Published online Dec 15, 1999. doi: 10.3748/wjg.v5.i6.470
Revised: September 9, 1999
Accepted: October 13, 1999
Published online: December 15, 1999
AIM: To analyse cumulative loss of heterozygosity (LOH) of ch romosomal regions and tumor suppressor genes in hepatocellular carcinomas (HCCs) from 20 southern African blacks.
METHODS: p53, RB1, BRCA1, BRCA2, WT1 and E-cadherin- ge nes were analysed for LOH, and p53 gene was also analysed for the codon 249 mutation, in tumor and adjacent non-tumorous liver tissues using molecular techniques and 10 polymorphic microsatellite markers.
RESULTS: p53 codon 249 mutation was found in 25% of the subjects, as was expected, because many patients were from Mozambique, a country wit h high aflatoxin B1 exposure. LOH was found at the RB1, BRCA2 and WT1 loci in 20%(4/20) of the HCCs, supporting a possible role of these genes in HCC. No LOH was evident in any of the remaining genes. Reports of mutations of p53 and RB1 genes in combination, described in other populations, were not confirmed in this study. Change in microsatellite repeat number was noted at 9/10 microsatellite loci in different HCCs, and changes at two or more loci were detected in 15%(3/20) of subjects.
CONCLUSION: We propose that microsatellite/genomic instability may play a role in the pathogenesis of a subset of HCCs in black Africans.
- Citation: Martins C, Kedda M, Kew M. Characterization of six tumor suppressor genes and microsatellite instability in hepatocellular carcinoma in southern African blacks. World J Gastroenterol 1999; 5(6): 470-476
- URL: https://www.wjgnet.com/1007-9327/full/v5/i6/470.htm
- DOI: https://dx.doi.org/10.3748/wjg.v5.i6.470
The evolution of cancer is thought to occur from the stepwise accumulation of ge netic aberrations in the same cell. These include loss of function of tumor supp ressor genes, activation of proto-oncogenes, faulty DNA mismatch repair, and the integration of viral DNA[1,2]. Hepatocellular carcinoma (HCC) is a leading cause of death in both Africa and the Far East, resulting in at least 310000 deaths worldwide each year[3]. HCC is multifactorial in aet iology and its pathogenesis is complex. The major risk factors involved in the development of the tumor are chronic HBV and HCV infections, cirrhosis and aflatoxin B1 (AFB) exposure[4,5].
Heavy dietary AFB intake is thought to cause a guanine (G) to thymine (T) transversion at the third base of codon 249 of the p53 gene, and for this reason clustering of this point mutation occurs in HCCs from Africa and China[6-8]. In addition, other mutations in, or deletions of, the p53 gene (on chromosome 17p13.1) are found with relatively high frequency in human HCCs in other countries. The functional loss of this tumor suppressor gene, as well as its abnormal expression, have been proposed to play a significant role in HCC development[9] or at least in the development of a subset of HCCs. The majority of p53 alterations reported to date have loss of one allele accompanied by mutations of the second allele[10]. Abnormalities of the p53 gene, such as gene mutation, deletion, or the nuclear accumulation of mutant p53 protein have also been found to correlate with increased allelic loss at the Breast Cancer Susceptibility Gene 1 (BRCA1) locus (17q21). This gene is thought to encode a transcription factor which acts as a tumor suppressor[11]. LOH of the BRCA1 gene in HCC was reported in a Korean study[12]. The Breast Cancer Susceptibility Gene 2 (BRCA2) (13q12-13) product is thought to be a tumor suppressor[13] involved in cellular proliferation and differentiation[14], and may be involved in the development of HCC[15]. LOH at the BRCA2 locus has been reported in HCC[15,16] and it has been suggested that mutations of the BRCA2 gene may be involved in hepatocarcinogenesis[15]. The retinoblastoma ( RB1 ) gene ( 13q14.2 ) product (pRB) functions as a cell cycle regulator[17], and its absence leads to unrestricted cell growth. Although there is no definite evidence that mutations of the RB gene are involved in HCC, LOH of the RB1 gene has been documented in human HCCs[18,12]. LOH of WT1 and 11p13 have been reported in human HCCs[12,16]. WT1 appears to be involved in proliferation, differentiation and apoptosis[19,20]. The product of the E-cadherin (Uvomorulin) gene (16q221) is the primary adhesion molecule in epithelium[21]. Loss of function of E-cadherin may lead to decreased cell-cell adhesion[22], cellular phenotypic changes, and the development of invasive properties[23]. In HCC, multicentric development and the formation of intrahepatic metastases is common[24]. LOH on chromosome 16q has been previously reported to be important in the initiation or progression of HCC[25,26].
