antisense(5’→3’)Size of product and PCR conditionGenBank accession number
β-actin RT-PCRGGAGTCCTGCTAGAAGCA322 bpXM004814
(for p16INK4A RT-PCR in HT-29)TGGCATCCACGTTTGCGGTGGA94 °C 3 m; 94 °C 30 s, 60 °C 1 m, 72 °C 1 m, 27 X; 72 °C 5 m
β-actin RT-PCRGGCATCGTGGCTGGAAGG612 bpBC023204
(for RT-PCR in other cells)ATGGACTCCGTGGACAGCGA94 °C 5 min; 92 °C 40 s, 58 °C 40 s, 72 °C 50 s, 30 X; 72 °C 5 min
p16INK4ACCCGCTTTCTTATTTGAG355 bpL27211
RT-PCRGTAGTTTTCATCTTTGGTTCTG94 °C 5 min; 94 °C 1 min, 58 °C 1 min, 72 °C, 1 min, 35 X; 72 °C 5 min
APCGAGACAGAAGTAAGATGATTG170 bpAF209032
RT-PCRTGGAGGTGCTGCGAATTATCTTCTA95 °C 5 min; 95 °C 1 min, 53 °C 1 min, 72 °C, 1 min, 35 X; 72 °C 5 min
p21WAF1CAGGGGACAGGGCGGCCA335 bpNM_000389
RT-PCRGCAGAGGAAGAGGGTATGTAC94 °C 5 min; 94 °C 1 min, 58 °C 1 min, 72 °C 1 min, 35 X; 72 °C 5 min
c-mycCCAACAGGACTCGGTCACCAT290 bpV00568
RT-PCRGCTATGACCTCCTCCAGCT94 °C 5 min; 94 °C 1 min, 52 °C 1 min, 72 °C, 1 min, 35 X; 72 °C 5 min
p16INK4A MSPCAGAGGGTGCGGGCCGCG140 bpX94154
(Wild-type)GGGCGGACCCGCGCCGTGG95 °C 5 min; 95 °C 1 min, 65 °C 2 min, 72 °C 3 min, 5 X; 95 °C 30 s, 65 °C 30 s, 72 °C 1 min, 35 X; 72 °C 5 min
p16INK4AMSTTATTAGAGGGTGACCCCGAACCG150 bpX94154
P-methyl-primersGGGGCGGATCGCCGACCGTAA95 °C 5 min; 95 °C 1 min, 65 °C 2 min, 72 °C 3 min, 5 X; 95 °C 30 s, 65 °C 30 s, 72 °C 1 min, 35 X; 72 °C 5 min
p16INK4ATTATTAGAGGGTCAACCCCAAACC151 bpX94154
MSP-unmethyl primersGGGGTGGATTGTACAACCATAA95 °C 5 min; 95 °C 1 min, 60 °C 2 min, 72 °C 3 m °C, 5 X; 95 °C 30 s, 60 °C 30 s, 72 °C 1 min, 35 X; 70 °C 5 min
Methylation-Specific PCR (MSP) for p16INK4A

We followed Clark’s method of bisulfite treatment[20] with some modifications as follows. Two μg of total genomic DNA (from at least two independent treatments corresponding to RT-PCR experiments) was isolated by using QIAamp DNA blood mini kit (QIAGEN Inc.), then denatured by NaOH and modified by sodium bisulfite solution (2.35 mol/L) containing hydroquinone (0.04 mol/L)) freshly prepared. The bisulfite-treated DNA was desalted using Wizard DNA clean up kit (Promega). To amplify the p16INK4A promoter, we used 0.1 μg aliquot of converted DNA. Methylation of the 5’CpG island in p16INK4A gene was also determined in samples from HT-29 cells treated by 5-aza-dC. The bisulfite treated DNA was amplified by PCR using primers specific for the methylated or unmethylated primer. The GenBank accession number, sequences of primers and program of PCR are also shown in Table 1. PCR product was directly loaded onto 3% agarose gels and electrophoresed. The gel was stained with ethidium bromide and directly visualized under UV illumination.

