Yang CQ, Wang JY, Fang GT, Liu JJ, Guo JS. Comparison between intravenous and peritoneal route on liver targeted uptake and expression of plasmid delivered by Glyco-poly-L-lysine. World J Gastroenterol 2000; 6(4): 508-512 [PMID: 11819638 DOI: 10.3748/wjg.v6.i4.508]
Corresponding Author of This Article
Ji-Yao Wang, Division of Gastroenterology, Zhongshan Hospital, Shanghai Medical University, Shanghai 200032, China. xhk@shmu.edu.cn
Article-Type of This Article
Original Article
Open-Access Policy of This Article
This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
Aug 15, 2000 (publication date) through May 16, 2026
Times Cited of This Article
Times Cited (0)
Journal Information of This Article
Publication Name
World Journal of Gastroenterology
ISSN
1007-9327
Publisher of This Article
Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA
Share the Article
Yang CQ, Wang JY, Fang GT, Liu JJ, Guo JS. Comparison between intravenous and peritoneal route on liver targeted uptake and expression of plasmid delivered by Glyco-poly-L-lysine. World J Gastroenterol 2000; 6(4): 508-512 [PMID: 11819638 DOI: 10.3748/wjg.v6.i4.508]
Chang-Qing Yang, Ji-Yao Wang, Guo-Ting Fang, Jian-Jun Liu, Jin-Sheng Guo, Division of Gastroenterology, Zhongshan Hospital, Shanghai Medical University, Shanghai 200032, China
Chang-Qing Yang, male, 35 years old, got his M.D. in 1990 and Ph.D. in 1998 from Xiangya Hospital of Hunan Medical University, now is working as a postdoctoral fellow in Zhongshan Hospital of Shanghai Medical University, majoring in liver targeted uptake and hepatic fibrosis.
ORCID number: $[AuthorORCIDs]
Author contributions: All authors contributed equally to the work.
Correspondence to: Ji-Yao Wang, Division of Gastroenterology, Zhongshan Hospital, Shanghai Medical University, Shanghai 200032, China. xhk@shmu.edu.cn
Received: December 22, 1999 Revised: December 31, 1999 Accepted: January 2, 2000 Published online: August 15, 2000
Abstract
AIM: To compare the effects of intravenous route and peritoneal route on liver targeted uptake and expression of plasmid delivered by galactose-terminal glyco-poly-L-lysine (G-PLL).
METHODS: The plasmid pTM/MMP-1 which could be expressed in eukaryotic cells was bound to G-PLL, and was then transferred into Wistar rats by intra venous and intraperitoneal injection. The expression and distribution of the plasmid were observed at different time periods by in situ hybridization and im munohistochemistry.
RESULTS: The plasmid could be expressed significantly within 24 h a fter being transferred in vivo by both intravenous and intraperitoneal routes. One week later the expression began to decrease, and could still be observed three weeks later. Although both the intravenous and intraperitoneal route could target-specifically deliver the plasmid to the liver, the effect of the former was better as compared to that of the latter.
CONCLUSION: Intravenous route is better for liver targeted uptake and expression of G-PLL-bound plasmids than the peritoneal route.
Citation: Yang CQ, Wang JY, Fang GT, Liu JJ, Guo JS. Comparison between intravenous and peritoneal route on liver targeted uptake and expression of plasmid delivered by Glyco-poly-L-lysine. World J Gastroenterol 2000; 6(4): 508-512
The efficient transference and the high expression of exogenous genes in specific cells or tissues are critical steps for both in vitro and in vivo gene therapy[1-12]. Gene transference mediated by receptors is carried out by high affinity linkage between the ligands (binding to the foreign gene) and specific receptors on the surface of different kinds of cells, and then the fore ign gene can be delivered into the cells by phagocytosis[13,14]. There also exist some specific receptors on the surface of hepatocytes such as asialog lycoprotein receptors (ASGP-R)[15-19], which facilitate the researche rs to deliver exogenous genes into hepatocytes specifically using the ligand-re ceptor interaction. Galactose-terminal glyco-poly-L-lysine (G-PLL) cont ains the saccharide group of galactosan that can be specifically ligated to the asia loglycoprotein receptor (ASGP-R) on the surface of hepatocytes. At the same time, the cationic poly-L-lysine can bind to nucleotides with high affinity, so it can serve as a good carrier to deliver exogenous DNA to liver specifically and steadily[20-24].
