BPG is committed to discovery and dissemination of knowledge
Brief Reports Open Access
©The Author(s) 2000. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Aug 15, 2000; 6(4): 605-607
Published online Aug 15, 2000. doi: 10.3748/wjg.v6.i4.605
Helicobacter pylorivacA genotypes and cagA status and their relationship to associated diseases
Peng Hou, Zhen-Xing Tu, Guo-Ming Xu, Yan-Fang Gong, Xu-Hui Ji, Zhao-Shen Li, Department of Gastroenterology, Changhai Hospital, Shanghai 200433, China
Peng Hou, male, graduated from Fourth Mi litary Medical University in 1986, now graduate student for doctor degree in Second Military Medical University, having 12 papers published
Author contributions: All authors contributed equally to the work.
Correspondence to: Professor Zhen-Xing Tu, Department of Gastro enterology, Changhai Hospital, Shanghai 200433, China. Xiaohua@smmu.edu.cn
Telephone: +86-21-25070556 Fax: +86-21-35030384
Received: March 20, 2000
Revised: June 20, 2000
Accepted: June 27, 2000
Published online: August 15, 2000

Abstract
Key Words: Helicobacter pylori; gastritis; peptic ulcer; stomach neoplasms; genotype; p olymerase chain reaction



INTRODUCTION

Helicobacter pylori (H.pylori) is a major causative bacterium of chronic gas tri tis, peptic ulcer and mucosa-associated lymphoid tissue lymphoma in humans, and associated with an increased risk of gastric cancer[1-8]. An important virulant factor of H.pylori is the vacuolating cytotoxin (VacA) encoded by vacA that induces cytoplasmic vacuolation in target cells both in vitro and in vivo[9-11]. VacA is produced as a 140 kDa precursor which contains an N-terminal signal peptide and an approximately 33 kDa C-terminal outer membrance exporter. The precursor is cleaved at both N-terminal and C-te rminal and secreted into the extracellular milieu as a 95 kDa mature protein. The mature protein futher undergoes specific cleavage to yield 37 kDa and 58 kDa subunits[12-14]. Although vacA is present in all H.pylori strains, only about 50% to 60% of strains can induce vacuolation of epithelial cells as assessed by the HeLa cell assay. vacA shows considerable genetic variation in H.pylori isolated from all over the world and contains at least two variable regions. The s region exists as s1 or s2 allelic types. Among type s1 strains, subtypes s1a and s1b have been identified. Them region occurs as m1 or m2 allelic types. Specific vacA genotype of H. pylori strains are associated with the production of the cytotoxin in vitro, epithelial damage in vivo, and clinical consequences[15-27]. The other virulant factor is the cytotoxin-associated protein (CagA) encoded by the cytotoxin-associated gene (cagA). The cagA gene is present in about 60% to 70% of strains and all of these strains express the cagA. The presence of cagA is also associated with the production of the cytotoxin in vitro, and clinical outcome[24-30]. The aim of this study was (i) to identify vacA genotypes and cagA status of H.pylori isolated from Chinese patients; (ii) to evaluation t he relatioship beween vacA genotypes, cagA status and related gastroentero logical disorders.

MATERIALS AND METHODS
Patients

Seventy-four clinical isolates of H.pylori were obtained from patients which underwent gastroduodenoscopy in Changhai Hospital, Shanghai, China. H.pylori strain CCUG17874 and G50 obtained from IRIS, Italy were also used in this study. No patient had received nonsteroidal anti-inflammatory drugs or antacids. Of these, 31 patients (mean age 47 years) had peptic ulcer including 21 duodenal ulcers, 5 gastric ulcers and 5 complete ulcers; 39 patients (mean age 41 years) had gastritis including 18 supper gastritis, 6 atrophic gastritis and 15 erosive gastritis; and 4 patients (mean age 56 years) had gastric adenocarci noma.

