BPG is committed to discovery and dissemination of knowledge
Original Article Open Access
©The Author(s) 2000. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Aug 15, 2000; 6(4): 526-531
Published online Aug 15, 2000. doi: 10.3748/wjg.v6.i4.526
Glyco-poly-L-lysine is better than liposomal delivery of exogenous genes to rat of liver
Chang-Qing Yang, Ji-Yao Wang, Bo-Ming He, Jian-Jun Liu, Jin-Sheng Guo, Division of Gastroenterology, Zhongshan Hospital, Shanghai Medical University, Shanghai 200032, China
Chang-Qing Yang, male, 35 years old, got his M.D. in 1990 and Ph.D. in 1998 from Xiangya hospital of Hunan Medical University, now is working as a postdoctoral fellow in Zhongshan Hospital of Shanghai Medical University, majoring in liver targeted uptake and hepatic fibrosis.
Author contributions: All authors contributed equally to the work.
Correspondence to: Ji-Yao Wang, Division of Gastroenterology, Zhongshan Hospital, Shanghai Medical University, Shanghai 200032, China. xhk@shmu.edu.cn
Author contributions: All authors contributed equally to the work.
Telephone: +86-21-6404-1990 ext 2420 Fax: +86-21-6483-3680
Received: January 14, 2000
Revised: January 26, 2000
Accepted: February 1, 2000
Published online: August 15, 2000

Abstract

AIM: To compare the effects of liposomes and glyco-poly-L-lysine on liver tar geted uptake and expression of plasmid in rat liver.

METHODS: After binding with lipofectamine or galactose-terminal glyco-poly-L-lysine, the plasmid could be expressed in eukaryotic cells when injected into Wistar rats by intravenous route. At different time intervals after the injection, the distribution and expression of the plasmid in liver of rats were observed and compared using in situ hybridization and immunohistochemistry.

RESULTS: The expression of the plasmid binding to liposomes or G-PLL could be markedly observed 24 h later, and began to decrease one week later, but it still could be observed up to three weeks. Both liposomes and G-PLL could deliver the plasmid to the liver effectively, but the effect of the latter was better than the former concerning the distribution and expression of the plasmid targeted uptake in the liver.

CONCLUSION: G-PLL is better than liposome as the targeted carrier for delivering exogenous genes to the liver.

Key Words: liposomes; glyco-poly-L-lysine; targeted liver uptake; exogenous gene



INTRODUCTION

Liver is one of the important metabolizing organs, and is closely related to many kinds of diseases, such as hereditary disease, infectious disease, metabolic disease, tumors and so on. Since the development of chemical drugs for the trea tment of these diseases is comparatively slow, gene therapy has opened up a prospective way for them[1-5].

The efficient delivery and the high expression of exogenous genes in specific cells or tissues are critical steps for gene therapy both in vitro and in vivo[6-15]. As for the gene therapy of hepatic diseases, efficient delivery of the exogenous genes to the liver and its high expression could increase its local accumulation while minimize the side-effects on other tissues and organs as well.

Both liposome and glyco-poly-L-lysine (G-PLL) are often used as carriers to deliver exogenous genes to the liver in gene therapy experiment[16-22]. Most of the liposomes are cationic when used as the carriers of gene transfe rence. Both in vitro and in vivo studies have showed that liposomes could be applied to transfer exogenous genes to hepatocytes[23,24], but its specificity varies in different studies[24-26]. Poly-L-lysine is a kind of polycation which can be bound to DNA by interacting with the oppositeele ctric charge on DNA. After binding with other specific ligands through covalent linkage, the resulting ligand-poly-L-lysine-DNA complex can be formed[27] and can thus be used to deliver foreign DNA to specific cells or tissues. Similarly, after being saccharified by galactose, glyco-poly-L-lysine (G-PLL) formed is then capable of delivering exogenous genes to the liver specifically [28-30].

Using rats as the experimental animal, we compared the in vivo potency of l iposomes and glyco-poly-L-lysine on delivering the plasmid, which could be expressed in eucaryotic cells.

