BPG is committed to discovery and dissemination of knowledge
Gastric Cancer Open Access
©The Author(s) 2002. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Jun 15, 2002; 8(3): 426-430
Published online Jun 15, 2002. doi: 10.3748/wjg.v8.i3.426
Rapid screening mitochondrial DNA mutation by using denaturing high-performance liquid chromatography
Man-Ran Liu, Kai-Feng Pan, Zhen-Fu Li, Yi Wang, Da-Jun Deng, Lian Zhang, You-Yong Lu, Beijing Institute for Cancer Research, Beijing Laboratory of Molecular Oncology, School of Oncology, Peking University, Beijing 100034, China
Author contributions: All authors contributed equally to the work.
Supported by the National Key Basic Science Research Program, No. G1998051203 and National Science Foundation of China (NSFC), No. 39602526.
Correspondence to: Dr. You-Yong Lu, Peking University, School of Oncology, Beijing Institute for Cancer Research, Beijing Laboratory of Molecular Oncology, 1 Da-Hong-Luo-Chang Street, Western District, Beijing 100034, China. yongylu@public.bta.net.cn
Telephone: +86-10-66163061 Fax: +86-10-66175832
Received: January 28, 2002
Revised: February 17, 2002
Accepted: March 14, 2002
Published online: June 15, 2002

Abstract

AIM: To optimize conditions of DHPLC and analyze the effectiveness of various DNA polymerases on DHPLC resolution, and evaluate the sensitivity of DHPLC in the mutation screening of mitochondrial DNA (mtDNA).

METHODS: Two fragments of 16s gene of mitochondrial DNA (one of them F2 is a mutant fragment) and an A3243G mutated fragment were used to analyze the UV detection limit and determine the minimum percentage of mutant PCR products for DHPLC and evaluate effects of DNA polymerases on resolution of DHPLC. Under the optimal conditions, we analyzed the mtDNA mutations from muscle tissues of mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS) and screened blindly for variances in D-loop region of mtDNA from human gastric tumor specimen.

RESULTS: Ten A3243G variants were detected in 12 cases of MELAS, no alterations were detected in controls and these results were consistent with the results obtained by analysis of RFLP with Apa I. We also identified 26 D-loop variances in 46 cases of human gastric cancer tissues and 38 alterations in 13 gastric cancer cell lines. The mutation of mtDNA at 80 ng PCR products containing a minimum of 5% mutant sequences could be detected by using DHPLC with UV detector. Moreover, Ampli-Taq Gold polymerase was equally as good as the proofreading DNA polymerase (e.g., Pfu) in eliminating the false positive produced by Taq DNA polymerases.

CONCLUSION: DHPLC is a powerful, rapid and sensitive mutation screening method for mtDNA. Proofreading DNA polymerase is more suitable for DHPLC analysis than Taq polymerase.




INTRODUCTION

A number of methods, such as PCR-SSCP, DGGE and CSGE, have been developed to screen the gene mutation. PCR-SSCP is a common method in mutation detection[1-16]. The low resolution and reproducibility or time-cost limit their application for mutation screening[17-23]. Recently, a more accurate and rapid DNA screening strategy[24-29]-Denaturing High-performance Liquid Chromatography (DHPLC) has been applied to mutation screening in human disease-related gene[30-42] and prenatal diagnosis[43,44].

However, there are few published data on detection of mitochondrial DNA (mtDNA) variation by DHPLC, especially in cancer. In order to detect effectively the mtDNA mutation, the optimizations of DHPLC for mtDNA mutation screening have been evaluated. The evaluation included the ultraviolet (UV) detection limit for PCR products with variant ingredients, minimal detected ratio of variant to wild type in PCR mixture. In addition, small peak was often observed preceding the chromatography profile in both amplimers of nucleus and mitochondrial genes when Taq DNA polymerases were used in PCR amplification. It may result in failure of DHPLC analysis. Therefore, we also evaluated the effect of DNA polymerasess on the resolution of DHPLC in detection of heteroduplex. Basing on those analyses, we identified the mutation of A3243G substitute for patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS). Finally, the variances of D-loop in mtDNA were blindly screened by DHPLC for patients with gastric carcinoma and gastric cancer cell lines.