Both peripheral veins and abdominal cavity can be used as the delivery route to target drug or nucleotide to liver[25-28], but the comparison of their effects on the targeted liver uptake has seldom been reported.
Using rats as the experimental animals, we compared in vivo the difference in distribution and expression of the plasmid given through intravenous or intrap eritoneal route.
MATERIALS AND METHODS
Preparation of the carriers
The original plasmid of rat interstitial collagenase was kindly provided by Prof. John J Jeffrey[29], and we reconstructed it with the plasmid of pT argetT (TM) (Promega Co., Madison, MI, USA), which could be expressed in eucaryotic cells. We also inserted a segment of nucleotides (GACTACAAGGACGACGATGATAAG) before the terminator codon (TAA) of the rat interstitial collagenase. The ‘Flag Domain’ peptide (DYKDDDDK) encoded by the segment of nucleotide above, which was usually called ‘Tag’, could be fused in the rat interstitial colla genase[30] and could be specifically recognized by an M2 monoclonal anti body (Kodak, New Haven, CT, USA). This recombinant plasmid was named pTM/MMP-1. The plasmid of pTM/MMP-1 was extracted and purified using QIAGEN-Tip 500 kit (QIAGEN Inc., Valencia, CA, USA) according to the manufactures instructions. The plasmid was mixed with different amounts of galactose-terminal glyco-poly- L-lysine (kindly provided by Dr. Shou-Ming Wen of Air-Force General Hospi tal o f PLA, China. The mean molecular weight of this GPLL was 8500 and the ratio of glactose topoly-L-lysine was 15:28). The optimal proportion of the plasmid pTM/MMP-1 binding to galactose-terminal glyco-poly-L-lysine was determin ed by electrophoresis in 1% agarose gel.
Animal experiments
Eighteen male Wistar rats, with body weight of 130-150 g, were randomly divided into three groups of six rats each. Poly-L-lysine intravenous (PI) group: 50 μg plasmid pTM/MMP-1 bound to galactose-terminal glyco-poly-L-lysine wa s administered through cauda vein; poly-L-lysine intra-peritoneal (PP) g roup: each rat was given the same amount of pTM/MMP-1 bound to galactose-termin al glyco-poly-L-lysine intraperitoneally; normal group: control animals. Tw enty-four hours, 48 h, 72 h, 1 wk, 2 wk, 3 wk after the administrat ion of the plasmid, one rat from each group was randomly selected and anaesthetized with 2% pentobarbital sodium intraperitoneally. Then 1 mL blood was obtained by cardiac puncture for the assay of alanine transaminase (ALT), aspartic trans aminase (AST), and creatinine (Cr) to observe the functions of important organs. After perfusion of the whole body with 20 mL phosphate-buffered saline and 40 mL 4% paraformaldehyde through ventricular injection, the tissues of liver, spleen, lungs, and kidneys were collected and fixed in 4% paraformaldehyde, encapsula t ed in paraffin and cut into sections 4-μm thick. This procedure above was approved by the Laboratory Animal Committee of Shanghai Medical University .
Immunohistochemistry
Immunohistochemistry was performed according to the literature[31,32]. The first antibody used was M2 monoclonal antibody which was specific for flag-domain tag (Kodak, New Haven, CT, USA) and the second antibody used was Horse anti-mouse IgG, labeled with biotin (Vecter, Burlingame, CA, USA). After the treatment with avidin and biotin (ABC kit, Vecter, Burlingame, CA, USA), color dev elopment was followed using dimethylaminoazobenzene (DAB) and counterstained with hematoxylin. Five fields were observed under high power from every immunostained section and the positive signals were counted.
In situ hybridization
The procedure of in situ hybridization was also described previously[25,26]. To state briefly, the oligonucleotide probe (5’-TGGTGTGACTACAAGGACGACGATGATAAG-3’) was synthesized in Cell Biology Institute of Chinese Academy of Sciences (Shanghai), which could hybridize with the (mRNA) of the flag-domain tag in the plasmid pTM/ MMP-1, and the 5’ end of the probe was labeled with biotin. After the hybridization of the target mRNA with the probe, the rest of the procedure was similartothatfollowedinimmunohistochemistry excluding the step of hematoxylin counterstaining.