RESULTS
Methylation in p16INK4A promoter in HT-29 cells treated with 5-ada-dC

We examined the methylation status of p16INK4A following 5-aza-dC treatment using MSP. Bisulfite treatment converted the cytosine residues in the genomic DNA to uracil, which were amplified as thymine during subsequent PCR. As shown in Figure 1, HT-29 cells showed a positive 150-151 bp band for methylated and unmethylated specific primer sets for p16INK4A respectively, indicating that p16INK4A gene was partially methylated in this cell line. The methylated bands for p16INK4A gene in the mock treated HT-29 cells were consistently stronger than the products of 5-aza-dC treated HT-29 cells. Thus, the product level from PCR using unmethylated primer was significantly higher, and methylated product level was correspondingly lower in HT-29 cells treated with 5-aza-dC.

Figure 1
Figure 1 5-aza-dC induced hypomethylation of the promoter of p16INK4A gene in HT-29 cells. Lane 1, untreated; lane 2, 5-aza-dC treated; lane 3, untreated with bisulfite. MSP was performed with the specific primers described in the Materials and Methods.

Three days after treatment with 1 μm of 5-aza-dC, MSP revealed a significant increase in the amount of unmethylated product (Figure 1). These results suggested that p16INK4A gene was a target of the decreased methylation level in HT-29 cells treated with 5-aza-dC.

Restoration of p16INK4A gene expression by 5-aza-dC

We initially tried to find out whether there were expressions of several tumor suppressor genes such as p16INK4A, p21WAF1 and APC, and proto-oncogene c-myc in human colon cancer cell lines HT-29 (p16INK4A only), Colo-320 and SW1116. mRNA levels of the above genes were investigated by using semiquantitative RT-PCR. p16INK4A gene was expressed in these three cell lines slightly prior to the treatment with 5-aza-dC.

In the first part of the present study, we examined the possibility of methylation on expression regulation of p16INK4A in three colon cancer cell lines. Increased levels of p16INK4A expression were seen in HT-29 cells treated with lower (1 μmol/L, 24 hours) but not higher (10 μmol/L, 24 hours) concentrations of 5-aza-dC (Figure 2, Table 2). In contrast, 5-aza-dC induced transcription of p16INK4A at higher concentration (10 μmol/L)) for 24 hours or 72 hours, but not at the lower concentration (2 μmol/L or 5 μmol/L) for the same duration (Figure 3A and Figure 3B, lanes 3 and 4, Table 3).

Table 2 The expression of p16INK4A gene in HT-29 cells (the band density).
5-aza-dC concMock treated1 μM, 24 h10 μM, 24 h
Density2257.72782.51975.3
Figure 2
Figure 2 Up-regulated mRNA level of p16INK4A by 5-aza-dC in HT-29 cells. RT-PCR was performed as described in Materials and Methods. β-actin was used as a loading/amplification control.
Table 3 Expression of p16INK4A gene in SW1116 and Colo-320 cells (the band density).
5-aza-dC treatmentMock treated2 μmol/L, 24 h5 μmol/L, 24 h10 μmol/L, 24 h2 μmol/L, 72 h5 μmol/L, 72 h10 μmol/L, 24 h
SW11161494.72055.52436.93487.31592.02074.82774.0
Colo-320809.1860.6829.21298.8875.7923.51189.6
Figure 3
Figure 3 5-aza-dC increased the transcription of p16INK4A gene in Colo-320 (A) and SW1116 cells. Lane 1: mock treatment. Lanes 2-7: after 5-aza-dC treatment; lane 2: 2 μmol/L, 24 h; lane 3: 5 μmol/L, 24 h; lane 4: 10 μmol/L, 24 h; lane 5: 2 μmol/L, 72 h; lane 6: 5 μmol/L, 72h; lane 7: 10 μmol/L, 72 h. The density of bands shown in Table 3.
5-aza-dC increased transcription level of APC gene