MATERIALS AND METHODS
Samples and DNA preparation

The specimen in this study included: (1) 12 cases of MELAS, 72 cases of other mitochondrial encephalomyopathies and 30 cases of controls. (2) 46 paired samples of gastric tumor tissues and non-tumor tissues, and 13 gastric cancer cell lines. (3) A randomly selected fragment (fragment 6: from 2616 to 2884 nt) within 16s gene was selected to evaluate effect of 11 brands of DNA polymerases on resolution of DHPLC. (4) Another variant fragment (fragment 2: from 1777 to 2069 nt) in 16s gene of gastric cancer cell line MKN45 was used to analyze the UV detection limit of PCR products for DHPLC. A variant sample of MELAS, whose ratio of mutant type (G) to wild type (A) at 3243 allele site was about 60 percent, was employed to determine the minimum percentage of mutant PCR products for DHPLC. The genome DNA was isolated following standard phenol/chloroform and ethanol precipitation extraction procedures.

PCR conditions and quantification of PCR products

Fragment containing A3243G mutatioo in mtDNA of MELAS was amplified by using one pair of oligonucleotide primers. Fragments of D-loop were amplified by using four pairs of overlapping primers desribed by Levin et al[45]. Another pair of primers was used to amplify fragment 6 (F6) within 16 s gene for assessing effect of DNA polymerases on DHPLC (Table 1). 20 μL standard PCR reactive system contain genome DNA 15 ng, forward and reverse primer 125 nmol·L-1 each, 1 × buffer (Mg2+ 1.6 μmol·L-1), dNTP 37.5 μmol·L-1, Pfu DNA polymerase 1.5 units (or Taq DNA polymrases 1 unit). PCR was performed with 32 cycles consisting of a denaturing step of 94 °C for 35 s, primer annealing for 50 s and an elongation step of 72 °C for 90 s. The final step at 72 °C was extended to 10 min. Annealing temperature of each fragment was showed in table 1. In addition, one mutated fragment (F2), harboring in mitochondrial 16s gene of gastric cancer cell line MKN45, was used to analyze the UV detection limit of PCR products for DHPLC and amplified by PCR protocol for 19, 21, 24, 27, 30 cycles at annealing temperature of 53 °C with Pfu polymerase.

Table 1 Primer sequence, PCR Conditions and DHPLC oven temperature used in this study.
FragmentsSize (bp)Primer SequenceAnnealing temp. (°C)DHPLC temp. (°C)DHPLC start gradient
A3243G494F: CCTCCCTGTAGGAAAGGACA595855% Ba
R: GCCTAGGTTGAGGTTGACCA
D-loop F1505F: GCTGGAAGATCTTTAACTCCACCATTAGCACC655858% B
R: CTACGCGTCGACGCGAGGAGAGTAGCACTCTTG
D-loop F2515F: GCTGGAAGATCTAAATCAATATCCCGCACAAG655858% B
R: CTACGCGTCGACTTAAGTGCTGTGGCCAGAAG
D-loop F3494F: GCTGGAAGATCTCACCCTATTAACCACTCACG585758% B
R: CTACGCGTCGACTGAGATTAGTAGTATGGGAG
D-loop F4585F: GCTGGAAGATCTACAAAGAACCCTAACACCAGC655859% B
R: CTACGCGTCGACACTTGGGTTAATCGTGTGACC
16s-F2292F: ATATAGTACCGCAAGGGAAAGA535649% B
R: GGGTTCTGTGGGCAAAT
16s-G6268F: AATAGGGACCTGTATGAATGG536051% B
R: TAGTTCGCTTTGACTGGTG

The PCR products of mutant fragment (F2) amplified with 19-30 cycles were electrophoresed by 2% agarose gel. The agarose gel was exposed to Koda Image Station 440CF, and the resulting signal qualified by using the Koda 1d Image Analysis software. Values were normalized against pUC18 message. A variant sample which ratio of mutant type (G) to wild type (A) at 3243 allele site was about 60 percent and a normal blood sample were amplified respectively. Both PCR products were mixed according to ratio of mutant: wild type to be 50%, 40%, 30%, 20%, 10%, 5% and 0%.

