Roles of Fas signaling pathway in vitamin E succinate-induced apoptosis in human gastric cancer SGC-7901 cells

Abstract

AIM: To investigate the roles of Fas signaling pathway in vitamin E succinate-induced apoptosis in human gastric cancer SGC-7901 cells.

METHODS: Human gastric cancer SGC-7901 cells were treated with VES at 5, 10, 20 mg·L^-1, succinic acid and vitamin E as vehicle control and condition media only as untreated (UT) control. Apoptotic morphology was observed by DAPI staining. Western blot analysis was applied to measure the expression of Fas, FADD and caspase-8 proteins. After the cells were transiently transfected with Fas and FADD antisense oligonucleotides, respectively, caspase-8 activity was determined by flurometric method.

RESULTS: The morphologically apoptotic changes were observed after VES treatment by DAPI staining. 23.7% and 89.6% apoptosis occurred after 24 h and 48 h of 20 mg·L^-1 VES treatment, respectively. The protein levels of Fas, FADD and caspase-8 were evidently increased in a dose-dependent manner after 24 h of VES treatment. The blockage of Fas by transfection with Fas antisense oligonucleotides obviously inhibited the expression of FADD protein. After SGC-7901 cells were transfected with Fas and FADD antisense oligonucleotides, caspase-8 activity was obviously decreased (P < 0.01), whereas Fas blocked more than FADD.

CONCLUSION: VES-induced apoptosis in human gastric cancer SGC-7901 cells involves Fas signaling pathway including the interaction of Fas, FADD and caspase-8.

Key Words: $[Keywords]

INTRODUCTION

RRR-α-tocopheryl succinate (vitamin E succinate, VES), a derivative of natural vitamin E, has been shown to be a potent growth inhibitor of many kinds of cancer cell types[1-5]. Antiproliferative effects of VES on tumor cells are diverse, including G1 cell cycle blockage[6-8], DNA synthesis arrest[9-11], induction of differentiation[12-14] and apoptosis[15-17]. Meanwhile, tumor cell growth inhibition by VES has also been demonstrated in vivo[18,19]. VES is noteworthy for its non-toxic and non-inhibitory effects on normal cell types, indicating that VES can be used as a chemopreventive/chemotherapeutic agent against tumors.

Up to date, the precise mechanisms of VES-induced inhibition of tumor cell growth are not well understood, but some studies show that VES can increase the secretion and activation of transforming growth factor-βs (TGF-βs) and enhance the expression of TGF-β receptor II[10,20]. Yu et al[21] reported that VES-triggered apoptosis in human breast cancer cell lines is inhibited by 50% with antibody neutralization of TGF-β ligand and transient transfection of TGF-β antisense oligonucleotides, implicating that TGF-β plays a crucial role in VES-induced apoptosis and VES may induce cancer cells to undergo apoptosis through other pathways as well. Turley et al[22] observed that the expression of Fas, a cell surface receptor, is increased after treatment of breast cancer cells with VES and VES-induced apoptosis in breast cancer cells is inhibited when Fas neutralized antibody or transfection of Fas antisense oligonucleotides are applied to cancer cells, showing that Fas-mediated apoptosis may be another important pathway by which VES inhibits tumor cell growth.

Gastric cancer is one of the most common malignant tumors in China[23-32]. Our previous studies found that VES can block cell cycle, arrest DNA synthesis and induce apoptosis in human gastric cancer SGC-7901 cells, therefore inhibiting cell growth[33-36]. In addition, our in vivo research demonstrated that VES inhibits benzo(a)pyrene (B(a)P)-induced forestomach carcinogenesis in female mice[37]. The exact mechanisms of apoptosis are not clearly known, but we found that VES can secrete and activate biologically active TGF-β and then TGF-β increases the kinase activity of c-Jun N-terminal kinase(JNK) followed by phosphorylation of c-Jun, and finally activated c-Jun triggers apoptosis in human gastric cancer SGC-7901 cells[38]. In this study, signaling pathway of Fas-induced apoptosis in VES-treated SGC-7901 cells is determined to further investigate the mechanisms of VES-induced growth inhibition.