Other biochemical assays
ALT, AST, and Cr were assayed using the 7170A Automatic Analyzer (HITACHI, Japan) to observe the changes in the important organs’ function.
Data analysis
All of the data were analyzed by the software SPSS 7.0 for windows (one-way ANOVA).
RESULTS
Ratio of G-PLL to plasmid
According to the electrophoresis results, we found that 0.3 μg of galacto se-terminal glyco-poly-L-lysine could throughly bind to 1 μg of the plasmid , which meant that about 72 molecules of G-PLL could carry one molecule of the plasmid pTM/MMP-1 (Figure 1).
Figure 1 Determination of optimal proportion of G-PLL bound to plasmid by 1% agar ose electrophoresis.
Lane 1-8 are respectively 0.05 μg, 0.1 μg, 0.2 μg, 0.3 μg, 0.4 μg, 0.5 μg, 1.0 μg, and 1.5 μg G-PLL mixed with 1 μg pTM/MMP-1 p lasmid. pTM/MMP-1 1 μg plasmid could only be bound completely by more than 0. 4 μg G-PLL.
The changes in the functioning of important organs
Compared with the normal group, there was no obvious elevation of the ALT, AST, and Cr levels in the PI and PP groups.
The distribution and expression of the plasmid in liver, spleen, lung and kidney
The results of the immunohistochemistry and in situ hybridization showed tha t the plasmid binding to G-PLL could be expressed in vivo, regardless of th e introducing route and the results of immunohistochemistry were more sensitive a nd stable. In addition, the protein product of the plasmid could be secreted ext racellularly (Figures 2 and 3), similar to the expression of interstiti al collag enase in the physiological state[30,33]. We found that both intravenous route and intraperitoneal route could make liver as the major distribution organ of the plasmid bound to G-PLL.
Figure 2 Immunostaining of flag-domain tag in the liver all hours after admin istration of the plasmid bound to G-PLL (galactose-terminal glyco-poly-L-lysine) via cauda vein.
× 200
Figure 3 In situ hybridization with biotin labeled oligonucleotide probe in the liver 3 wk after the administration of the plasmid bound to G-PLL (galacto se-terminal glyco-poly-L-lysine) via abdominal cavity.
× 100
The obvious expression of the plasmid could be observed 24 h after the administration and began to decrease one week later, although it could still be observed weakly even two or three weeks later. Among the two groups, we observed that the expression and distribution of the plasmid in the liver of the PI group was significantly higher than that of the PP group. Besides the liver, the plasmid in PI group could also be expressed in lung at a lower level, and almost could not be expressed in spleen and kidney. As for the PP group, most of the distribution and expression was located in the liver and a relatively higher level could be seen in the spleen and kidney, whereas low expression could be observed in the lungs (Figure 4).
Figure 4 The distribution and expression of the plasmid bound to G-PLL (galactosetermina l glyco-poly-L-lysine) in different tissues and at different time period and administered intraperitoneally or intravenously.
A: liver, B: spleen, C: lung, D: kidney. PI: plasmid bound to G-PLL introduced intravenously, PP: plasmid bound to G-PLL introduced intraperitoneally.
DISCUSSION
Regarding the gene therapy of hepatic diseases, efficient delivery of the exogenous genes to the liver and its high expression there could increase its local accumulation and minimize the side-effects on other tissues and organs as well[34-36].
For the gene therapy of hepatic diseases in the animal experiments, exogenous ge nes were usually delivered to the liver through the portal vein, bile duct injec tion, or even by direct liver injection[37-41]. From the viewpoint of clinical application these methods have limitations concerning its invasive trauma and possible risk. If the gene transference to liver could be accomplished by a peripheral vein or abdominal cavity, the limitations could t hen be avoided or decreased and it would also be easily accepted by the patients. So we observed the efficacy of liver targeted gene delivery using intravenous and intraperitoneal routes.