MATERIALS AND METHODS
Preparation of the carriers

The original plasmid of rat interstitial collagenase was kindly provided by Prof. John J Jeffrey[31], and we reconstructed it with the plasmid of pTa rgetT (TM) (Promega Co., Madison, MI, USA), which could be expressed in eucaryotic cells. We also inserted a segment of nucleotides (GACTACAAGGACGACGATGATAAG) before the terminator codon (TAA) of the rat interstitial collagenase. The ‘Flag Domain’ peptide (DYKDDDDK) encoded by the segment of nucleotide above, which was usually called ‘Tag’, could be fused in the rat interstitial collag enase[32-33] and could be specifically recognized by a M2 monoclonal an tibody (Kodak, New Haven, CT, USA). This recombinant plasmid was named pTM/MMP- 1. The plasmid of pTM/MMP-1 was extracted and purified using QIAGEN-Tip 500 kit (QIAGEN lnc., Valencia, CA, USA) according to manufacturers of the instructions. The plasmid was mixed with different amounts of lipofectamine (GIBCO, Grand I sland, NK, USA) or galactose-terminal glyco-poly-L-lysine (kindly provided by Dr. Shou-Ming Wen of Air-force General Hospital of PLA, China. The mean mol ecu lar weight of this kind of G-PLL was 8500 and the ratio of glactose to poly-L-lysine was 15: 28). The optimal proportion of the plasmid pTM/MMP-1 to lipo fec tamine or galactose-terminal glyco-poly-L-lysine was determined by elect rophoresis in 1% agarose gel.

Animal experiments

Eighteen male Wistar rats, with body weight 130-150 g, were randomly divided into three groups. Lipofectamine intravenious (LI) group: 50 μg of plasmid pTM/ MMP-1 encapsulated by lipofectamine was given through cauda vein; Poly-L-lysi ne intravenous (PI) group: 50 μ plasmid pTM/MMP-1 binding to gala ctose-termi nal glyco-poly-L-lysine was administred through cauda vein; Normal group: control animal. Twenty-four hours, 48 h, 72 h, 1 wk, 2 wk, 3 wk af ter the administration of the plasmid, one rat from each group was randomly selected and anaesthetized with 2% pentobarbital sodium intraperitoneally. Then 1 mL blood from each rat was obtained by cardiac puncture for the assay of alanine transaminase (ALT), aspartic transaminase (AST), and creatinine (Cr) to follow the functions of important organs. After perfusion of the whole body with 20 mL phosphate-buffered saline and 40 mL precold 4% paraformaldehyde through ventricula rinjection, the tissues of liver, spleen, lungs and kidneys were collected and fixed in 4% paraformaldehyde, encapsulated in paraffin and cut into sections of 4 μm thick. The animal experiments above were approved by the Laboratory Animal Committee of Shanghai Medical University.

Immunohistochemistry

Immunohistochemistry was performed according to the literature[34,35]. The first antibody used was M2 monoclonal antibody which was specific for flag-domain tag (Kodak, New Haven, CT, USA) and the second antibody used was Horse anti-mouse IgG, labeled with biotin(Vecter, Burlingame, CA, USA). After the treatment with avidin and biotin (ABC kit, Vecter, Burlingame, CA, USA), color development was followed using dimethylaminoazobenzene (DAB) and counterstained with hematoxylin. Five fields were observed under high power from every immunostained section and the positive signals were counted.

In situ hybridization

The procedure of in situ hybridization was also described previously[34,35]. To state briefly, the oligonucleotide probe (5’-TGGTGTGACTACAAGGACGACGATGATAAG-3’) was synthesized in Cell Biology Institute of Chinese Academy of Sciences (Shanghai), which could hybridize with the (mRNA) of the flag-domain tag in the plasmid pTM/MMP-1, and the 5’ of the probe was labeled with biotin. After the hybridization of the target mRNA with the probe, the rest of the procedure was similar to that followed in immonohistochemistry excluding the step of hematoxylin counterstaining.

Other biochemical assays

ALT, AST, and Cr were assayed using the 7170A Automatic Analyzer (HITACHI, Jap an) to observe the changes in the important organs’ function.