MATERIALS AND METHODS

Materials

VES was purchased from Sigama Co. Ltd. RPMI 1640 media and LIPOFECTAMINE PLUS^TM Reagent were obtained from Gibco BRL, ApoAlert^TM Caspase-8 Fluorescent Assay kit from Clontech, Inc. DAPI (4’,6-diamidine-2’-phenylindole dihydrochloride), FADD and caspase-8 rabbit polyclonal antibodies, Fas antisense (GAGGGTCCAGATGCCCAGCAT) and FADD antisense (CAGCACCAGGAACGGGTCCAT) oligonucleotides were gifts from Dr. Sanders BG (University of Texas, Austin, USA). Fas rabbit polyclonal antibody was from Santa Cruz Biotechnology, Inc.

Methods

Cell culture Human gastric cancer cell lines SGC-7901 were maintained in RPMI 1640 medium supplemented with 100 mL·L^-1 fetal calf serum (FCS), 100 kU·L^-1 penicillin, 100 mg·L^-1 streptomycin and 2 mmol·L^-1 L-glutamine under 50 mL·L^-1 CO₂ in a humidified incubator at 37 °C. SGC-7901 cells were incubated for different time periods in the presence of VES at 5, 10 and 20 mg·L^-1 (VES was dissolved in absolute ethanol and diluted in RPMI 1640 complete condition media correspondingly to a final concentration of VES and 1 mL·L^-1 ethanol), succinic acid, vitamin E and ethanol equivalents as vehicle (VEH) control and condition media only as untreated (UT) control.

Determination of apoptosis Cells were treated with VES at 20 mg/L^-1 for 48 h, then harvested, washed with PBS and stained with 2 mg·L^-1 DAPI in 100% methanol for 30 min at 37 °C. Cells were viewed using a fluorescence microscope with ultraviolet (UV) excitation at 300-500 nm. Cells with nuclei that contained clearly condensed chromatin or cells with fragmented nuclei were scored as apoptotic.

Western blot analysis SGC-7901 cells treated with VES were harvested, washed in PBS and lyzed in lysis buffer containing 150 mmol·L^-1 NaCl, 1 mL·L^-1 NP-40, 5 mg·L^-1 sodium deoxycholate, 1 g·L^-1 SDS, 50 mmol·L^-1 Tris (pH 7.4), 1 mmol·L^-1 DTT, 0.5 mmol·L^-1 Na₃VO₄, 10 mmol·L^-1 phenylmethylsulfonyl fluoride (PMSF), 10 mg·L^-1 trypsin, 10 mg·L^-1 aprotinin and 5 mg·L ^-1 leupeptin. Following the centrifugation of 12000 × g for 30 min at 4 °C, the amount of protein in the supernatant was determined using Biorad DC protein assay. Equal amount of protein was separated on 10% SDS-PAGE and transferred to nitrocellulose filter (Gibco BRL, USA) overnight. Blocked with 50 g·L^-1 defatty milk, the filter was incubated with Fas, FADD and caspase-8 rabbit polyclonal antibodies, respectively, and horseradish peroxidase-conjugated IgG, finally developed with DAB.

Transient transfection The cells were washed twice with serum-free medium without antibiotics and incubated for 3 h in 2 mL of serum-free medium containing 30 μL of LIPOFECTAMINE Reagent and 2 ug of Fas or FADD antisense oligonucleotides. After 3 h, the cells were treated with VES.

Caspase-8 activity assay Caspase-8 activity was determined according to the manufacurer’s instructions. Briefly, 50 μL of supertanant from VES-treated cell extracts were mixed with 50 μL of a mixture of 2 × reacion buffer and DTT, then 1 μL of 1 mmol·L^-1 IETD-fmk and incubated for 30 min at 37 °C in water bath. Next, 5 μL of 1 mmol·L^-1 IETD-AFC was added, followed by incubation for 1 h at 37 °C in water bath. The fluorescent absorbance (A) was measured at 400nm for emission and at 505 nm for excitaion.