Polymerase chain reaction (PCR) amplification of microsatellites (sequences uniformly distributed throughout the human genome) provides a simple and effective method of rapidly detecting loss of heterozygosity/microsatellite instability (LOH/MI)[27]. Microsatellite instability is defined as the loss or gain of microsatellite repeats at 2 or more loci and is detected by the presence of extra bands or band shifts between tumor and non-tumorous tissue DNA.
In this study, we examined the G-T transversion at codon 249 of the p53 gene, LOH of the p53, RB1, BRCA1, BRCA2, WT1 and E-cadherin genes, and micr osatellite instability at 10 loci flanking these genes, in HCC and adjacent non -tumorous liver, from 20 southern African blacks.
The subjects included 20 southern African black men, aged between 20 and 40 years. HCC tissue and matched non-tumorous liver were obtained at necropsy or during surgical resection. DNA was extracted from the tissues using a modified “salting-out” procedure[28].
The HBV status of the subjects was determined previously using commercially available kits to detect HBV markers in serum (Abbott Labs, Chicago, IL, USA).
Microsatellite instability (MI) and loss of heterozygosity (LOH) studies were carried out by PCR and gel electrophoresis using polymorphic repeat markers (Table 1).
| Gene/Locus | Primer | Primer sequence | Amplicon | Amplicon length |
| p53 | p53F3 | 5’GTTGGCTCTGACTGT-ACCAC | exon 7 spanning codon 249[6] | 110 bp |
| p53R3 | 5’CTGGAGTCTTCCAGT-GTGAT | |||
| p53 | p53ivs1a | 5’GCACTTTCCTCAACTCTACA | ALU sequence within intron 1 | 200 bp-300 bp |
| p53ivs1b | 5’AACAGCTCCTTTAATGGCAG | of p53 gene[43] | ||
| D13S120 | 1353L | 5’ATGACCTAGAAATGATACTGGC | (AC)73 repeat at D13S120[44] | 112 bp-136 bp |
| (BRCA2) | 1353R | 5’CAGACACCACAACACACATT | ||
| D17S846 | FF | 5’TGCATACCTGTACTACTTCAG | (GGAA)25 repeat at D17S846[45] | 250 bp-300 bp |
| (BRCA1) | RF | 5’TCCTTTGTTGCAGATTTCTTC | ||
| D17S855 | FS | 5’GGATGGCCTTTTAGAAAGTGG | AC repeat at D17S855[46] | 145 bp |
| (BRCA1) | RS | 5’ACACAGACTTGTCCTACTGCC | ||
| WT1 | 400 | 5’AATGAGACTTACTGGGTGAGG | AC repeat within 3’ untranslated | 100 bp-200 bp |
| 401 | 5’TTACACAGTAATTTCAAGCAACGG | sequence of WT33[47] | ||
| RB1 | B57 | 5’TGTATCGGCTAGCCTATCTC | [CTTT(T)]n (n = 14-26) repeat | 400 bp-600 bp |
| B103 | 5’AATTAACAAGGTGTGGTGGT | within intron 20 of RB gene[48,49] | ||
| D13S127 | 1341L | 5’CAGATATGTACTCATGCACATG | (AC)35 repeat at D13S127[44] | 130 bp-142 bp |
| (BRCA2/RB1) | 1341R | 5’AAACAAATGAGTTTGGCTGT | ||
| D13S137 | F | 5’TTTCCTCATTCTTTCCCAATTG | (GT)22 repeat at D13S137[50] | ± 135 bp |
| (RB1) | R | 5’CAGGAGGGATGGACTCACTTC | ||
| E-cadherin | E-cadF1 | 5’GATCCTAAGGACAAATGTAGATGCTCT | D16S301 locus polymorphic | 146 bp |
| E-cadF1 | 5’AGCCACTTCCCAGAACTTGGCTTCC | AC region[51] | ||