Data analysis

The data was analysed using the software SPSS 7.0 for windows (One-way ANOVA).

RESULTS
Ratio of liposomes and G-PLL to plasmid

According to the electrophoresis results, we found that 5 μL of li pofectamine could encapsulate 1 μg of plasmid pTM/MMP-1 completely; While 0. 3 μg of galactose-terminal glyco-poly-L-lysine throughly could bind to 1 μg of the pl asmid, which meant that about 72 molecules of G-PLL could carry one molecule of the plasmid pTM/MMP-1 (Figures 1 and 2).

Figure 1
Figure 1 Determination of the optimal proportion of liposome bound to plasmid by 1% agarose electrophoresis. Lane 1-8 are respectively 1-8 μL lipofectamine mixed with 1 μg pTM/MMP-1 plasmid. Plasmid 1 μg could only be encapsulated complet ely by more than 5 μL lipofectamine.
Figure 2
Figure 2 Determination of the optimal proportion of G-PLL bound to plasmid by 1% agarose electrophoresis. Lane 1-8 are respectively 0.05 μg, 0.1 μg, 0.2 μg, 0.3 μg , 0.4 μg, 0.5 μg, 1.0 μg, and 1.5 μg G-PLL mixed with 1 μg pTM/ MMP-1 plasmid. Plasmid 1 μg could only been bound completely by more than 0.4 μg G-PLL.
The changes in the functioning of important organs

Compared with the normal group, there was no obvious elevation of the ALT, AS T, and Cr levels in the LI, PI groups.

The distribution and expression of the plasmid in liver, spleen, lung and kidney

The results of the immunohistochemistry and in situ hybridization showed that the plasmidbinding to liposomes or G-PLL could be expressed in vivo, and the results of immunohistochemistry were more sensitive and stable. In addition, the protein product of the plasmid could be secreted extracellularly (Figures 3 and 4), similar to the expression of interstitial collagenase in the phy siological state[36]. We found that both liposomes and G-PLL could deli ver the plasmid to the liver very efficiently, making liver as its major distribution organ. The obvious expression of the plasmid could be observed 24 h after the administration and began to decrease one week later, although it could still be observed weakly even two or three weeks later (Figure 5). Among the three groups, we also observed that the expression and distribution of the plasmid in the liver was most in the PI group, followed by the LI group. Besides the liver , the exogenous gene could also be expressed highly in lungs, and expressed in ki dney in a relatively lower level in the LI group; while for the PI group, a relatively lower level of the expression could be seen in the kidney, the spleen, and the lung.

Figure 3
Figure 3 Immunostaining of flag-domain tag in the liver of rat 24 h after the admini stration of the plasmid bound to G-PLL (galactose-terminal glyco-poly-L-lysine) via cauda vein. × 200
Figure 4
Figure 4 In situ hybridization with biotin labeled oligonucleotide probe in the liver 3 wk after the administration of the plasmid encapsulated by liposome (lipofectamine) via cauda vein. × 100
Figure 5
Figure 5 The distribution and expression of the plasmid bound to liposomes or G-PLL (gal actose-terminal glyco-poly-L-lysine) in different tissues and at differe nt time points. A: liver, B: spleen, C: lung, D: kidney. LI: plasmid encapsulate d by liposomes given through cauda vein, PI: plasmid bound to G-PLL introduced intravenously.
DISCUSSION

Both liposomes and G-PLL can be used as the targeted carriers to deliver drugs or nucleotides to liver[17-21,24-29], but the comparison of their effects on the liver targeted uptake have not been reported extensively.