DHPLC analysis

PCR products from gastric cancer cell lines were mixed with about 30 percent of PCR ingredients of normal blood in order to detect homozygous mutation in cell lines. Prior to DHPLC analysis, all fragments were heated to 95 °C for 3 min, followed by slow cooling to 45 °C over 50 min to form a mixture of hetero- and homoduplex. The melting temperature and optimal gradient for each fragment (Table 1) can be obtained with WAVEMAKER4.0 software with some empirical optimization. Aliqots of 3 μL PCR products were automatically loaded on the DNASep column and eluted on a linear acetonitrile gradient in a 0.1 mol·L-1 triethylamine acetate buffer (pH7.0) with a constant flow rate of 0.9 mL·min-1. Elution of DNA from the column was detected by absorbing at 260 nm.

DNA sequencing

PCR products were purified by 4% PAGE gel. Direct sequencing of the PCR products was performed by use of the fluorescent terminators on an ABI Prism 377 sequencer (PE Biosystems, USA). The sequence data were checked with MITOMAP Human mtDNA "Cambridge" Sequences (http://www.gen.emory.edu/MITOMAP/mitoseq.html).

RESULTS
Optimization of DHPLC for mtDNA mutation detection

The UV detection limit was analyzed for PCR products with variants. The concentration of PCR products of 16s gene containing a variance from gastric cancer cell line MKN45 was about 8, 20, 40, 85 and 110 ng·μL-1 after amplification with 19, 21, 24, 27, 30 cycles respectively. The UV detection limit was about 80 ng for the PCR products whose mutated ingredients were efficiently detected by DHPLC.

The minimal ratio of heteroduplex detected by DHPLC was studied. To investigate the sensitivity of DHPLC in detection of mtDNA variants, we used PCR products from the mutated MELAS sample to mix with normal blood amplimers based on ratio of mutant to wild type to be 50%, 40%, 30%, 20%, 10%, 5%, 1% and 0%. Our results showed that heteroduplexes were sensitively detected by DHPLC, when the ratio (mutant:wild) range from 5% to 50% in the mixture of PCR products (Figure 1). Moreover, the chromatography profiles of DHPLC were similar when mutant products in mixture were about 10%-40%. It suggested that homozygous mutation could be easily identified if 20%-30% wild PCR products were added.

Figure 1
Figure 1 The minimal ratio of hetero-: homoduplex in mixture were identi-fied by DHPLC. The composition of mutant type in PCR product mixture are 0% (A, wild type), 1% (B), 5% (C), 10% (D), 20% (E), 30% (F), 40% (G) and 50% (H) respectively. Chromatogram B has no difference to chromatogram A. Heteroduplex peak start to change in sample containing 5% variant (C). The heteroduplex can be obviously discerned in sample with 10% variant (D). Chromatogram E to H is almost similar. It indicates that about 5% mutant composition in PCR product mixture can be detected by DHPLC.

The effect of DNA polymerases on DHPLC was evaluated. A small peak was often observed preceding the main peak in most of fragments amplified by Taq DNA polymerases. In order to understand whether this was an universality gor DHPLC resolution induced by Taq polymerase, we chose 6 brands of Taq, 1 type of Taq Gold and 4 kinds proofreading DNA polymerases to amplify a randomly selected fragment (F6) for DHPLC analysis. Our findings displayed that all in this study gave a broadened peak proceeding the main peak, but Taq Gold and proofreading DNA polymerases (such as Pfu and Vent) had no or tiny peak before the main peak (Figure 2). To exclude the results that were induced by polymerase buffer, we further amplified the fragment using Taq polymerase to match with Taq Gold and proofreading polymerase buffer, or Taq Gold and proofreading polymerase with Taq polymerase buffer. The results indicated that the particular small peak was only related to Taq DNA polymerase itself.