| E-cadherin | E-cadF2 | 5’GGTTGAGATGCTGACATGC | D16S260 locus polymorphic | ± 234 bp |
| E-cadR2 | 5’CAGGGTGGCTGTTATAATG | AC repeat region[52] |
PCR products of the polymorphic loci p53, D17S846 and RB1.20 were resolved on 4% composite agarose gels, while radioactively labeled PCR products of the remaining loci were resolved on polyacrylamide gels, and viewed by autoradiography. Band mobility shifts between tumor and matched non-tumorous liver DNA were scored as a change in allele repeat number. LOH was characterized by the disappearance of one band or a considerable (£¾80%) decrease in band intensity in heterozygotes, whilst microsatellite instability was determined by expansion and/or contraction of microsatellite sequences.
A standard PCR protocol (primers, Table 1) was followed for the p53, WT1, D1 3S137, RB(1.20), D13S120, D13S127, D17S855, and D17S846 loci. Each PCR reaction consisted, at final volume, of 100 ng DNA, 1 U Taq DNA polymerase (Promega, Madison, USA), 1 × buffer, 1 mM each dATP, dTTP, dGTP, 0.1 mM dCTP, 0.025 µCi α32P dCTP, and 50 pmol of each pr imer; in a total volume of 50 µL, amplification for 30 cycles of denaturation at 94 °C for 30 s, annealing 55 °C for 30 s, extension at 72 °C for 1 min, and a final cycle of 72 °C for 10 min.
The PCR reaction for the D16S301 and D16S260 loci (primers, Table 1) consisted, at final volume, of 100 ng DNA, 1 U Taq- DNA Polymerase, 1 × buffer, 0.1% gelatin, 1 mM each dGTP, dATP, dTTP, 0.1 mM dCTP, and 0.025 µCi α32P dCTP, 50 pmol of each primer; in a total volume of 25 µL, amplification for 25 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 2 min, extension at 72 °C for 2.5 min, and a final cycle of 72 °C for 10 min.
The p53 codon 249 mutation was detected by PCR-RFLP using primer sequences F3 and R3 (Table 1), and confirmed by sequence analysis. The PCR reaction consisted of, at final volume[6], 100 ng DNA, 2.5U of Taq-DNA polymerase (Promega), 1 × buffer, 1mM MgCl2, 0.8 mM each of dCTP, dATP, dGTP, dTTP, and 50 pmol of each primer; in a total volume of 50 µL, amplification for 30 cycles of denaturation at 94 °C for 15 s, annealing at 56 °C for 15 s, and extension at 72 °C for 30 s. The 110 bp PCR product was sized on ethidium bromide stained agarose gels against a 100 bp DNA ladder (Promega). AG to T transversion at the third base of codon 249 was detected by the presence or absence of a HaeIII restriction site[6]. All samples shown by digestion to have the codon 249 mutation were sequenced in both directions both upstream and downstream in separate reactions, to confirm the presence of the mutation.
All sequencing was carried out using the Sequenase PCR Product Sequencing Kit (United States Biochemical Corp., Cleveland, Ohio), according to the manufacturer’s instructions.
