Hu YP, Yao YC, Li JX, Wang XM, Li H, Wang ZH, Lei ZH. The cloning of 3'-truncated preS/S gene from HBV genomic DNA and its expression in transgenic mice. World J Gastroenterol 2000; 6(5): 734-737 [PMID: 11819684 DOI: 10.3748/wjg.v6.i5.734]
Corresponding Author of This Article
Yi Ping Hu, Department of Cell Biology, Department of Basic Medicine, Second Military Medical University, Shanghai 200433, China. yphu@smmu.edu.cn
Article-Type of This Article
brief-report
Open-Access Policy of This Article
This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA
Share the Article
Hu YP, Yao YC, Li JX, Wang XM, Li H, Wang ZH, Lei ZH. The cloning of 3'-truncated preS/S gene from HBV genomic DNA and its expression in transgenic mice. World J Gastroenterol 2000; 6(5): 734-737 [PMID: 11819684 DOI: 10.3748/wjg.v6.i5.734]
Yi Ping Hu, Yu Cheng Yao, Jian Xiu Li, Xin Min Wang, Zhong Hua Wang, Department of Cell Biology, Second Military Medical University, Shanghai 200433, China
Hong Li, Department of Biology, Department of Basic Medicine, West-China University of Medical Sciences, Chengdu 610041, China
Zhang Heng Lei, Department of Biology, North Sichuan Medical College, Nanchong 637007, China
Yi Ping Hu, graduated from Fudan University as a Ph.D. in 1992, engaged in the researches of medical transgenic animals.
ORCID number: $[AuthorORCIDs]
Author contributions: All authors contributed equally to the work.
Supported by Projects of the Science Development Foundation of Shanghai (994919033) and Tackling Key Problems in Science and Technology from the State Science and Technology Ministry (TJ99-LA01)
Correspondence to: Yi Ping Hu, Department of Cell Biology, Department of Basic Medicine, Second Military Medical University, Shanghai 200433, China. yphu@smmu.edu.cn
Telephone: 0086-21-25070240
Received: February 28, 2000 Revised: May 20, 2000 Accepted: June 2, 2000 Published online: October 15, 2000
Citation: Hu YP, Yao YC, Li JX, Wang XM, Li H, Wang ZH, Lei ZH. The cloning of 3'-truncated preS/S gene from HBV genomic DNA and its expression in transgenic mice. World J Gastroenterol 2000; 6(5): 734-737
Hepatitis B virus (HBV) is regarded as one of the main etiologic factors involved in the development of human hepatocellular carcinoma (HCC)[1-20]. The open reading frame (orf) of X gene of HBV encoded a transactivating factor is the evidence that strongly supported the notion that the X gene of HBV DNA integrated in HCC genomic DNA could contribute to the carcinogenesis of liver cells by activation of some related cellular genes in trans[8,9]. But it was found that the functional orf of X gene was absent in some HCCs harbouring HBV genomic DNA[6-14]. However, the 3'-truncated preS/S sequence of HBV DNA, which also encodes a transcriptional transactivation factor, was found in all analyzed HCCs harbouring HBV genomic DNA[20-27]. These findings indicate that transactivation of some cellular genes by the expression product of 3'-truncated preS/S sequence of HBV integrated in the genomic DNA of liver cells is a possible mecha nism for HBV-associated oncogenesis[11]. The transcriptional transactivity also can be produced in the cultured cells transfected with an artificial 3'-truncated preS/S gene of HBV genomic DNA[1]. To explore the in vivo function of 3'-truncated preS/S region of HBV, we cloned the 3'-truncated preS/S region from wild-type HBV genomic DNA and constructed its expression vector for using in transgenic mice. Then, by using pronuclear microinjection method, we obtained two transgenic mouse lines expressing 3'-truncated preS/S region from 15 new born mice. These transgenic mouse lines are helpful to identify the function of the expression product of 3'-truncated preS/S in vivo and the relationship between 3'-truncated preS/S and HBV-associated oncogenesis.
MATERIALS AND METHODS
Materials
Plasmids Vectors pBR322HBV carrying wild-type HBV genomic DNA and pBluscript were preserved in our laboratory. Expression vector pcDNA3.1, containing MCV promoter was provided by Dr. Yu Hong-Yu.
CellsE. coli DH5α was preserved in our laboratory.
Animals C57BL/6 and BALB/ c mice were preserved by our transgenic animal laboratory (SPF level). All mice were maintained on a 14:10 light-dark schedule (lights off at 10 pm, on at 8 am.).