Gene transfer mediated by receptors is carried out by high affinity linkage between the ligands (binding to the foreign gene) and specific receptors on the surface of different kinds of cells, and then the foreign gene can be delivered into the cells by phagocytosis[37-40]. There also exist some specific receptors on the surface of hepatocytes such as asialoglycoprotein receptor (ASG P-R)[41,42], which facilitate the delivery of exogenous genes into hepa tocytes specifically using the ligand-receptor interaction. Galactose-terminal glyco-poly-L-lysine contains the saccharide group of galactosan that can be specifically ligated to the ASGP-R on the surface of hepatocytes. At the same time, the cationic poly-L-lysine can bind to nucleotides with high affinity , thus forming a good carrier to deliver exogenous DNA to liver specifically and ste adily[28-30]. It has been reported in the literature, that the ratio of the liver targeted delivery could reach up to 70%-90% in vivo[27,43]. In our experiments we found that in addition to its main locati on in the liver, the plasmid binding to G-PLL could be expressed in kidney, spleen, and lung also. It may be due to the existence of ASGP-R in other extrahepa tic tissues[44,45].

Liposomes are a kind of annular closed vesicles made from double layers of lipid molecules[46]. Having no toxicity and no immunogenicity[47]. Gene transfer mediated by liposomes is achieved by the fusion between liposomes and the membrane of the cells. Liposomes encapsulating the foreign DNA can be integrated with the membrane of the cells, and thus the foreign gene can be deli vered inside the cells by phagocytosis[24,48-50]. Because it contains lecithin and lactosylceramide that can bind to ASGP-R on the surface of hepato cytes specifically, liposome could also be used as targeted delivery carrier to the liver[51,52]. Our experiment al results demonstrated that the plasmid encapsulated by liposomes could also be expressed in lung and spleen to a certain extent despite its major expression in the liver, maybe due to the macrophage system which existed in the lung, spleen, and other tissues. This phenomenon demonstrates further that the efficacy of liver targeted delivery by liposomes is inferior to that of G-PLL.

In this study, we also observed whether liposomes and G-PLL, both binding to the plasmid, would induce some toxicity to the body or not. We did not find any detrimental effects on the functioning of important organs like liver, heart, and kidney and this indicated further that liposomes and G-PLL could be used in vivo safely as delivery carriers for drug or nucleotides.

In conclusion, we found that the plasmid binding to liposomes or G-PLL could be delivered to the liver efficiently and G-PLL was better than liposomes regar ding the distribution and expression of the plasmid in the liver. Both liposomes and G-PLL can be used as carriers to deliver drugs or nucleotides to rat liver, but whether they can be used in human beings in the future deserves further in vestigation.

ACKNOWLEDGEMENTS

We express our thanks to Dr. Shou-Ming Wen of Air-Force General Hospital of PLA, China for kindly providing galactose-terminal glyco-poly-L-lysine. We also want to thank the Deptartment of Pathology in Zhongshan Hospital for their technical assistance.