Seven patients were currently infected with HBV (5 of these were HBsAg-positive ; HBeAg-negative; the HBeAg status of the remaining 2 was unknown), and 6 were previously infected (anti-HBc and anti-HBs-positive). The HBV status of the remaining patients was not known (Table 2).
| Subject number | VNTRs | p53 codon 249 | HBV status | ||||||||||
| p53 | WT1 | RB1 | BRCA2 | BRCA1 | E-cadherin | ||||||||
| (ALU) | (AC) | D13S137 (GT)22 | RB1.20 [CTTT(T)]n | D13S120 (AC)73 | D13S127 (AC)35 | D17S855 (AC) | D17S846 (GGAA)25 | D16S301 (AC) | D16S260 (AC) | T | NT | ||
| 1 | NI | NI | - | - | - | NI | - | - | - | NI | -/- | -/- | HBsAg+; HBeAg- |
| 2 | - | - | - | - | - | NI | - | - | - | NI | -/- | -/- | HBsAg+ |
| 3 | - | - | - | - | - | - | - | - | NI | - | +/- | -/- | HBsAg+; HBeAg- |
| 4 | - | - | - | NI | - | - | ? | NI | - | - | -/- | -/- | anti-HBc+; anti-HBs+ |
| 6 | - | ? | ? | ? | - | NI | ? | - | ? | - | +/- | -/- | HBsAg+; HBeAg- |
| 7 | ? | ? | ? | ? | - | - | ? | ? | - | - | -/- | -/- | anti-HBs+; anti-HBc+ |
| 8 | ↑ | △ | NI | + | ↓ | ↓ | △ | △ | ↑ | - | +/- | -/- | anti-HBs+; anti-HBc+ |
| 14 | - | NI | ? | NI | - | + | - | ? | ? | NI | -/- | -/- | anti-HBs+; anti-HBc+ |
| 16 | ? | ? | △ | ? | + | + | ? | ? | △ | ↑ | -/- | -/- | HBsAg+ |
| 18 | ↑ | + | ? | ? | ↑ | - | ? | ? | ? | ↑ | -/- | -/- | HBsAg+; HBeAg- |
| 24 | NI | - | NI | - | - | - | - | - | NI | - | -/- | +/- | anti-HBs+; anti-HBc+ |
| 39 | - | NI | - | ? | - | - | - | NI | ? | - | -/- | -/- | HBsAg+; HBeAg- |
| 40 | NI | - | ? | - | - | NI | - | - | ? | - | -/- | -/- | anti-HBs+; anti-HBc+ |
| 48 | NI | - | - | - | - | - | - | - | ? | ? | -/- | -/- | ? |
| 50 | NI | - | - | NI | - | - | - | NI | - | NI | -/- | -/- | ? |
| 51 | NI | - | ? | NI | - | NI | - | - | - | - | -/- | -/- | ? |
| 52 | NI | - | NI | - | - | NI | - | - | - | - | +/- | -/- | ? |
| 53 | - | - | - | - | - | - | - | - | NI | - | -/- | -/- | ? |
| 54 | - | ? | - | - | - | - | - | - | - | NI | -/- | -/- | ? |
| 56 | NI | - | - | NI | - | - | - | NI | NI | NI | -/- | -/- | ? |
LOH was noted for the WT1 (1/13 subjects), RB (1.20) ( 1/10 subjects ), D13S120 ( 1/20 subjects ) and D13S127 (2/14 subjects) loci (Table 2).
The D13S137 and D13S127 loci flank the RB1 gene, while the RB (1.20) repeat sequence is within intron 20 of the same gene. LOH at the D13S127 locus suggests loss of at least a portion of the RB1 gene as shown in 2/14 informative subjects. LOH at RB (1.20) indicated loss of the RB1 gene in a further 1/10 informative subjects. The RB1 gene was thus lost in 3/18 informative subjects (Table 2). LOH at the D13S120 and D13S127 loci flanking the BRC A2- gene was shown in 2/20 informative subjects (Table 2). No LOH was found for any of the remaining loci (Table 2).