Figure 2
Figure 2 The universality of a broad small peak proceeding the main peak induced by Taq DNA polymerase. An extra small peak is observed preceding the eluted chromatography profile of A and B but not in chromatogram of C, D and E. Chromatogram A is a representative of products amplified by Taq DNA polymerase. B is typical chromatography profile when Taq DNA polymerase matched with Pfu DNA polymerase buffer in PCR reaction. C and D respectively comes from amplimers amplified by Ampli-Taq Gold and Vent DNA polymerase. E is one of chromatograms coming from PCR amplification by using Pfu DNA polymerase.
Mutation screening of mtDNA

Patients with MELAS have been suggested to associate with mutation of A3243G in tRNALeu1[46,47]. 10 variant cases out of 12 MELAS patients were successfully identified by DHPLC. No alterations were detected in 72 cases with other mitochondrial encephalomyopathies and 30 controls at this allele site. These results were completely consistent with results obtained by restriction endonuclease Apa I.

Basing on above results, we further screened blindly the variants of non-coding D-loop region of mtDNA in gastric cancer using 4 pairs of overlapping primers. In the primary scanning, 28 heteroduplexes were identified in gastric tumor tissues and 38 variances were distinguished in cell lines. The typical chromatograms of heteroduplexes in each fragment were showed in Figure 3. To prove the results, all of positive samples were detected repeatedly. 26 heteroduplexes in tumor group were confirmed, 2 cases were checked to be negative. The two samples were distinguished to be positive due to change of retention time in contrast with other samples, but their chromatograms were similar with wild type. The detected variant frequency of mtDNA by DHPLC was listed in Table 2. Ten variant fragments were randomly chosen for direct DNA sequencing, and all of mutated fragments were confirmed.

Table 2 The detected frequency of variance of mtDNA by using DHPLC.
Fragments SamplesA3243G
D-loop
MELASOther EncephalaNormal bloodTumorCell line
Positive/total fragments10/120/720/3026/18438/52
Percent (%)83.30014.173.1
Figure 3
Figure 3 The representative DHPLC chromatograms of variant fragments detected blindly for patients with gastric cancinoma in D-loop of mtDNA. The chromatogram of tumor tissue is visibly different to that of its counter-part non-tumor tissue. The variant cases are listed on the top of each DHPLC chromatogram. DF1, DF2, DF3 and DF4 represent the tested fragments of D-loop respectively. T: tumor tissues; N: non-tumor tissues.
DISCUSSION

Mutation detection by DHPLC is performed at a temperature sufficient to partially denature the DNA heteroduplexes. The different retention times of hetero- and homoduplex on the DNASep matrix allow for high sensitivity and rapid detection[48,49]. In generally, the heteroduplex profile is easily distinguished from homoduplex peak.

Although the present data have showed that DHPLC is a convenient and sensitive method in mutation screening[17,22,24-26,28]. It may be a challenge to mutation detection of mtDNA because of complicated heteroplasmy in mitochondria[50,51] and various types of variances in mtDNA molecule. Due to hundreds to thousands mtDNA copies in a cell[52], the ratio of a special mutant to normal mtDNA is relatively low. However, a number of various variants may co-existence in a sample. For these reasons, sensitive and rapid detecting method is needed to distinguish different types of variances in large sets of mtDNA copies. We applied DHPLC to screen the mtDNA mutation in this study. Our data showed that DHPLC was a powerful screening strategy for mtDNA mutation. Firstly, about 80 ng of PCR products with variant that could be identified by DHPLC were enough to UV detection limit. The heteroduplex peak was not visible when total PCR products were less than 50 ng each injection. But the homoduplex peak could be satisfactorily detected. Next, about 5 percent of mutant products in PCR mixture were effectively discerned. These results indicated that DHPLC was sensitive to distinguish those minimal special variants from a large normal mtDNA. Finally, the results were reproducible.

In detection of A3243G mutation for MELAS patients, we proved our collaborators research. Ten variant samples identified by using restriction endonuclease Apa I were all distinguished by DHPLC. Heteroduplexes of tumor tissues obtained by DHPLC were also visibly different to that of non-tumor counterpart, when DHPLC was used to screen blindly the variances of D-loop of mtDNA in gastric cancer. These results also demonstrated that DHPLC, as same as research for nuclear DNA[25-27,29,34], was a sensitive method for mtDNA mutation screening.