References
1.  Miller AD. Human gene therapy comes of age. Nature. 1992;357:455-460.  [PubMed]  [DOI]
2.  Anderson WF. Human gene therapy. Science. 1992;256:808-813.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 505]  [Cited by in RCA: 450]  [Article Influence: 13.2]  [Reference Citation Analysis (0)]
3.  Cao GW, Gao J, Du P, Qi ZT, Kong XT. Construction of retroviral vec tors to induce a strong expression of human class I interferon gene in human he patocellular carcinoma cells in vitro. World J Gastroenterol. 1997;3:139-145.  [PubMed]  [DOI]
4.  Crystal RG. The Gordon Wilson Lecture. In vivo gene therapy: a strategy to use human genes as therapeutics. Trans Am Clin Climatol Assoc. 1995;106:87-99.  [PubMed]  [DOI]
5.  Xu CT, Pan BR. Current status of gene therapy in gastroenterology. World J Gastroenterol. 1998;4:85-89.  [PubMed]  [DOI]
6.  Vile R, Russell SJ. Gene transfer technologies for the gene therapy of cancer. Gene Ther. 1994;1:88-98.  [PubMed]  [DOI]
7.  Cao GW, Qi ZT, Pan X, Zhang XQ, Miao XH, Feng Y, Lu XH, Kuriyama S, Du P. Gene therapy for human colorectal carcinoma using human CEA promoter contro led bacterial ADP-ribosylating toxin genes human CEA: PEA & amp; DTA gene transfer. World J Gastroenterol. 1998;4:388-391.  [PubMed]  [DOI]
8.  Cao GD, Wang SW, Wu SS, Li HF, Zhang WG. Retrovirus medi-ated antise nse RNA to bcl-2 alter the biological behavior of stom-ach carcinoma MGC 803 cell lines. World J Gastroenterol. 1998;4:45-48.  [PubMed]  [DOI]
9.  Chen B, Zhang XY, Zhang YJ, Zhou P, Gu Y, Fan DM. Antisense to cyclin D1 reverses the transformed phenotype of human gastric cancer cells. World J Gastroenterol. 1999;5:18-21.  [PubMed]  [DOI]
10.  Wu GY, Wu CH. Delivery systems for gene therapy. Biotherapy. 1991;3:87-95.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 54]  [Cited by in RCA: 53]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
11.  Darimont BD. The Hsp90 chaperone complex A potential target for cancer therapy. World J Gastroenterol. 1999;5:195-198.  [PubMed]  [DOI]
12.  Zhang ZR, He Q. Study on liver targeting and hepatocytes permeable valaciclovir polybutylcyanoacrylate nanoparticles. World J Gastroenterol. 1999;5:330-333.  [PubMed]  [DOI]
13.  Dai YM. Targeting chemical therapy: New focus of gene therapy. Shijie Huaren Xiaohua Zazhi. 1999;7:469-472.  [PubMed]  [DOI]
14.  Ferry N. [Gene therapy of the liver: from the laboratory to the patient's bedside]. Acta Gastroenterol Belg. 1994;57:213-218.  [PubMed]  [DOI]
15.  Di Campli C, Wu J, Gasbarrini A, Gasbarrini G, Zern MA. Gene therapy for human liver diseases. Eur J Gastroenterol Hepatol. 1999;11:421-429.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 7]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
16.  Zhang L, Li SN, Wang XN. CEA and AFP expression in human hepatoma cells transfected with antisense IGF-I gene. World J Gastroenterol. 1998;4:30-32.  [PubMed]  [DOI]
17.  Gao X, Huang L. Potentiation of cationic liposome-mediated gene delivery by polycations. Biochemistry. 1996;35:1027-1036.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 360]  [Cited by in RCA: 326]  [Article Influence: 10.9]  [Reference Citation Analysis (9)]
18.  Chen B, Zhang XY, Zhang YJ, Zhou P, Gu Y, Fan DM. Antisense to cyclin D1 reverses the transformed phenotype of human gastric cancer cells. World J Gastroenterol. 1999;5:18-21.  [PubMed]  [DOI]
19.  Kato K, Nakanishi M, Kaneda Y, Uchida T, Okada Y. Expression of hepatitis B virus surface antigen in adult rat liver. Co-introduction of DNA and nuclear protein by a simplified liposome method. J Biol Chem. 1991;266:3361-3364.  [PubMed]  [DOI]
20.  Wu GY, Wilson JM, Shalaby F, Grossman M, Shafritz DA, Wu CH. Receptor-mediated gene delivery in vivo. Partial correction of genetic analbuminemia in Nagase rats. J Biol Chem. 1991;266:14338-14342.  [PubMed]  [DOI]
21.  Wu GY, Wu CH. Receptor-mediated gene delivery and expression in vivo. J Biol Chem. 1988;263:14621-14624.  [PubMed]  [DOI]