To identify whether the transcription level of APC was regulated by DNA methylation in human colon cancer cell lines, we cultured Colo-320 and SW1116 cells with or without 5-aza-dC treatment for 24 hours and 72 hours. The data from RT-PCR implied that before incubation with 5-aza-dC, the levels of APC transcription in these cells were lower (Figure 4, line 1, Table 4). Incubation for 24 hours with 5-aza-dC resulted in the accumulation of APC mRNA, whose levels remained unchanged during the 72 hour incubation period. APC mRNA levels were normalized with respect to the level of β-actin mRNA, which did not change during culture with 5-aza-dC (Figure 4, Table 4). RT-PCR was repeated twice and the results were consistent.

Table 4 Expression of APC gene in SW1116 and Colo-320 cells (the band density).
5-aza-dC treatmentMock treated2 μmol/L, 24 h5 μmol/L, 24 h10 μmol/L, 24 h2 μmol/L, 72 h5 μmol/L, 72 h10 μmol/L, 24 h
SW1116786.21481.2782.6796.9802.91173.51236.8
Colo-3201804.62388.24055.21923.91803.03197.83271.7
Figure 4
Figure 4 5-aza-dC increased the transcription of APC gene in Colo-320 (A) and SW1116 cells. Lane 1: mock treatment. Lanes 2-7: after 5-aza-dCtreatment; lane 2: 2 μmol/L, 24 h; lane 3: 5 μmol/L, 24 h; lane 4: 10 μmol/L, 24 h; lane 5: 2 μmol/L, 72 h; lane 6: 5 μmol/L, 72 h; lane 7: 10 μmol/L, 72 h. The density of bands shown in Table 4.

The effectiveness of 5-aza-dC on the expression of APC was high even at lower concentration (2 μmol/L), suggesting that methylation-induced silencing of this gene was the primary event. Restoration of APC expression by 5-aza-dC treatment confirmed a causal relationship between DNA hypermethylation and APC silencing in colon cancer cell lines Colo-320 and SW1116.

5-aza-dC treatment failed to induce expression of p21WAF1 and c-myc in Colo-320 and SW1116 cells

To further define the modification status of p21WAF1 and c-myc expression in colon carcinogenesis, we attempted to observe whether their transcription levels would change after treatment with DNMT inhibitor. Although no expression of p21WAF1 and significant over-expression of c-myc were seen in mock treatment. Our current study revealed that almost no change in activity was seen when these two cell lines Colo-320 and SW1116 cells were treated by 5-aza-dC. In other words, regulation of methylation on the expression of p21WAF1 and c-myc genes was not found (data not shown).

Taken these together, it was suggested that the methylation silencing transcription be localized at specific regions of the chromatin. Other mechanisms might play a role in controlling the activity of p21WAF1 and c-myc genes in colon cancer cell lines Colo-320 and SW1116.

DISCUSSION

Compelling evidences for the role of epigenetic modification on the regulation of gene transcription have been published[21-26]. p16INK4A was a tumor suppressor gene originally identified by Serrano et al[27], and the methylation profile of p16INK4A promoter differed in each cancer type[28]. Several studies indicat that 5-aza-dC induced growth inhibition might be resulted from the release of methylation silenced cell cycle regulatory gene p16INK4A[29]. APC gene hypermethylation is frequent but not universal in colon cancer cell line. Previous studies showed that p21WAF1 transcription was regulated by histone acetylation, another modification of epigenetics in human colon cancer[30], but little is known about the effect of DNA methylation on this gene expression.