Isolation and culture of H.pylori

Two gastric biopsies were obtained res pectively from gastric antrum and corpus of each patient by using endoscopy. Each specimen was placed in a transport medium and sent to the laboratory within 3 h. The specimens were then incubated onto Campylobacter selective agar (MERCK) c ontaining 10% sheep blood for 3 d at 37 °C under microaerobic conditions (10% CO2, 5% O2, 85% N2). All H.pylori strains were positive for urease, oxid ase, catalase and were identified by Gram and Giems staining under light microscopy. Colonies directly harvested from the plates were used for RNA extraction.

Preparation of total RNA and RT-PCR amplification

The extraction of tot al RNA was performed using Promega’s SV total RNA isolation system according to manufacturer’s instructions. The DNA sequences of the primer oligonucleotides u sed for RT-PCR and the size of the corresponding PCR products are listed in Table 1. RT-PCR reactions were performed as follows: denaturation at 95 °C for 2 min, followed by 30 cycles consisting of 95 °C for 40 s, 55 °C for 1 min, and 67 °C for 2 min, and final extension at 67 °C for 7 min. The RT-PCR products were elect rophoretically separated on a 1.5% agarose gel and stained with ethidium bromide.

Table 1 Oligonucleotide primers used in this work.
Region amplifiedPrimer sequenceSize of PCR product
cagA5’ATAATGCTAAATTAGACAACTTGAGCG 3’297 bp
5’TTAGAATAATCAACAAACATCACGCCA 3
vacA
s1a5’ATGGAAATACAACAAACACAC 3’190 bp
5’GTCAGCATCACACCGCAAC 3
s1b5’ATGGAAATACAACAAACACAC 3’187 bp
5’AGCGCCATACCGCAAGAG 3’
s25’ATGGAAATACAACAAACACAC 3’286 bp
5’CTGCTTGAATGCGCCAAAC 3’
m15’GGTCAAAATGCGGTCATGG 3’290 bp
5’CCATTGGTACCTGTAGAAAC 3’
m25’GGAGCCCCAGGAAACATTG 3’352 bp
5’CATAACTAGCGCCTTGCAC 3’
Statistical methods

Analysis of data was performed using the χ2 test. Probability levels (P) of < 0.05 were considered statistically significant.

RESULTS
vacA genotypes of H.pylori strains

Typing of the vacA gene of 74 clinical isolates and strain CCUG17874 and G50 was performed based on signal and middle sequences by RT-PCR as described in mate rials and methods. All of the 74 clinical isolates and strain CCUG17874 were s1a type whose fragment was 259 bp products as predicted by RT-PCR-amplification. Strain G50 was s1b type whose fragment was 286 bp products predicted by RT-P CR-amplification. No clinical isolates was of type s1b. Neither strain CCUG17874 and G50 nor clinical isolates was of type s2. Seven isolates (9.5%) and strai n C CUG17874 were of m1 type whose fragment was 290 bp products. Sixty-seven isolates (90.5%) and strain G50 were of m2 type whose fragment was 352 bp products. Overall, 7 strains (9.5%) were type s1a/m1, 67 isolates (90.5%) were type s1a/m2. An s1a/m2 type strain was predominantly found in clinical isolates from Chinese patients living in Shanghai.

cagA positivity of H.pylori strains

The cagA gene was determined in 74 isolates by RT-PCR. Sixty-nine Chinese H.pylori strains (93.2%) were cagA positive. When the vacA genotype wa s compared with cagA status, all (100%) of 7 s1a/m1 type strains and 62 (92. 5%) of 67 s1a/m2 typr strains were cagA positive.

Relationship between vacA genotype, cagA status and related gastroenterological disorders

Infection with type s1a/m1 strain was found in 4 (12.9%) of 31 patients with peptic ulcers compared with 3 (7.7%) of 39 patients with gastritis. Infection with s1a/m2 strain was found in 27 (87.1%) of 31 patients with peptic ulcer compared with 36 (92.3%) of 39 patients with gastritis. There was no statistical signifi cance between vacA genotype and the clinical outcome. (P > 0.05). cagA positivity was found in 29 (93.5%) of 31 patients with peptic ulcer compared with 37 (94.9%) of 39 patients with gastritis. There was also no relationship between cagA status and related gastroenterological diseases (P > 0.05).