Receptor mediated gene transfer was carried out by high affinity linkage between the ligands (binding to the foreign gene) and specific receptors on the surface of different kinds of cells, such that the foreign gene could be delivered into the cells by phagocytosis[24,42]. It has been reported that the ratio of the targeted uptake by the liver delivered by G-PLL could reach up to 70%-90% in vivo[43,44]. In our experiments we found that in additio n to its main location in the liver, the plasmid binding to G-PLL could be also expressed in kidneys, spleen, and lungs. It might be due to the existence of AS GP-R in the other extrahepatic tissues[45,46].
Recently Zhang et al[42]found that intravenous injection was an us eful method for delivery to liver by a target carrier. We found that the peripheral vein route was better than abdominal cavity in the targeted delivery of the plasmid bound to G-PLL. We conjectured that although the majority of the DNA/ ca rrier complex would reach the liver through portal vein after the absorption by the abundant capillary bed of peritoneum, quite a lot of the complex would possibly be absorbed or degraded by other organs in the abdominal cavity, thus leadin g to the decreased distribution and expression of the plasmid in the liver. In the same way, it might be one of the reasons that its distribution in the spleen reached to a relatively high level. In this experiment, we also observed whether G-PLL binding to the plasmid would induce some toxicity to the body. We did not find any detrimental effect on the functioning of important organs such as liver, heart, and kidney, and this further indicated that G-PLL could be used safely in vivo as the delivery carriers for drug or nucleotides.
In conclusion, we found that the plasmid bound to GPLL could be delivered to the liver efficiently and safely, and the intravenous transference was better than peritoneal transference for the targeted uptake by the liver when G-PLL was used as a carrier. But whether G-PLL can be used to deliver drugs or nucleotides for the treatment of liver diseases in human beings by intravenous route deserves further investigations.
ACKNOWLEDGEMENTS
We express our thanks to Dr. Shou-Ming Wen of the Air-force General Hospital of PLA in P.R.China for kindly providing galactose-termi nal glyco-poly-L-lysine. We also want to thank the Deptartment of Pathology in Zhongshan Hospital for their technical assistance.
Cao GW, Gao J, Du P, Qi ZT, Kong XT. Construction of retroviral vec tors to induce a strong expression of human class I interferon gene in human he patocellular carcinoma cells in vitro.World J Gastroenterol. 1997;3:1 39-145.
[PubMed] [DOI]
Cao GW, Qi ZT, Pan X, Zhang XQ, Miao XH, Feng Y, Lu XH, Kuriyama S, Du P. Gene therapy for human colorectal carcinoma using human CEA promoter contro led bacterial ADP-ribosylating toxin genes human CEA: PEA & amp; DTA gene transfer.World J Gastroenterol. 1998;4:388-391.
[PubMed] [DOI]
Zhang L, Li SN, Wang XN. CEA and AFP expression in human hepatoma cells transfected with antisense IGF-I gene.World J Gastroenterol. 1998;4:30-32.
[PubMed] [DOI]
Cao GD, Wang SW, Wu SS, Li HF, Zhang WG. Retrovirus medi-ated antise nse RNA to bcl- 2 alter the biological behavior of stomach carcinoma MGC 803 cell lines.World J Gastroenterol. 1998;4:45-48.
[PubMed] [DOI]
Chen B, Zhang XY, Zhang YJ, Zhou P, Gu Y, Fan DM. Antisense to cyclin D1 reverses the transformed phenotype of human gastric cancer cells.World J Gastroenterol. 1999;5:18-21.
[PubMed] [DOI]
Wu JS, He Y, Wang SM. Inhibitory effects of EGFG antisense oligod eoxy-nucleotide with liposome in human colorectal cancer cell line.Shijie Huaren Xiaohua Zazhi. 1998;6:762-765.
[PubMed] [DOI]
Mathias CJ, Wang S, Lee RJ, Waters DJ, Low PS, Green MA. Tumor-selective radiopharmaceutical targeting via receptor-mediated endocytosis of gallium-67-deferoxamine-folate.J Nucl Med. 1996;37:1003-1008.
[PubMed] [DOI]
Zhoug S, Wen SM, Zhang DF, Wang QL, Wang SQ, Ren H. Sequencing of PCR amplified HBV DNA pre-c and c regions in the 2.2.15 cells and antiviral action by targeted antisense oligonucleotide directed against sequence.World J Gastroenterol. 1998;4:434-436.