22.  Walton CM, Wu CH, Wu GY. A DNA delivery system containing listeriolysin O results in enhanced hepatocyte-directed gene expression. World J Gastroenterol. 1999;5:465-469.  [PubMed]  [DOI]
23.  Li AP, Myers CA, Kaminski DL. Gene transfer in primary cultures of human hepatocytes. In Vitro Cell Dev Biol. 1992;28A:373-375.  [PubMed]  [DOI]
24.  Mahato RI, Kawabata K, Takakura Y, Hashida M. In vivo disposition characteristics of plasmid DNA complexed with cationic liposomes. J Drug Target. 1995;3:149-157.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 79]  [Cited by in RCA: 75]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
25.  Tagawa M, Yokosuka O, Imazeki F, Ohto M, Omata M. Gene expression and active virus replication in the liver after injection of duck hepatitis B virus DNA into the peripheral vein of ducklings. J Hepatol. 1996;24:328-334.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 8]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
26.  McCormack B, Gregoriadis G. Comparative studies of the fate of free and liposome-entrapped hydroxypropyl-beta-cyclodextrin/drug complexes after intravenous injection into rats: implications in drug delivery. Biochim Biophys Acta. 1996;1291:237-244.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 46]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
27.  Stankovics J, Crane AM, Andrews E, Wu CH, Wu GY, Ledley FD. Overexpression of human methylmalonyl CoA mutase in mice after in vivo gene transfer with asialoglycoprotein/polylysine/DNA complexes. Hum Gene Ther. 1994;5:1095-1104.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 83]  [Cited by in RCA: 73]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
28.  Martinez-Fong D, Mullersman JE, Purchio AF, Armendariz-Borunda J, Martinez-Hernandez A. Nonenzymatic glycosylation of poly-L-lysine: a new tool for targeted gene delivery. Hepatology. 1994;20:1602-1608.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 44]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
29.  Guo J, Zhou YX, Yao ZQ, Wang SQ, Weng SM, Wang BC. Specific delivery to liver cells by asialoglycoprotein modified antisense oligodeoxynucleotides in vitro and in vivo. Zhonghua Chuanranbing Zazhi. 1997;15:16-19.  [PubMed]  [DOI]
30.  Dini L, Falasca L, Lentini A, Mattioli P, Piacentini M, Piredda L, Autuori F. Galactose-specific receptor modulation related to the onset of apoptosis in rat liver. Eur J Cell Biol. 1993;61:329-337.  [PubMed]  [DOI]
31.  Quinn CO, Scott DK, Brinckerhoff CE, Matrisian LM, Jeffrey JJ, Partridge NC. Rat collagenase. Cloning, amino acid sequence comparison, and parathyroid hormone regulation in osteoblastic cells. J Biol Chem. 1990;265:22342-22347.  [PubMed]  [DOI]
32.  Guo J, Wang J. [Construction of mammalian expression plasmid of Flag-tagged rat collagenase and its in vitro transfection study]. Zhonghua Ganzangbing Zazhi. 1999;7:226-229.  [PubMed]  [DOI]
33.  Yang CQ, Wang JY, Fang GT, Liu JJ, Guo JS. A comparison between intravenous and peritoneal route on liver targeted uptake and expression of plasmid delivered by Glyco-poly-l-lysine. World J Gastroenterol. 2000;6:508-512.  [PubMed]  [DOI]
34.  Huang Bei. In situ hybridization of tissues and cells. In: Qian W, edito r. Modern medical experimental method. Firsted. Beijing: People's Medical Publishing House 1997.p 89-92. .  [PubMed]  [DOI]
35.  Omar B, Thikkavarapu S, Roger P, John H. In situ hybridization and immunohistochemistry. In: Ausubel FM, Brent R, Kingston RE, Woore DD, seidman JG, Smith JA, Struhl K, editors. Short protocols in molecular biology. 3rd ed. John Wiley and Sons, Inc. 1995;539-586.  [PubMed]  [DOI]
36.  Van Wart HE, Birkedal-Hansen H. The cysteine switch: a principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family. Proc Natl Acad Sci USA. 1990;87:5578-5582.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 986]  [Cited by in RCA: 1016]  [Article Influence: 28.2]  [Reference Citation Analysis (0)]