DISCUSSION

Based upon the methodology for typing vacA gene developed by Atherton et al[19], we analysed and typed vacA genotype of clinical isolates fr om Chinese patients living in Shanghai by using RT-PCR. The product amplified by RT-PCR was obtained in all clinical isolates, CCUG17874 and G50 strains. The results suggested that vacA transcription occurred in each of H.pyroli s t rains tested and was in agreement with previous reports[19]. According to typing of vacA alleles, these Chinese patients infected prevalently with H.pylori contained the type s1a/m2 of vacA alleles. The finding reported here was different from that in United States, Germany, and Japan[15-26]. The reason why the s1a/m2 strains have accumulated in Shanghai, China is unclear. It is known that genomic rearrangement may be associated with the uptake of D NA by natural transformation. Chinese have the same habits and customs, and little intermarriages with other nations. The high incidence of the s1a/m2 allele in Chinese population may indicate that it was first acquired in this population and the chance for genomic diversity may be little. Alternatively, the s1a/m2 allele may have a selective advantage in the Chinese population due to human polymor phism and ethnic background.

Recently, van Doorn et al[32] found a novel subtype of vacA signal region fr om s1a subtype, designated as s1c. Type s1c allele was obtained exclusively in isolates from East Asia. We have done vacA gene sequencing from 5 clinical isolates (in press). The s region was considered as type s1a. Compared with s1c sequence, two of the five strains were of type s1c. These results ind icated that s1c subtype could be identified as subtype s1a. Whether s1c strains are phenotypically different from s1a strains remains to be determined.

The findings here showed that all strains but five possessed the cagA gene and suggested that cagA positive strains were predominantly found in Shanghai also. The relationship between type s1a vacA allele and cagA positive has been described[31]. All (100%) of Chinese (Shanghai) H.pylori strains were of type s1a vacA allele and 93.2% of strains were cagA positive and were highly prevalent in China.

Subtype analysis of vacA alleles and cagA positivity demonstrated that the vacA subtype and cagA status was not independently associated with the clinical outcome of H.pylori infection. The factors affecting the clinical consequences need further studies.