[PubMed] [DOI]
Guo J, Zhou YX, Yao ZQ, Wang SQ, Weng SM, Wang BC. Specific delivery to liver cells by asialoglycoprotein modified antisense oligodeoxynucleotides in vitro and in vivo.Zhonghua Chuanranbing Zazhi. 1997;15:16-19.
[PubMed] [DOI]
Dini L, Falasca L, Lentini A, Mattioli P, Piacentini M, Piredda L, Autuori F. Galactose-specific receptor modulation related to the onset of apoptosis in rat liver.Eur J Cell Biol. 1993;61:329-337.
[PubMed] [DOI]
Walton CM, Wu CH, Wu GY. A DNA delivery system containing listeriolysin O results in enhanced hepatocyte-directed gene expression.World J Gastroenterol. 1999;5:465-469.
[PubMed] [DOI]
Wu CH, Wilson JM, Wu GY. Targeting genes: delivery and persistent expression of a foreign gene driven by mammalian regulatory elements in vivo.J Biol Chem. 1989;264:16985-16987.
[PubMed] [DOI]
Baumhofer JM, Beinhauer BG, Wang JE, Brandmeier H, Geissler K, Losert U, Philip R, Aversa G, Rogy MA. Gene transfer with IL-4 and IL-13 improves survival in lethal endotoxemia in the mouse and ameliorates peritoneal macrophages immune competence.Eur J Immunol. 1998;28:610-615.
[PubMed] [DOI] [Full Text]
Biewenga J, van der Ende MB, Krist LF, Borst A, Ghufron M, van Rooijen N. Macrophage depletion in the rat after intraperitoneal administration of liposome-encapsulated clodronate: depletion kinetics and accelerated repopulation of peritoneal and omental macrophages by administration of Freund's adjuvant.Cell Tissue Res. 1995;280:189-196.
[PubMed] [DOI]
Guo J, Wang J. [Construction of mammalian expression plasmid of Flag-tagged rat collagenase and its in vitro transfection study].Zhonghua Ganzangbing Zazhi. 1999;7:226-229.
[PubMed] [DOI]
Huang Bei. In situ hybridization of tissues and cells. In: Qian W, editor. Modern medical experimental method. First ed. Beijing: People's Medical publishing House 1997.p 89-92.
.
[PubMed] [DOI]
Omar B, Thikkavarapu S, Roger P, John H. In situ hybridization and immunohistochemistry. In: Ausubel FM, Brent R, Kingston RE, Woore DD, seidman JG, Smith JA, Struhl K, editors. Short protocols in molecu lar Biology. 3rd ed. John Wiley and Sons, Inc 1995.p 539-586.
.
[PubMed] [DOI]
Kato K, Nakanishi M, Kaneda Y, Uchida T, Okada Y. Expression of hepatitis B virus surface antigen in adult rat liver. Co-introduction of DNA and nuclear protein by a simplified liposome method.J Biol Chem. 1991;266:3361-3364.
[PubMed] [DOI]
Hara T, Aramaki Y, Takada S, Koike K, Tsuchiya S. Receptor-mediated transfer of pSV2CAT DNA to mouse liver cells using asialofetuin-labeled liposomes.Gene Ther. 1995;2:784-788.
[PubMed] [DOI]
Zhang ZR, He Q. Study on liver targeting and hepatocytes permeable valaciclovir polybutylcyanoacrylate nanoparticles.World J Gastroenterol. 1999;5:330-333.
[PubMed] [DOI]
Chowdhury NR, Wu CH, Wu GY, Yerneni PC, Bommineni VR, Chowdhury JR. Fate of DNA targeted to the liver by asialoglycoprotein receptor-mediated endocytosis in vivo. Prolonged persistence in cytoplasmic vesicles after partial hepatectomy.J Biol Chem. 1993;268:11265-11271.
[PubMed] [DOI]
Mu JZ, Tang LH, Alpers DH. Asialoglycoprotein receptor mRNAs are expressed in most extrahepatic rat tissues during development.Am J Physiol. 1993;264:G752-G762.
[PubMed] [DOI]