Microsatellite/genomic instability ( or again/loss of microsatellite repeats ) was found in 15% (3/20) of subjects.
The p53 codon 249 mutation was detected in 25% of the subjects using PCR-RFLP analysis, and confirmed by sequencing. The p53 codon 249 mutation was det ected in the tumor tissue of 3 subjects, in the non-tumorous liver of 1 subject, and in both the tumor and non-tumorous liver tissue of 1 subject (Table 2).
Sequencing gel electrophoresis of the p53 gene product revealed a gel artifact, in all subjects with wild-type chromosomes, previously described by Kapelner et al (1994).
All tumors were at an advanced stage. No attempt was made to correlate the presence of LOH or microsatellite instability with clinical or other features.
LOH of the p53 gene has been reported with relatively high frequency in HCCs from Japan (29%-69%)[29,30], and also from southern Africa (60%), an d Taiwan (39.3%)[6,31]. No LOH was detected for p53 in this study, although inactivation/ reduction of p53 gene expression or of its product by means other than LOH may have occurred in our population. In a study by Walker et al (1991), p53 allele loss occurred only in HBV-negative tumors. It thus appeared as if a mechanism other than loss of one p53 allele and mutati on of the second allele was operating in HBV-positive tumors, thereby eliminati ng fully functional p53 protein. The obvious mechanism would be the formation of complexes between wild-type p53 protein and viral protein/s leading to the loss of function of wild-type p53 protein. Such associations have been well docume nted in the literature[32]. In our study most samples were HBV positive and a mechanism such as that mentioned above, rather than p53 gene inactivation by physical mutation and LOH, may have been operating in our tumors to eliminate the function of the p53 protein. Alternatively, should both alleles of t he p53 gene be mutated in ways other than LOH in our samples, such as point mutations and small deletions ( < 50 bp )[18], these would not have been detected by the techniques employed in this study.
The p53 codon 249 mutation was detected in 25% (5/20) subjects. This was expected as the subjects were southern African blacks, some of whom came from Mozambique and other areas where aflatoxin exposure is prevalent. The p53 codon 249 mutation was found in both tumor and non-tumorous liver tissues of one subject. This could have been caused by contamination of the non-tumorous liver with tumor tissue. In another subject the mutation was detected in the non-tumorous liver only. The presence of this mutation has been documented in non-tumorous liver and not in the corresponding tumor tissues[33], where it was proposed that normal liver subjected to prolonged aflatoxin exposure could gradually accumulate high levels of AGT mutations, whereas the mutation would not necess a rily arise in neoplastic populations that were cloned from single progenitor cells resistant to aflatoxin. Unfortunately, insufficient tissue was available in these two patients for histopathological examination, so we cannot exclude microscopic contamination as a cause of this finding in the two subjects. Two patients with a codon 249 G→T transversion were HBsAg positive, 2 subjects were anti-HBs/anti-HBc positive and the HBV status of 1 subject was unknown. This concur red with previous studies where mutations at codon 249 were not found in non-HB V-related HCCs[34], and is in agreement with previous work which suggests that both aflatoxin exposure and HBV infection are required for this mutation to occur[29,33].
A gel artefact generated by formation of a mini hairpin secondary structure in the codon 249 region of the p53 gene in 34 wild type chromosomes, lead to a “missing” G at the third base of codon 249 in the sequence of the sense strand[35]. In a study by Kapelner et al (1994), as with our samples, Hae-III digest confirmed the presence of the recognition sequence GGCC. However, since there has been no other report of this “G deletion” in such a commonly sequenced region, Kapelner et al (1994) suggested that this artifact may not occur often.