37.  Mathias CJ, Wang S, Lee RJ, Waters DJ, Low PS, Green MA. Tumor-selective radiopharmaceutical targeting via receptor-mediated endocytosis of gallium-67-deferoxamine-folate. J Nucl Med. 1996;37:1003-1008.  [PubMed]  [DOI]
38.  Bijsterbosch MK, Manoharan M, Rump ET, De Vrueh RL, van Veghel R, Tivel KL, Biessen EA, Bennett CF, Cook PD, van Berkel TJ. In vivo fate of phosphorothioate antisense oligodeoxynucleotides: predominant uptake by scavenger receptors on endothelial liver cells. Nucleic Acids Res. 1997;25:3290-3296.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 102]  [Cited by in RCA: 124]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
39.  Zhoug S, Wen SM, Zhang DF, Wang QL, Wang SQ, Ren H. Sequencing of PCR amplified HBV DNA pre-c and c regions in the 2.2.15 cells and antiviral action by targeted antisense oligonucleotide directed against sequence. World J Gastroenterol. 1998;4:434-436.  [PubMed]  [DOI]
40.  Zhang ZR, He Q. Study on liver targeting and hepatocytes permeable valaciclovir polybutylcyanoacrylate nanoparticles. World J Gastroenterol. 1999;5:330-333.  [PubMed]  [DOI]
41.  Becker S, Spiess M, Klenk HD. The asialoglycoprotein receptor is a potential liver-specific receptor for Marburg virus. J Gen Virol. 1995;76:393-399.  [PubMed]  [DOI]
42.  Treichel U, McFarlane BM, Seki T, Krawitt EL, Alessi N, Stickel F, McFarlane IG, Kiyosawa K, Furuta S, Freni MA. Demographics of anti-asialoglycoprotein receptor autoantibodies in autoimmune hepatitis. Gastroenterology. 1994;107:799-804.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 57]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
43.  Chowdhury NR, Wu CH, Wu GY, Yerneni PC, Bommineni VR, Chowdhury JR. Fate of DNA targeted to the liver by asialoglycoprotein receptor-mediated endocytosis in vivo. Prolonged persistence in cytoplasmic vesicles after partial hepatectomy. J Biol Chem. 1993;268:11265-11271.  [PubMed]  [DOI]
44.  Mu JZ, Tang LH, Alpers DH. Asialoglycoprotein receptor mRNAs are expressed in most extrahepatic rat tissues during development. Am J Physiol. 1993;264:G752-G762.  [PubMed]  [DOI]
45.  Park JH, Cho EW, Shin SY, Lee YJ, Kim KL. Detection of the asialoglycoprotein receptor on cell lines of extrahepatic origin. Biochem Biophys Res Commun. 1998;244:304-311.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 22]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
46.  Mannino RJ, Gould-Fogerite S. Liposome mediated gene transfer. Biotechniques. 1988;6:682-690.  [PubMed]  [DOI]
47.  de Haan P, Claassen E, van Rooijen N. Liposomes as carrier for antibiotics: a comparative study on the immune response against liposome-encapsulated penicillin and other penicillin preparations. Int Arch Allergy Appl Immunol. 1986;81:186-188.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 5]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
48.  Satoh E, Osawa M, Tomiyasu K, Hirai H, Shimazaki C, Oda Y, Nakagawa M, Kondo M, Kinoshita S, Mazda O. Efficient gene transduction by Epstein-Barr-virus-based vectors coupled with cationic liposome and HVJ-liposome. Biochem Biophys Res Commun. 1997;238:795-799.  [PubMed]  [DOI]
49.  Wu JS, He Y, Wang SM. Inhibitory effects of EGFG antisense oligodeoxy nucleotide with liposome in human colorectal cancer cell line. Shijie Huaren Xiaohua Zazhi. 1998;6:762-765.  [PubMed]  [DOI]
50.  Caplen NJ, Kinrade E, Sorgi F, Gao X, Gruenert D, Geddes D, Coutelle C, Huang L, Alton EW, Williamson R. In vitro liposome-mediated DNA transfection of epithelial cell lines using the cationic liposome DC-Chol/DOPE. Gene Ther. 1995;2:603-613.  [PubMed]  [DOI]
51.  Nicolau C, Cudd A. Liposomes as carriers of DNA. Crit Rev Ther Drug Carrier Syst. 1989;6:239-271.  [PubMed]  [DOI]
52.  Nandi PK, Legrand A, Nicolau C. Biologically active, recombinant DNA in clathrin-coated vesicles isolated from rat livers after in vivo injection of liposome-encapsulated DNA. J Biol Chem. 1986;261:16722-16726.  [PubMed]  [DOI]
Footnotes

This work was supported by the National Natural Science Foundation of China (No39570336).

Edited by Zhu QR proofread by Mittra S