As mutation detection of nucleus genes, several factors must be addressed when DHPLC is employed in mtDNA screening. These factors include primer design, PCR optimization, choice of optimal melting temperature or reverse-phase gradient[29,49,53] and DNA polymerase in this study. We find Taq polymerase may influence identification of mutation for DHPLC screening. Taq DNA polymerase tends to add a deoxyribonucleotide, preferentially dATP, to the 3’-hydroxyl terminus of a blunt-ended substrate, and the high-sensitivity of the WAVE system makes it capable of registering these A-tailed products to form an extra peak. In particular, the GC-rich small fragment with high Tm is easy to be influenced. Because the selected temperature of column oven is high, the retention time of heteroduplex will be reduced and the extra small peak is prone to form a false heteroduplex peak.

The concentration of dNTP in PCR reaction is factor of DHPLC resolution for heteroduplex detection. DNA molecules bind with the DNASep cartridge via the triethylammonium acetate (TEAA). The dNTP contends with DNA in interaction with TEAA and decrease DNASep cartridge’s binding sites to TEAA-DNA complex. Therefore, ability of cartridge to bind with DNA and resolution of DHPLC will be reduced. In order to obtain improved resolution of DHPLC, it is necessary to elute the cartridge by 75% acetonitrile regularly.

In conclusion, DHPLC is a powerful screening method for mtDNA mutation because of its high-throughput, automation, sensitivity and high reproducibility.

ACKNOWLEDGMENTS

We thank Dr. Z.X. Wan and J.J.Zhang for kindly providing of mtDNA from MELAS and other known mutated samples. We also thank Dr. W.G. Liu, Assistant professor, Mayo Clinic, Rochester USA, for comments on the manuscript. This work was supported by the National Key Basic Science Research Program, No. G1998051203, and National Science Foundation of China (NSFC), No. 39602526.