LOH appears to have occurred in 4 subjects at the RB1 (3/18 ro 17%), BRCA2 (2/20 or 10%) and WT1 (1/13 or 8%) loci (2 of these subjects had LO H at both the RB1 and BRCA2 genes). Although reduction to homozygosity h as been apparent in certain individuals, and has consistently been scored as LOH, ‘band disappearance’ may also be caused by a gain/loss in microsatellite repeats. We think, however, that this is unlikely to be the case in so many indiv iduals.
LOH of the retinoblastoma gene has been documented in 33% of HCCs from Korea[12], 16%-73% of HCCs from Japan[18,30]and 27% of HCCs from Austra lia[36]. One copy of the RB1 gene was lost in 17% (3/18) of HCCs in this study. Although our sample is small, this frequency differs from the higher percentages found thus far. This may reflect population differences, LOH of t he RB1 gene may play a role in a small subset of southern African HCCs. Coin cident mutation of the p53 and RB1 genes has been observed in 25%[18], and 12.9%[37] of advanced HCCs in Japan and Australia respectively[36]. Mutations and LOH in these genes is most frequently observed in advanced stage HCCs, like those investigated here. However, no coincident mutati on of these genes was detected in this study.
LOH of the BRCA2 gene has been reported in 3% of Japanese HCCs[15], and in 40% of HCCs from the USA[16]. In this study one copy of the BRCA2 gene was lost in 10% (2/20) HCCs. This finding supports the notion that BRCA2 may function as a tumor suppressor gene in the liver[15], and that it may in some way be involved in the progression of a small number of HCCs. To our knowledge, LOH of the BRCA1 gene has been reported only once, in a study in which 11.5% (3/6) of HCCs showed LOH at this locus[12]. No LOH was found for this gene in our sample population. LOH at 11p13, the region containing the WT1 gene, as well as LOH of the gene itself has been reported in 4%-7% HCCs[12,16]. Our result of 8% (1/13) LOH agrees with these findings. LOH of the region where the E-cadherin gene is located (16q22) has been reported in 64%-91% of Chinese and Japanese HCCs[25,26]. No LOH w as found for this gene in our study. Although all the HCCs used in this study were in advanced stages, it was not established whether they were highly undifferentiated. There may be retention of E-cadherin expression in these samples and no loss of intercellular adhesiveness.
We cannot say whether HBV played any role in the chromosome losses reported here[37]. Cumulative LOH is thought to reflect the sequential development of HCC progression.
LOH of a number of tumor suppressor genes may be important in the advancement of HCC[37]. Frequent loss of tumor suppressor genes has been reported in Korean HCCs, where 86% HCCs had LOH of 1 gene, and 59% had LOH of 2 - 4 genes[12]. Piao et al (1997), investigated 10 tumor suppressor genes (-VHL, APC, EXT1, WT1, RB1, p53, BRCA1, nm23, DPC4, DCC). The genes most often lost were p53 (66%), RB1 (33%), EXT1 (33%), and APC (20%). The genes found to be lost most often in our study were RB1 (17%) and BRCA2 (10%). However, as the total LOH of the p53, RB1, BRCA1, BRCA2, WT1 and E-cadherin genes in this study was 20% (4/20), we conclude that LOH of tumor suppre ssor genes is infrequent in our HCCs.