Statistical analysis

The data were expressed as ^-x± s. Statistical analysis was performed using student’s t-test. P < 0.05 was considered significant.

RESULTS

VES induced apoptosis in SGC-7901 cells

SGC-7901 cells in untreated control group and 20 mg·L^-1 VES group were cultured for 48 h, collected and stained with DAPI. The morphological changes were observed with fluorescent apoptosis occurred after 24 h and 48 h of 20 mg·L^-1 VES treatment, respectively.microscope at 300-500 nm (Figure 1). The nuclei in UT control group exhibited circular-like shape, clear edge, and homogeneous staining; while those treated with VES showed uneven edge, chromatin condensation, pyknosis and formation of apoptotic body. 23.7% and 89.6%.

Figure 1 SGC-7901 cells stained with DAPI. A: UT control; B: VES at 20 mg·L^-1

Effects of VES on protein expression

The protein levels of Fas, FADD and caspase-8, as determined by western blot analysis of cells extracts obtained from VES-treated SGC-7901 cells, were evidently increased in a dose-dependent manner after 24 h of VES treatment (Figures 2, 3 and 4).

Figure 2 The expression of Fas protein in SGC-7901 cells follow-ing treatment of VES for 24 h. Lane1: Molecular weight marker; Lane2: UT control; Lane3: succinate; Lane4: vitamin E; Lane5: VES at 5 mg·L^-1; Lane6: VES at 10 mg·L^-1; Lane7: VES at 20 mg·L^-1.

Figure 3 The expression of FADD protein in SGC-7901 cells fol-lowing treatment of VES for 24 h. Lane1: Molecular weight marker; Lane2: VES at 20 mg·L^-1; Lane3: VES at 10 mg·L^-1; Lane4: VES at 5 mg·L^-1; Lane5: vitamin E; Lane6: succinate; Lane7: UT control.

Figure 4 The expression of caspase-8 protein in SGC-7901 cells fol-lowing treatment of VES for 24 h. Lane1: Molecular weight marker; Lane2: UT control; Lane3: succinate; Lane4: vitamin E; Lane5: VES at 5 mg·L^-1; Lane6: VES at 10 mg·L^-1; Lane7: VES at 20 mg·L^-1.

The expression of FADD protein when Fas was blocked in VES-treated SGC-7901 cells

SGC-7901 cells were transiently transfected with antisense oligonucleotides to Fas, followed by 20 mg·L^-1 VES treatment for 24 h. The expression of FADD protein was decreased by 77% compared with that in control group (Figure 5), indicating that the blockage of Fas signal obviously inhibited the expression of FADD protein.

Figure 5 The expression of FADD protein when Fas antisense was transfected into SGC-7901 cells following treatment of VES for 24 h.

Effects of blockage of Fas and FADD on caspase-8 activity in VES-treated SGC-7901 cells

SGC-7901 cells were transfected with Fas and FADD antisense oligonucleotides, respectively, followed by VES treatment for 24 h at different doses. Caspase-8 activity in both cases was decreased with significant differences compared with the activity in the same dose of VES-treated cells untransfected in an obviously dose-dependent manner (Table 1). Meanwhile, caspase-8 activity in Fas antisense-transfected cells was reduced more than that in FADD antisense-transfected cells and the differences were significant.

Table 1 Effects of blockage of Fas and FADD on caspase-8 activity in VES-treated SGC-7901 cells.

Groups	Doses (mg·L-1)	Caspase-8 activity
VES	5	12.1 ± 0.70
	10	21.6 ± 0.88
	20	32.4 ± 1.71
Fas antisense + VES	5	5.1 ± 0.35b
	10	10.9 ± 0.39b
	20	16.9 ± 0.87b
FADD antisense + VES	5	9.6 ± 0.34bd
	10	15.7 ± 0.29bd
	20	21.9 ± 0.83bd

^bP < 0.01, vs VES at the same dose;

^dP < 0.01, vs Fas antisense at the same dose.