References
1.  Deng ZL, Ma Y. Aflatoxin sufferer and p53 gene mutation in hepatocellular carcinoma. World J Gastroenterol. 1998;4:28-29.  [PubMed]  [DOI]
2.  Luo D, Liu QF, Gove C, Naomov N, Su JJ, Williams R. Analysis of N-ras gene mutation and p53 gene expression in human hepatocellular carcinomas. World J Gastroenterol. 1998;4:97-99.  [PubMed]  [DOI]
3.  Peng XM, Peng WW, Yao JL. Codon 249 mutations of p53 gene in development of hepatocellular carcinoma. World J Gastroenterol. 1998;4:125-127.  [PubMed]  [DOI]
4.  Zhao X, Cai YY, Xie DW, Wang LD, Yang CS. Multiplex PCR SSCP: a highly effective and efficient method of mutation detection and analysis. World J Gastroenterol. 1998;4:106.  [PubMed]  [DOI]
5.  Peng XM, Yao CL, Chen XJ, Peng WW, Gao ZL. Codon 249 mutations of p53 gene in non-neoplastic liver tissues. World J Gastroenterol. 1999;5:324-326.  [PubMed]  [DOI]
6.  Weng ML, Li JG, Gao F, Zhang XY, Wang PS, Jiang XC. The mutation induced by space conditions in Escherichia coli. World J Gastroenterol. 1999;5:445-447.  [PubMed]  [DOI]
7.  Ji CY, Smith DR, Goh HS. The role and prognostic significance of p53 mutation in colorectal carcinomas. World J Gastroenterol. 2000;6:78.  [PubMed]  [DOI]
8.  Liu WD, Hada T, Cheng JD, Higashino K. Point mutations in E2, NS3 and NS5A of hepatitis G virus. World J Gastroenterol. 2000;6:41.  [PubMed]  [DOI]
9.  Qin Y, Li B, Tan YS, Sun ZL, Zuo FQ, Sun ZF. Polymorphism of p16INK4a gene and rare mutation of p15INK4b gene exon2 in primary hepatocarcinoma. World J Gastroenterol. 2000;6:411-414.  [PubMed]  [DOI]
10.  Wang Y, Liu H, Zhou Q, Li X. Analysis of point mutation in site 1896 of HBV precore and its detection in the tissues and serum of HCC patients. World J Gastroenterol. 2000;6:395-397.  [PubMed]  [DOI]
11.  Wang XJ, Yuan SL, Li CP, Iida N, Oda H, Aiso S, Ishikawa T. Infrequent p53 gene mutation and expression of the cardia adenocarcinomas from a high-incidence area of Southwest China. World J Gastroenterol. 2000;6:750-753.  [PubMed]  [DOI]
12.  Liu J, Chen SL, Zhang W, Su Q. P21-WAF1 gene expression with p53 mutation in esophageal carcinoma. Shijie Huaren Xiaohua Zazhi. 2000;8:1350-1353.  [PubMed]  [DOI]
13.  Cui J, Yang DH, Qin HR. Mutation and clinical significance of c-fms oncogene in hepatocellular carcinoma. Shijie Huaren Xiaohua Zazhi. 2001;9:392-395.  [PubMed]  [DOI]
14.  Fan RY, Li SR, Wu ZT, Wu X. Detection of P53 protein, K-ras and APC gene mutation in sporadic colorectal cancer tissue and exfoliative epi-thelial cells in stool. Shijie Huaren Xiaohua Zazhi. 2001;9:771-775.  [PubMed]  [DOI]
15.  He XS, Su Q, Chen ZC, He XT, Long ZF, Ling H, Zhang LR. Expression, deletion [was deleton] and mutation of p16 gene in human gastric cancer. World J Gastroenterol. 2001;7:515-521.  [PubMed]  [DOI]
16.  Yuan P, Sun MH, Zhang JS, Zhu XZ, Shi DR. APC and K-ras gene mutation in aberrant crypt foci of human colon. World J Gastroenterol. 2001;7:352-356.  [PubMed]  [DOI]
17.  Choy YS, Dabora SL, Hall F, Ramesh V, Niida Y, Franz D, Kasprzyk-Obara J, Reeve MP, Kwiatkowski DJ. Superiority of denaturing high performance liquid chromatography over single-stranded conformation and conformation-sensitive gel electrophoresis for mutation detection in TSC2. Ann Hum Genet. 1999;63:383-391.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 72]  [Cited by in RCA: 69]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
18.  Gross E, Arnold N, Goette J, Schwarz-Boeger U, Kiechle M. A comparison of BRCA1 mutation analysis by direct sequencing, SSCP and DHPLC. Hum Genet. 1999;105:72-78.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 88]  [Cited by in RCA: 95]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
19.  Boutin P, Vasseur F, Samson C, Wahl C, Froguel P. Routine mutation screening of HNF-1alpha and GCK genes in MODY diagnosis: how effective are the techniques of DHPLC and direct sequencing used in combination? Diabetologia. 2001;44:775-778.  [PubMed]  [DOI]
20.  Eng C, Brody LC, Wagner TM, Devilee P, Vijg J, Szabo C, Tavtigian SV, Nathanson KL, Ostrander E, Frank TS. Interpreting epidemiological research: blinded comparison of methods used to estimate the prevalence of inherited mutations in BRCA1. J Med Genet. 2001;38:824-833.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 117]  [Cited by in RCA: 104]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