Microsatellite/genomic instability is reflected in the expansion/contraction of microsatellite sequences, and is thought to be a product of replication errors[38]. Microsatellite instability has been considered to be insignificant in HCC development by some authors, while others believe that it may be significant[39]. To our knowledge, this is the first time microsatellite instability has been looked at in HCCs from a southern African black population. It is important to note that there are differences in allele frequency between our so uthern African Negroid population and the Asian, European and Australian populat i ons, characterized previously at the WT1, D13S137, D13S120, D13S127, D17S855 , D16S301, and D16S260 loci (paper in preparation ). Microsatellite instability has been documented in 40% of HCCs from the USA[39], and in 41% of HCCs at two or more loci in a French study[40]. In a Korean study microsatellite instability was detected in 4/10 ( 40% ) HCCs, where each subject showed inst ability at two or more loci[39]. Of the 9 markers used in their study, 3 showed genetic instability in one or more subjects. In our study 3/20 (15%) H CCs showed instability at two or more loci. Of the 10 loci investigated, 9 showed genetic instability in one or more subjects. Cumulative microsatellite in stability indicates advanced HCC. One of these subjects also had the codon 249 mutation in the p53 gene. We were not able to determine whether joint changes at the loci were necessary for tumor development, or whether they represented independent events in tumor initiation and/or progression. Microsatellite/ genomic instability is believed to occur at random and may reflect alteration of the entire genome of the cancer cell[41]. The order of these changes is most likely insignificant. Their cumulative effect however, may be important[42]. We propose that microsatellite/genomic instability may play a role only in a small subset of HCC in our population.
In conclusion, our observations support a possible role of p53, WT1 and BRCA2 genes in the pathogenesis of HCC, and that microsatellite instability appears to be an important factor contributing to HCC development in a subset of our HCCs.
| 1. | Yee CJ, Roodi N, Verrier CS, Parl FF. Microsatellite instability and loss of heterozygosity in breast cancer. Cancer Res. 1994;54:1641-1644. [PubMed] |
| 2. | Fujimoto Y, Kohgo Y. [Alteration of genomic structure and/or expression of cancer associated genes in hepatocellular carcinoma]. Rinsho Byori. 1998;46:9-14. [PubMed] |
| 3. | Parkin DM, Stjernswärd J, Muir CS. Estimates of the worldwide frequency of twelve major cancers. Bull World Health Organ. 1984;62:163-182. [PubMed] |
| 4. | Harris CC. Hepatocellular carcinogenesis: recent advances and speculations. Cancer Cells. 1990;2:146-148. [PubMed] |
| 5. | Saito I, Miyamura T, Ohbayashi A, Harada H, Katayama T, Kikuchi S, Watanabe Y, Koi S, Onji M, Ohta Y. Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc Natl Acad Sci USA. 1990;87:6547-6549. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 846] [Cited by in RCA: 813] [Article Influence: 22.6] [Reference Citation Analysis (1)] |
| 6. | Bressac B, Kew M, Wands J, Ozturk M. Selective G to T mutations of p53 gene in hepatocellular carcinoma from southern Africa. Nature. 1991;350:429-431. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1020] [Cited by in RCA: 841] [Article Influence: 24.0] [Reference Citation Analysis (0)] |
| 7. | Hsu IC, Metcalf RA, Sun T, Welsh JA, Wang NJ, Harris CC. Mutational hotspot in the p53 gene in human hepatocellular carcinomas. Nature. 1991;350:427-428. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1120] [Cited by in RCA: 933] [Article Influence: 26.7] [Reference Citation Analysis (3)] |
| 8. | Scorsone KA, Zhou YZ, Butel JS, Slagle BL. p53 mutations cluster at codon 249 in hepatitis B virus-positive hepatocellular carcinomas from China. Cancer Res. 1992;52:1635-1638. [PubMed] |