References
1.  Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, Isaacson PG. Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet. 1991;338:1175-1176.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1402]  [Cited by in RCA: 1180]  [Article Influence: 33.7]  [Reference Citation Analysis (4)]
2.  Cover TL, Blaser MJ. Helicobacter pylori and gastroduodenal disease. Annu Rev Med. 1992;43:135-145.  [PubMed]  [DOI]
3.  Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA, Jellum E, Orentreich N, Vogelman JH, Friedman GD. Helicobacter pylori infection and gastric lymphoma. N Engl J Med. 1994;330:1267-1271.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1376]  [Cited by in RCA: 1197]  [Article Influence: 37.4]  [Reference Citation Analysis (0)]
4.  Hu PJ, Mitchell HM, Li YY, Zhou MH, Hazell SL. Association of Helicobacter pylori with gastric cancer and observations on the detection of this bacterium in gastric cancer cases. Am J Gastroenterol. 1994;89:1806-1810.  [PubMed]  [DOI]
5.  Asaka M, Kimura T, Kato M, Kudo M, Miki K, Ogoshi K, Kato T, Tatsuta M, Graham DY. Possible role of Helicobacter pylori infection in early gastric cancer development. Cancer. 1994;73:2691-2694.  [PubMed]  [DOI]  [Full Text]
6.  Shan ZW, Shen H, Zhang MJ, Xu JG. Relationship between differentiat ion syndromes in stomach disease and Helicobacter pylori. China Natl J New Gastroenterol. 1996;2:73-75.  [PubMed]  [DOI]
7.  Harry XH. Association between Helicobacter pylori and gastric cancer: current knowledge and future research. World J Gastroenterol. 1998;4:93-96.  [PubMed]  [DOI]
8.  Vandenplas Y. Helicobacter pylori infection. World J Gastroenterol. 2000;6:20-31.  [PubMed]  [DOI]
9.  Cover TL, Blaser MJ. Purification and characterization of the vacuolating toxin from Helicobacter pylori. J Biol Chem. 1992;267:10570-10575.  [PubMed]  [DOI]
10.  de Bernard M, Arico B, Papini E, Rizzuto R, Grandi G, Rappuoli R, Montecucco C. Helicobacter pylori toxin VacA induces vacuole formation by acting in the cell cytosol. Mol Microbiol. 1997;26:665-674.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 104]  [Cited by in RCA: 92]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
11.  Papini E, de Bernard M, Milia E, Bugnoli M, Zerial M, Rappuoli R, Montecucco C. Cellular vacuoles induced by Helicobacter pylori originate from late endosomal compartments. Proc Natl Acad Sci USA. 1994;91:9720-9724.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 189]  [Cited by in RCA: 167]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
12.  Pagliaccia C, de Bernard M, Lupetti P, Ji X, Burroni D, Cover TL, Papini E, Rappuoli R, Telford JL, Reyrat JM. The m2 form of the Helicobacter pylori cytotoxin has cell type-specific vacuolating activity. Proc Natl Acad Sci USA. 1998;95:10212-10217.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 153]  [Cited by in RCA: 141]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
13.  Lupetti P, Heuser JE, Manetti R, Massari P, Lanzavecchia S, Bellon PL, Dallai R, Rappuoli R, Telford JL. Oligomeric and subunit structure of the Helicobacter pylori vacuolating cytotoxin. J Cell Biol. 1996;133:801-807.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 155]  [Cited by in RCA: 131]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
14.  Cover TL, Tummuru MK, Cao P, Thompson SA, Blaser MJ. Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains. J Biol Chem. 1994;269:10566-10573.  [PubMed]  [DOI]
15.  Telford JL, Ghiara P, Dell'Orco M, Comanducci M, Burroni D, Bugnoli M, Tecce MF, Censini S, Covacci A, Xiang Z. Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease. J Exp Med. 1994;179:1653-1658.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 469]  [Cited by in RCA: 425]  [Article Influence: 13.3]  [Reference Citation Analysis (0)]
16.  Strobel S, Bereswill S, Balig P, Allgaier P, Sonntag HG, Kist M. Identification and analysis of a new vacA genotype variant of Helicobacter pylori in different patient groups in Germany. J Clin Microbiol. 1998;36:1285-1289.  [PubMed]  [DOI]