21.  Klein B, Weirich G, Brauch H. DHPLC-based germline mutation screening in the analysis of the VHL tumor suppressor gene: usefulness and limitations. Hum Genet. 2001;108:376-384.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 32]  [Article Influence: 1.3]  [Reference Citation Analysis (1)]
22.  Kristensen VN, Kelefiotis D, Kristensen T, Børresen-Dale AL. High-throughput methods for detection of genetic variation. Biotechniques. 2001;30:318-322, 324, 326 passim.  [PubMed]  [DOI]
23.  Xiao W, Oefner PJ. Denaturing high-performance liquid chromatography: A review. Hum Mutat. 2001;17:439-474.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 544]  [Cited by in RCA: 466]  [Article Influence: 18.6]  [Reference Citation Analysis (0)]
24.  O'Donovan MC, Oefner PJ, Roberts SC, Austin J, Hoogendoorn B, Guy C, Speight G, Upadhyaya M, Sommer SS, McGuffin P. Blind analysis of denaturing high-performance liquid chromatography as a tool for mutation detection. Genomics. 1998;52:44-49.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 224]  [Cited by in RCA: 199]  [Article Influence: 7.1]  [Reference Citation Analysis (0)]
25.  Arnold N, Gross E, Schwarz-Boeger U, Pfisterer J, Jonat W, Kiechle M. A highly sensitive, fast, and economical technique for mutation analysis in hereditary breast and ovarian cancers. Hum Mutat. 1999;14:333-339.  [PubMed]  [DOI]  [Full Text]
26.  Hoogendoorn B, Norton N, Kirov G, Williams N, Hamshere ML, Spurlock G, Austin J, Stephens MK, Buckland PR, Owen MJ. Cheap, accurate and rapid allele frequency estimation of single nucleotide polymorphisms by primer extension and DHPLC in DNA pools. Hum Genet. 2000;107:488-493.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 121]  [Cited by in RCA: 122]  [Article Influence: 4.7]  [Reference Citation Analysis (0)]
27.  Spiegelman JI, Mindrinos MN, Oefner PJ. High-accuracy DNA sequence variation screening by DHPLC. Biotechniques. 2000;29:1084-1090, 1092.  [PubMed]  [DOI]
28.  Roberts PS, Jozwiak S, Kwiatkowski DJ, Dabora SL. Denaturing high-performance liquid chromatography (DHPLC) is a highly sensitive, semi-automated method for identifying mutations in the TSC1 gene. J Biochem Biophys Methods. 2001;47:33-37.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 19]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
29.  Taliani MR, Roberts SC, Dukek BA, Pruthi RK, Nichols WL, Heit JA. Sensitivity and specificity of denaturing high-pressure liquid chromatography for unknown protein C gene mutations. Genet Test. 2001;5:39-44.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 11]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
30.  Yokomizo A, Tindall DJ, Drabkin H, Gemmill R, Franklin W, Yang P, Sugio K, Smith DI, Liu W. PTEN/MMAC1 mutations identified in small cell, but not in non-small cell lung cancers. Oncogene. 1998;17:475-479.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 129]  [Cited by in RCA: 133]  [Article Influence: 4.8]  [Reference Citation Analysis (0)]
31.  Bénit P, Kara-Mostefa A, Berthelon M, Sengmany K, Munnich A, Bonnefont JP. Mutation analysis of the hamartin gene using denaturing high performance liquid chromatography. Hum Mutat. 2000;16:417-421.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (1)]
32.  Gross E, Arnold N, Pfeifer K, Bandick K, Kiechle M. Identification of specific BRCA1 and BRCA2 variants by DHPLC. Hum Mutat. 2000;16:345-353.  [PubMed]  [DOI]  [Full Text]
33.  Nickerson ML, Weirich G, Zbar B, Schmidt LS. Signature-based analysis of MET proto-oncogene mutations using DHPLC. Hum Mutat. 2000;16:68-76.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (1)]
34.  van Den Bosch BJ, de Coo RF, Scholte HR, Nijland JG, van Den Bogaard R, de Visser M, de Die-Smulders CE, Smeets HJ. Mutation analysis of the entire mitochondrial genome using denaturing high performance liquid chromatography. Nucleic Acids Res. 2000;28:E89.  [PubMed]  [DOI]
35.  Cohn D, Mutch D, Elbendary A, Rader J, Herzog T, Goodfellow P. No evidence for BCL10 mutation in endometrial cancers with microsatellite instability. Hum Mutat. 2001;17:117-121.  [PubMed]  [DOI]  [Full Text]
36.  Gross E, Kiechle M, Arnold N. Mutation analysis of p53 in ovarian tumors by DHPLC. J Biochem Biophys Methods. 2001;47:73-81.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 42]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
37.  Han SS, Cooper DN, Upadhyaya MN. Evaluation of denaturing high performance liquid chromatography (DHPLC) for the mutational analysis of the neurofibromatosis type 1 ( NF1) gene. Hum Genet. 2001;109:487-497.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 48]  [Cited by in RCA: 42]  [Article Influence: 1.7]  [Reference Citation Analysis (1)]