In the current study, our findings indicated firstly that p16INK4A was expressed in these three human colon cancer cell lines, and APC was expressed with p21WAF1 inactivated in Colo-320 and SW1116 cells. 5-aza-dC induced hypomethylation of p16INK4A promoter and the restoration of p16INK4A transcription, suggesting that DNA methylation is the major regulation mechanism for p16INK4A in HT-29, Colo-320 and SW1116 cells. Previously it was suggested that lack of p21WAF1 expression appeared to be the result of hypermethylation of it’s promoter region, as p21WAF1 protein expression could be induced by growth of Rat-1 cells in the presence of 5-aza-dC[31]. However, the influence of methylation on p21WAF1 gene expression was dependent on differentiation of cells and tissues[30]. An important finding from this study indicated that reduction of DNA methylation might not play a crucial role in the regulation of p21WAF1 transcription in human colon cancer cell lines, Colo-320 and SW1116.

c-Myc proto-oncoprotein has been found to be deregulated in colon cancer. Over-expression of c-Myc in tissue culture caused an increase in cell proliferation with a shortened G1 phase, whereas loss of c-Myc resulted in slow growth and longer G1 phase[32]. Over-expression and abnormal intracellular location of the product of proto-oncogene c-myc in colon dysplasia and neoplasia might be related to the alteration in epigenetic mechanisms controlling the function of this gene[33]. Although hypomethylation of c-myc in human tumors has also been reported, it is not clear whether demethylation induces the over-expression of c-myc in human tumor cell lines. This paper reports that 5-aza-dC did not up-regulate c-myc transcription, while the expression of p16INK4A and APC tumor suppressor genes responded to 5-aza-dC treatment in colon cancer cell lines. The reason why 5-aza-dC failed to colon cancer treatment was not due to c-myc over-expression from demethylation.

In conclusion, our study results support the concept that there are significant differences in the regulatory response to DNA methylation in different genes including tumor suppressor gene and proto-oncogene, even in the same colon cancer cell lines Colo-320 or SW1116.

ACKNOWLEDGEMENTS

We are grateful to Ms.Hong-Yin Zhu and Ju-Fang Tong for performing the RT-PCR and cell culture, and Dr.Xie-Ning Wu for his assistance in preparing this manuscript.