17.  Telford JL, Ghiara P, Dell'Orco M, Comanducci M, Burroni D, Bugnoli M, Tecce MF, Censini S, Covacci A, Xiang Z. Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease. J Exp Med. 1994;179:1653-1658.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 469]  [Cited by in RCA: 425]  [Article Influence: 13.3]  [Reference Citation Analysis (0)]
18.  Yang JC, Kuo CH, Wang HJ, Wang TC, Chang CS, Wang WC. Vacuolating toxin gene polymorphism among Helicobacter pylori clinical isolates and its association with m1, m2, or chimeric vacA middle types. Scand J Gastroenterol. 1998;33:1152-1157.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 6]  [Article Influence: 0.2]  [Reference Citation Analysis (0)]
19.  Atherton JC, Cao P, Peek RM, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270:17771-17777.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1186]  [Cited by in RCA: 1082]  [Article Influence: 34.9]  [Reference Citation Analysis (0)]
20.  Atherton JC, Peek RM, Tham KT, Cover TL, Blaser MJ. Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology. 1997;112:92-99.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 466]  [Cited by in RCA: 398]  [Article Influence: 13.7]  [Reference Citation Analysis (0)]
21.  Yu CQ, Zou QM, Jie QH, Guo XQ, Luo P. The relationship between the infe ction of Helicobacter pylori secreting VacA and digestive diseases. Shijie Huaren Xiaohua Zazhi. 1999;7:439.  [PubMed]  [DOI]
22.  Hou P, Xu GM, Gong YF, Tu ZX, Li ZS, Ji XH. The genotype of vacA gene of Helicobacter pylori(HP) and its correlation with the gastroduodenal dise ases associated with HP. Zhonghua Neike Zazhi. 1999;38:744-746.  [PubMed]  [DOI]
23.  Evans DG, Queiroz DM, Mendes EN, Evans DJ. Helicobacter pylori cagA status and s and m alleles of vacA in isolates from individuals with a variety of H. pylori-associated gastric diseases. J Clin Microbiol. 1998;36:3435-3437.  [PubMed]  [DOI]
24.  Weel JF, van der Hulst RW, Gerrits Y, Roorda P, Feller M, Dankert J, Tytgat GN, van der Ende A. The interrelationship between cytotoxin-associated gene A, vacuolating cytotoxin, and Helicobacter pylori-related diseases. J Infect Dis. 1996;173:1171-1175.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 182]  [Cited by in RCA: 155]  [Article Influence: 5.2]  [Reference Citation Analysis (1)]
25.  Yamaoka Y, Kodama T, Kita M, Imanishi J, Kashima K, Graham DY. Relationship of vacA genotypes of Helicobacter pylori to cagA status, cytotoxin production, and clinical outcome. Helicobacter. 1998;3:241-253.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 133]  [Cited by in RCA: 129]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
26.  Rudi J, Kolb C, Maiwald M, Kuck D, Sieg A, Galle PR, Stremmel W. Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases. J Clin Microbiol. 1998;36:944-948.  [PubMed]  [DOI]
27.  Zhang LX, Zhang L, Zhang NX, Liu YG, Yan XJ, Han FC, Hou Y. Comparative study on the relationship betweeen CagA protein of Helicobacter pylori and gastroduodenal ulcer. Shijie Huaren Xiaohua Zazhi. 1999;7:700-701.  [PubMed]  [DOI]
28.  Du YQ, Xu GM, Ji XH, Di H, Sun ZX. CagA gene distribution in Helicobacter pylori infected native peple. J Med Coll PLA. 1998;13:301-305.  [PubMed]  [DOI]
29.  Ren JP, Wang Y, Xie XJ, Di X, Qian DM, Men ZR, Li M. The relation betw een Helicobacter pylori with anti CagA andibody and gastroduodanal diseases. Shijie Huaren Xiaohua Zazhi. 1999;7:1 1 9.  [PubMed]  [DOI]
30.  Hou P, Xu GM, Li ZS, Tu ZX, Guo YF, Ji XH. The relation between cagA mRNA of Helicobacter pylori (HP), serum anti HP IgG and Hp associated ga stric diseases. Jiefangjun Yixue Zazhi. 2000;25:127-128.  [PubMed]  [DOI]
31.  Ito Y, Azuma T, Ito S, Miyaji H, Hirai M, Yamazaki Y, Sato F, Kato T, Kohli Y, Kuriyama M. Analysis and typing of the vacA gene from cagA-positive strains of Helicobacter pylori isolated in Japan. J Clin Microbiol. 1997;35:1710-1714.  [PubMed]  [DOI]
32.  van Doorn LJ, Figueiredo C, Sanna R, Pena S, Midolo P, Ng EK, Atherton JC, Blaser MJ, Quint WG. Expanding allelic diversity of Helicobacter pylori vacA. J Clin Microbiol. 1998;36:2597-2603.  [PubMed]  [DOI]
Footnotes

This work was supported by the National Natural Science Foundation of China, No 39670648

Edited by Zhou XH proofread by Mittra S

Write to the Help Desk