Main reagents Restriction endonucleases, T4 DNA ligase and DNA large fragment (klenow) ploymerase were purchased from Promega company. QIA quick gene gel kit and plasmid extraction kit were from QIA gene. Anti-HBV preS1 kit was purchased from α- company.
PCR primers design and synthesis Primers were synthesized by Sangon. Positive primer: 5’GGCCAGAGGCAAATCAGGTAGGAGG3’, Negative primer: 5’TGGGTGAGGCAGTAGTCGGAACAGG3’. The primers are from 1607 to 1934 bp of HBVadr genomic DNA sequence, containing 327 bp. We also used the T7 primer, upstream the positive primer.
Methods
Plasmid construction A 2.0 kb fragment, containing 3'-truncat ed preS/S of HBV genome, was cut out of pBR322HBV digested with Xba-I and was subcloned into pBluescript, which was named pBluescript-Xba 2.0. The 3'-truncated preS/S region was obtained from pBluescript-Xba 2.0 digested with BstE II and xba I. Its 3’-end was filled with klenow fragment and dNTPs, and inserted into BamH I site of expression vector pcDNA3.1 which also filled, named pcDNA3.1 PreS/S. Restriction endonucleases digesting and sequencing were used to identify the construction.
Transgenic mice The pcDNA3.1-PreS/S DNA was purified and dissolved in TE buffer (10 mM Tris-HCl, 0.2 mM EDTA, pH7.5) at a final concentration of 1 mg/L (-2000 copies/pl). After pronuclear microinjection, the eggs were implanted into oviducts of pseudopregnant recipients to enable further development before term.
DNA isolation To isolate tail fragments from 10-day-old mice, approximately one third of the tail was cut and place into a screw-capped 1.5 mL microcentrifuge tube containing 500 μL of TB buffer. The tubes containing the tail fragments were incubated overnight at 55 °C. They were extracted once with 500 μL of 1:1 (v/v) equilibrated phenl-chloroform, and precipitated with 2 volumes of ethanol. After centrifugation, precipitates were resupended in 500 μL water.
DNA analysis The PCR amplification conditions were used with Taq DNA ploymerase. For a 50 μL reaction, mix the following components: 1 μg template DNA, 0.5 μL dNTP 10 mm, 10u-Taq, 5 μL PCR Buffer (10 ×), 41.5 μL deionized water. We use the following cycling parameters: initial denaturation at 94 °C for 5 min; followed by 35 cycles at 94 °C for 30 s; 58 °C for 30 s; and 72 °C for 1 min; and then final extension at 72 °C for 7 min. The products were run on a 2% agarose gel.
Expression analysis The 100 μL of blood was extracted from the mouse developed from a microinjected eggs. After centrifuged in microfuge for 5 min, the supernatants were isolated and analyzed by ELISA.
RESULTS
Clone of 3'-truncated preS/S and construction of its expression vector
The approximate 2.0 kb fragment containing the preS/S was cloned from HBV genomic DNA, from which 3'-truncated preS/S region was cut out and subcloned into the expression vector pcDNA3.1, and then was identified by the restrictive enzyme and sequence analysis. The results showed that the structure was identical with our design (Figure 1 and Figure 2).
Figure 1 a: The HBV genomic sequence, cloned in pBR322.
Positions of restriction site (B, BamH I; Bs, BstE II; X, Xba I; Xh, Xho I) b: 0.65 kb fragment, containing the 3'-truncated preS/S. c: Construction of the vector (pcDNA3.1-preS/S) for expressing 3'-truncated preS/S.
Figure 2 The pcDNA3.
1 digested with Nhe I, Pme I, Xba I and Xho I. 1: Nhe + Xba I; 2: Xho I + Nhe I; 3: Pme I + Xba I; M: λ/EcoR I+ Hind-III marker
Production of transgenic mice
The recombinant construct containing CMV promoter sequences fused to 3'-truncated preS/S region, which encodes a transcriptional transactivation factor, was microinjected into fertilizted eggs from C57BL/6 mice. Of 243 microinjected eggs implanted into oviducts of 20 pseudopregnant recipient mice 15 developed to term and gave rise pups. However, only 7 of them survived and the others died within several hours after birth. DNA from the 7 mice were isolated and analyzed by PCR. It was found that 2 of them were positive for the injected trans gene (Figure 3). Besides, we also noticed that the embryos from the microinjected eggs had a high miscarriage and mortality rate during the course of their development and growth in comparison with the experience in our laboratory.
Figure 3 The DNA analysis of founder mice by PCR.