References
1.  Baylin SB, Herman JG, Graff JR, Vertino PM, Issa JP. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv Cancer Res. 1998;72:141-196.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1278]  [Cited by in RCA: 1181]  [Article Influence: 42.2]  [Reference Citation Analysis (0)]
2.  Herman JG, Latif F, Weng Y, Lerman MI, Zbar B, Liu S, Samid D, Duan DS, Gnarra JR, Linehan WM. Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc Natl Acad Sci USA. 1994;91:9700-9704.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1065]  [Cited by in RCA: 1068]  [Article Influence: 33.4]  [Reference Citation Analysis (0)]
3.  Nakayama S, Sasaki A, Mese H, Alcalde RE, Tsuji T, Matsumura T. The E-cadherin gene is silenced by CpG methylation in human oral squamous cell carcinomas. Int J Cancer. 2001;93:667-673.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 66]  [Cited by in RCA: 62]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
4.  Nagai MA, Habr-Gama A, Oshima CT, Brentani MM. Association of genetic alterations of c-myc, c-fos, and c-Ha-ras proto-oncogenes in colorectal tumors. Frequency and clinical significance. Dis Colon Rectum. 1992;35:444-451.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 13]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
5.  Fang JY, Xiao SD. Alteration of DNA methylation in gastrointestinal carcinogenesis. J Gastroenterol Hepatol. 2001;16:960-968.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 34]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
6.  Vettese-Dadey M, Grant PA, Hebbes TR, Crane- Robinson C, Allis CD, Workman JL. Acetylation of histone H4 plays a primary role in enhancing transcription factor binding to nucleosomal DNA in vitro. EMBO J. 1996;15:2508-2518.  [PubMed]  [DOI]
7.  Herman JG, Merlo A, Mao L, Lapidus RG, Issa JP, Davidson NE, Sidransky D, Baylin SB. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res. 1995;55:4525-4530.  [PubMed]  [DOI]
8.  Gonzalez-Zulueta M, Bender CM, Yang AS, Nguyen T, Beart RW, Van Tornout JM, Jones PA. Methylation of the 5' CpG island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing. Cancer Res. 1995;55:4531-4535.  [PubMed]  [DOI]
9.  Russo P, Malacarne D, Falugi C, Trombino S, O'Connor PM. RPR-115135, a farnesyltransferase inhibitor, increases 5-FU- cytotoxicity in ten human colon cancer cell lines: role of p53. Int J Cancer. 2002;100:266-275.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 29]  [Article Influence: 1.2]  [Reference Citation Analysis (1)]
10.  Mori H, Niwa K, Zheng Q, Yamada Y, Sakata K, Yoshimi N. Cell proliferation in cancer prevention; effects of preventive agents on estrogen-related endometrial carcinogenesis model and on an in vitro model in human colorectal cells. Mutat Res. 2001;480-481:201-207.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 51]  [Cited by in RCA: 45]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
11.  Ding X, Flatt PR, Permert J, Adrian TE. Pancreatic cancer cells selectively stimulate islet beta cells to secrete amylin. Gastroenterology. 1998;114:130-138.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 54]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
12.  Rylova SN, Amalfitano A, Persaud-Sawin DA, Guo WX, Chang J, Jansen PJ, Proia AD, Boustany RM. The CLN3 gene is a novel molecular target for cancer drug discovery. Cancer Res. 2002;62:801-808.  [PubMed]  [DOI]
13.  Gao Z, Gao Z, Fields JZ, Boman BM. Tumor-specific expression of anti-mdr1 ribozyme selectively restores chemosensitivity in multidrug-resistant colon-adenocarcinoma cells. Int J Cancer. 1999;82:346-352.  [PubMed]  [DOI]  [Full Text]
14.  Shiraki K, Tsuji N, Shioda T, Isselbacher KJ, Takahashi H. Expression of Fas ligand in liver metastases of human colonic adenocarcinomas. Proc Natl Acad Sci USA. 1997;94:6420-6425.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 190]  [Cited by in RCA: 187]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
15.  Moertel CG, Schutt AJ, Reitemeier RJ, Hahn RG. Phase II study of 5-azacytidine (NSC-102816) in the treatment of advanced gastrointestinal cancer. Cancer Chemother Rep. 1972;56:649-652.  [PubMed]  [DOI]
16.  Bellet RE, Mastrangelo MJ, Engstrom PF, Strawitz JG, Weiss AJ, Yarbro JW. Clinical trial with subcutaneously administered 5-azacytidine (NSC-102816). Cancer Chemother Rep. 1974;58:217-222.  [PubMed]  [DOI]
17.  Abele R, Clavel M, Dodion P, Bruntsch U, Gundersen S, Smyth J, Renard J, van Glabbeke M, Pinedo HM. The EORTC Early Clinical Trials Cooperative Group experience with 5-aza-2'-deoxycytidine (NSC 127716) in patients with colo-rectal, head and neck, renal carcinomas and malignant melanomas. Eur J Cancer Clin Oncol. 1987;23:1921-1924.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 97]  [Cited by in RCA: 84]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