DISCUSSION

Fas (also called CD95/APO-1), a 45 kDa type I transmembrane protein, belongs to the nerve growrth factor(NGF)/tumor necrosis factor (TNF) receptor superfamily. As a member of five death domain-containing receptors, Fas intiates a signal-transduction cascade leading to programmed cell death[39-42]. In this study, we determined the expression of Fas protein in VES-treated SGC-7901 cells. The data showed that after 24 h of VES treatment, the expression of Fas protein was evidently increased with a marked dose-dependent relationship in comparison with control, indicating that Fas signal pathway is initiated in the course of VES-triggered apoptosis. After VES treatment following transfection of Fas antisense oligonuceotides into SGC-7901 cells, the expression of Fas protein and caspase-8 activity were obviously reduced and VES-induced apoptosis was inhibited by 50%, implicating that Fas may play an essential role in VES-mediated apoptosis in human gastric cancer SGC-7901 cells.

All the death receptors’ cytoplasmic regions contain a death domain (DD) reqired for cytotoxic signal transduction. Engagement of death receptors by their ligands can lead death receptors to oligomerization; then an adaptor protein is required to recruit death receptors to their effectors. Engagement of Fas by Fas ligand or agonistic anti-Fas antibodies can induce apoptosis in Fas-bearing cells[43-46]. The main death pathway initiated from Fas activation involves a series of death associated molecules including FAP-1 (Fas-associated protein 1), RIP (receptor interaction protein) and FADD (Fas-associated death domain-containing protein)[47]. Therefore, the roles of FADD in VES-treated SGC-7901 cells were also investigated in the present study.

FADD (also known as MORT1), a cytoplasmic protein, contains 208 amimo acids and N-terminal amino acids of FADD constitute a death effector domain (DED) essential to death signal transduction[47-50]. We treated SGC-7901 cells with VES and found that the level of FADD protein was obviously elevated compared with control in an evident dose-dependent manner, showing that FADD was also involved in the signaling pathway of VES-mediated apoptosis in SGC-7901 cells. In addition, we transfected SGC-7901 cells with FADD antisense oligonucleotides followed by treating them with VES. The results showed that the expression of FADD protein and caspase-8 activity was obviously inhibited, further suggesting that FADD was associated with VES-triggered apoptosis in human gastric cancer SGC-7901 cells.

Caspase-8 (MACH1/FLICE), a member of interleukin 1β-converting enzyme family of proapoptotic proteases, contains two N-terminal stretches that are apparently homologous to death effector domain (DED) of FADD through which FADD recruits to caspase-8 leading to the activation of the proteolytic cascade of caspases[51-54]. Kim et al[55] found that Fas-mediated apoptosis was completely blocked in caspase-8-deficient Jurkat T lymphocytes and restored in the case of recruitment of wild-type caspase-8, indicating that caspase-8 is an important mediator of Fas-induced apoptosis. We show here that the expression and activity of caspase-8 in SGC-7901 cells were apparently elevated, demonstrating that caspase-8 is associated with VES-induced apoptosis. In order to explore the relationship among Fas, FADD and caspase-8 in VES-induced apoptosis in SGC-7901 cells, we determined the activity of caspase-8 following transfection of SGC-7901 cells with Fas and FADD antisense oligonucleotides. The data showed that the blockage of Fas and FADD obviously reduced the activity of caspase-8 in VES-treated SGC-7901 cells, while the blockage of Fas did more than that of FADD.

In summary, the adaptor protein FADD is recruited to Fas receptor via mutual interaction of their DDs. FADD in turn recruits procaspase-8 through interaction between DEDs of FADD and procaspase-8. Upon formation of this death-inducing signaling complex, procaspase-8 is activated leading to the activation of the proteolytic cascade of caspases, so Fas may play a crucial role in VES-mediated apoptosis in human gastric cancer SGC-7901 cells. VES-mediated apoptosis is very complex. It is reported that mitochondria permeability transition (MPT) participates in apoptosis[56-61]. Therefore, additional studies should provide insight into the role of the biological significance of mitochondria in the mechanisms of tumor cell growth inhibition by VES in future.