324 bp fragment was amplified with positive and negative primers. 1: blank control; 2: PCR for genomic DNA of normal mice; 3: PCR for genomic DNA of transgenic mice (No.1); 4: PCR for genomic DNA of transgenic mice (No.3); M: λ/Eco RI + Hind III marker
Expression of 3'-truncated preS/S gene in Transgenic mice
The serum samples were collected from the 2 mice harbouring the 3'-truncated preS/S region under the control of CMV promoter and the expression product of the recombinant gene in transgenic mice was analyzed by ELISA, in which the antibody against HBV preS1 was used as the first antibody. The results showed that 2 of them were positive for PreS1 (Table 1). Following the founders conformed, a series of expression analysis was carried out at different time points during the development. It was found that the 3'-truncated preS/S region could been stably expressed in the transgenic mice.
Table 1 The ELISA results of the surme of transgenic mice expressing the 3'-truncated preS/S at different times.
The full-length preS/S sequence integrated in nearly all HCCs can’t show any trans-activity. However, one copy of the preS/S sequence with 3'-truncation could show a definite trans-activity[1]. We constructed the expression vector of 3'-truncated preS/S gene, which can be expressed in cultured mammalian cells. So this vector should be very useful for exploring the biological function of expression product of 3'-truncated preS/S gene and for identifying whether 3'-truncated preS/S gene in HCCs is a causative factor of HBV-associated oncogenesis.
During the process of generating transgenic mice, the miscarriage rate and mortality rate seemed to be much higher than that in the producing transgenic mice harbouring other genes[28-30]. This phenomenon indicates that beside the some common reasons for the death of transgenic mice there might be some other factors. It is possible that there are some effects of the trans-activation of the expression product of the 3'-truncated preS/S like those of the 3'-truncated preS/S intergrated in HCCs of human being on the development of mouse embroys and its early growing of the pups after birth.
The 2 transgenic mouse founders could express 3'-truncated preS/S sequences stably. These results indicate that the 3'-truncated preS/S is integrated in their genomic DNA, which is similar to those existing in the HCCs of human being. So we believe that the 2 transgenic mouse lines can be employed as the model for exploring the in vivo function of the expression product of 3'-truncated preS/S and relationship between 3'-truncated preS/S and HBV-associated oncogenesis.
Wang WL, Gu GY, Hu M. Expression and significance of HBV genes and their antigens in human primary intrahepatic cholangiocarcinoma.World J Gastroenterol. 1998;4:392-396.
[PubMed] [DOI]
Zhong S, Wen SM, Zhang DF, Wang QL, Wang SQ, Ren H. Sequencing of PCR amplified HBV DNA pre-c and c regions in the 2.2.15 cells and antiviral action by targeted antisense oligonucleotide directed against sequence.World J Gastroentero. 1998;4:434-436.
[PubMed] [DOI]
Tang RX, Gao FG, Zeng LY, Wang YW, Wang YL. Detection of HBV DNA and its existence status in liver tissues and peripheral blood lymphocytes from chronic hepatitis B patients.World J Gastroenterol. 1999;5:359-361.
[PubMed] [DOI]
Imai M, Hoshi Y, Okamoto H, Matsui T, Tsurimoto T, Matsubara K, Miyakawa Y, Mayumi M. Free and integrated forms of hepatitis B virus DNA in human hepatocellular carcinoma cells (PLC/342) propagated in nude mice.J Virol. 1987;61:3555-3560.
[PubMed] [DOI]
Shaul Y, Garcia PD, Schonberg S, Rutter WJ. Integration of hepatitis B virus DNA in chromosome-specific satellite sequences.J Virol. 1986;59:731-734.
[PubMed] [DOI]
Koike K, Kobayashi M, Mizusawa H, Yoshida E, Yaginuma K, Taira M. Rearrangement of the surface antigen gene of hepatitis B virus integrated in the human hepatoma cell lines.Nucleic Acids Res. 1983;11:5391-5402.
[PubMed] [DOI]
Lei ZH, Li JX, Yu HY, Wang XM, Sun W, Pan XH, Hao GR, Wang XP, Fu JL, Hu YP. Generation of transgenic mice harbouring hepatitis B (ayw subtype).Dier Junyi Daxue Xuebao. 1997;18:201-204.
[PubMed] [DOI]
Haslinger A, Karin M. Upstream promoter element of the human metallothionein-IIA gene can act like an enhancer element.Proc Natl Acad Sci USA. 1985;82:8572-8576.
[PubMed] [DOI]
Standring DN, Rutter WJ, Varmus HE, Ganem D. Transcription of the hepatitis B surface antigen gene in cultured murine cells initiates within the presurface region.J Virol. 1984;50:563-571.
[PubMed] [DOI]