18.  Fang JY, Mikovits JA, Bagni R, Petrow-Sadowski CL, Ruscetti FW. Infection of lymphoid cells by integration-defective human immunodeficiency virus type 1 increases de novo methylation. J Virol. 2001;75:9753-9761.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 68]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
19.  Bender CM, Gonzalgo ML, Gonzales FA, Nguyen CT, Robertson KD, Jones PA. Roles of cell division and gene transcription in the methylation of CpG islands. Mol Cell Biol. 1999;19:6690-6698.  [PubMed]  [DOI]
20.  Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res. 1994;22:2990-2997.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1369]  [Cited by in RCA: 1372]  [Article Influence: 42.9]  [Reference Citation Analysis (0)]
21.  Usadel H, Brabender J, Danenberg KD, Jerónimo C, Harden S, Engles J, Danenberg PV, Yang S, Sidransky D. Quantitative adenomatous polyposis coli promoter methylation analysis in tumor tissue, serum, and plasma DNA of patients with lung cancer. Cancer Res. 2002;62:371-375.  [PubMed]  [DOI]
22.  Jin Z, Tamura G, Tsuchiya T, Sakata K, Kashiwaba M, Osakabe M, Motoyama T. Adenomatous polyposis coli (APC) gene promoter hypermethylation in primary breast cancers. Br J Cancer. 2001;85:69-73.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 94]  [Cited by in RCA: 103]  [Article Influence: 4.1]  [Reference Citation Analysis (0)]
23.  Shibata DM, Sato F, Mori Y, Perry K, Yin J, Wang S, Xu Y, Olaru A, Selaru F, Spring K. Hypermethylation of HPP1 is associated with hMLH1 hypermethylation in gastric adenocarcinomas. Cancer Res. 2002;62:5637-5640.  [PubMed]  [DOI]
24.  To KF, Leung WK, Lee TL, Yu J, Tong JH, Chan MW, Ng EK, Chung SC, Sung JJ. Promoter hypermethylation of tumor-related genes in gastric intestinal metaplasia of patients with and without gastric cancer. Int J Cancer. 2002;102:623-628.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 98]  [Cited by in RCA: 97]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
25.  Shen L, Ahuja N, Shen Y, Habib NA, Toyota M, Rashid A, Issa JP. DNA methylation and environmental exposures in human hepatocellular carcinoma. J Natl Cancer Inst. 2002;94:755-761.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 201]  [Cited by in RCA: 185]  [Article Influence: 7.7]  [Reference Citation Analysis (0)]
26.  Norrie MW, Hawkins NJ, Todd AV, Meagher AP, O'Connor TW, Ward RL. The role of hMLH1 methylation in the development of synchronous sporadic colorectal carcinomas. Dis Colon Rectum. 2002;45:674-680.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 23]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
27.  Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature. 1993;366:704-707.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2729]  [Cited by in RCA: 2535]  [Article Influence: 76.8]  [Reference Citation Analysis (0)]
28.  Esteller M, Corn PG, Baylin SB, Herman JG. A gene hypermethylation profile of human cancer. Cancer Res. 2001;61:3225-3229.  [PubMed]  [DOI]
29.  Bender CM, Pao MM, Jones PA. Inhibition of DNA methylation by 5-aza-2'-deoxycytidine suppresses the growth of human tumor cell lines. Cancer Res. 1998;58:95-101.  [PubMed]  [DOI]
30.  Fang JY, Lu YY. Effects of histone acetylation and DNA methylation on p21( WAF1) regulation. World J Gastroenterol. 2002;8:400-405.  [PubMed]  [DOI]
31.  Allan LA, Duhig T, Read M, Fried M. The p21(WAF1/CIP1) promoter is methylated in Rat-1 cells: stable restoration of p53-dependent p21(WAF1/CIP1) expression after transfection of a genomic clone containing the p21(WAF1/CIP1) gene. Mol Cell Biol. 2000;20:1291-1298.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 52]  [Cited by in RCA: 48]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
32.  Bush A, Mateyak M, Dugan K, Obaya A, Adachi S, Sedivy J, Cole M. c-myc null cells misregulate cad and gadd45 but not other proposed c-Myc targets. Genes Dev. 1998;12:3797-3802.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 135]  [Cited by in RCA: 143]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
33.  Sharrard RM, Royds JA, Rogers S, Shorthouse AJ. Patterns of methylation of the c-myc gene in human colorectal cancer progression. Br J Cancer. 1992;65:667-672.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 84]  [Cited by in RCA: 80]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
Footnotes

Edited by Zhu LH and Wang XL

Write to the Help Desk