38.  Kleymenova E, Walker CL. Determination of loss of heterozygosity in frozen and paraffin embedded tumors by denaturating high-performance liquid chromatography (DHPLC). J Biochem Biophys Methods. 2001;47:83-90.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 18]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
39.  Le Gac G, Mura C, Férec C. Complete scanning of the hereditary hemochromatosis gene (HFE) by use of denaturing HPLC. Clin Chem. 2001;47:1633-1640.  [PubMed]  [DOI]
40.  Lin D, Goldstein JA, Mhatre AN, Lustig LR, Pfister M, Lalwani AK. Assessment of denaturing high-performance liquid chromatography (DHPLC) in screening for mutations in connexin 26 (GJB2). Hum Mutat. 2001;18:42-51.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 35]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
41.  Nicolao P, Carella M, Giometto B, Tavolato B, Cattin R, Giovannucci-Uzielli ML, Vacca M, Della Regione F, Piva S, Bortoluzzi S. DHPLC analysis of the MECP2 gene in Italian Rett patients. Hum Mutat. 2001;18:132-140.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 20]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
42.  zur Stadt U, Rischewski J, Schneppenheim R, Kabisch H. Denaturing HPLC for identification of clonal T-cell receptor gamma rearrangements in newly diagnosed acute lymphoblastic leukemia. Clin Chem. 2001;47:2003-2011.  [PubMed]  [DOI]
43.  Lam CW, Sin SY, Lau ET, Lam YY, Poon P, Tong SF. Prenatal diagnosis of glycogen storage disease type 1b using denaturing high performance liquid chromatography. Prenat Diagn. 2000;20:765-768.  [PubMed]  [DOI]  [Full Text]
44.  Bénit P, Bonnefont JP, Kara Mostefa A, Francannet C, Munnich A, Ray PF. Denaturing high-performance liquid chromatography (DHPLC)-based prenatal diagnosis for tuberous sclerosis. Prenat Diagn. 2001;21:279-283.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 14]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
45.  Levin BC, Cheng H, Reeder DJ. A human mitochondrial DNA standard reference material for quality control in forensic identification, medical diagnosis, and mutation detection. Genomics. 1999;55:135-146.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 73]  [Cited by in RCA: 65]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
46.  Dubeau F, De Stefano N, Zifkin BG, Arnold DL, Shoubridge EA. Oxidative phosphorylation defect in the brains of carriers of the tRNAleu(UUR) A3243G mutation in a MELAS pedigree. Ann Neurol. 2000;47:179-185.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
47.  Sternberg D, Chatzoglou E, Laforêt P, Fayet G, Jardel C, Blondy P, Fardeau M, Amselem S, Eymard B, Lombès A. Mitochondrial DNA transfer RNA gene sequence variations in patients with mitochondrial disorders. Brain. 2001;124:984-994.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 70]  [Cited by in RCA: 63]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
48.  Kuklin A, Davis AP, Haefele R, Alianell G, Gjerde D, Taylor P. New paradigms in NDA polymorphism detection. Biomed Prod. 1998;7:90-92.  [PubMed]  [DOI]
49.  Kuklin A, Munson K, Gjerde D, Haefele R, Taylor P. Detection of single-nucleotide polymorphisms with the WAVE DNA fragment analysis system. Genet Test 1997-. 1998;1:201-206.  [PubMed]  [DOI]
50.  Battersby BJ, Shoubridge EA. Selection of a mtDNA sequence variant in hepatocytes of heteroplasmic mice is not due to differences in respiratory chain function or efficiency of replication. Hum Mol Genet. 2001;10:2469-2479.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 75]  [Cited by in RCA: 75]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
51.  Srivastava S, Moraes CT. Manipulating mitochondrial DNA heteroplasmy by a mitochondrially targeted restriction endonuclease. Hum Mol Genet. 2001;10:3093-3099.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 140]  [Cited by in RCA: 144]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
52.  Chinnery PF, Turnbull DM. Mitochondrial DNA and disease. Lancet. 1999;354 Suppl 1:SI17-SI21.  [PubMed]  [DOI]
53.  Narayanaswami G, Taylor PD. Improved efficiency of mutation detection by denaturing high-performance liquid chromatography using modified primers and hybridization procedure. Genet Test. 2001;5:9-16.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 18]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
Footnotes

Edited by Pagliarini R

Write to the Help Desk