| 9. | Bressac B, Galvin KM, Liang TJ, Isselbacher KJ, Wands JR, Ozturk M. Abnormal structure and expression of p53 gene in human hepatocellular carcinoma. Proc Natl Acad Sci USA. 1990;87:1973-1977. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 318] [Cited by in RCA: 310] [Article Influence: 8.6] [Reference Citation Analysis (0)] |
| 10. | Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P. Mutations in the p53 gene occur in diverse human tumour types. Nature. 1989;342:705-708. [PubMed] |
| 11. | Smith SA, Easton DF, Evans DG, Ponder BA. Allele losses in the region 17q12-21 in familial breast and ovarian cancer involve the wild-type chromosome. Nat Genet. 1992;2:128-131. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 290] [Cited by in RCA: 263] [Article Influence: 7.7] [Reference Citation Analysis (0)] |
| 12. | Piao Z, Kim H, Jeon BK, Lee WJ, Park C. Relationship between loss of heterozygosity of tumor suppressor genes and histologic differentiation in hepatocellular carcinoma. Cancer. 1997;80:865-872. [PubMed] |
| 13. | Gudmundsson J, Johannesdottir G, Bergthorsson JT, Arason A, Ingvarsson S, Egilsson V, Barkardottir RB. Different tumor types from BRCA2 carriers show wild-type chromosome deletions on 13q12-q13. Cancer Res. 1995;55:4830-4832. [PubMed] |
| 14. | Rajan JV, Marquis ST, Gardner HP, Chodosh LA. Developmental expression of Brca2 colocalizes with Brca1 and is associated with proliferation and differentiation in multiple tissues. Dev Biol. 1997;184:385-401. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 122] [Cited by in RCA: 106] [Article Influence: 3.7] [Reference Citation Analysis (1)] |
| 15. | Katagiri T, Nakamura Y, Miki Y. Mutations in the BRCA2 gene in hepatocellular carcinomas. Cancer Res. 1996;56:4575-4577. [PubMed] |
| 16. | Wang HP, Rogler CE. Deletions in human chromosome arms 11p and 13q in primary hepatocellular carcinomas. Cytogenet Cell Genet. 1988;48:72-78. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 118] [Cited by in RCA: 106] [Article Influence: 2.8] [Reference Citation Analysis (1)] |
| 17. | Hsia CC, Di Bisceglie AM, Kleiner DE, Farshid M, Tabor E. RB tumor suppressor gene expression in hepatocellular carcinomas from patients infected with the hepatitis B virus. J Med Virol. 1994;44:67-73. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 21] [Cited by in RCA: 18] [Article Influence: 0.6] [Reference Citation Analysis (0)] |
| 18. | Murakami Y, Hayashi K, Hirohashi S, Sekiya T. Aberrations of the tumor suppressor p53 and retinoblastoma genes in human hepatocellular carcinomas. Cancer Res. 1991;51:5520-5525. [PubMed] |
| 19. | Evans RM, Hollenberg SM. Zinc fingers: gilt by association. Cell. 1988;52:1-3. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 561] [Cited by in RCA: 571] [Article Influence: 15.0] [Reference Citation Analysis (1)] |
| 20. | Menke AL, Shvarts A, Riteco N, van Ham RC, van der Eb AJ, Jochemsen AG. Wilms' tumor 1-KTS isoforms induce p53-independent apoptosis that can be partially rescued by expression of the epidermal growth factor receptor or the insulin receptor. Cancer Res. 1997;57:1353-1363. [PubMed] |
| 21. | Shimoyama Y, Hirohashi S, Hirano S, Noguchi M, Shimosato Y, Takeichi M, Abe O. Cadherin cell-adhesion molecules in human epithelial tissues and carcinomas. Cancer Res. 1989;49:2128-2133. [PubMed] |
| 22. | Takeichi M. Cadherins: a molecular family important in selective cell-cell adhesion. Annu Rev Biochem. 1990;59:237-252. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1008] [Cited by in RCA: 921] [Article Influence: 25.6] [Reference Citation Analysis (0)] |
| 23. | Behrens J, Mareel MM, Van Roy FM, Birchmeier W. Dissecting tumor cell invasion: epithelial cells acquire invasive properties after the loss of uvomorulin-mediated cell-cell adhesion. J Cell Biol. 1989;108:2435-2447. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 687] [Cited by in RCA: 681] [Article Influence: 18.4] [Reference Citation Analysis (1)] |
| 24. | Nagao T, Inoue S, Yoshimi F, Sodeyama M, Omori Y, Mizuta T, Kawano N, Morioka Y. Postoperative recurrence of hepatocellular carcinoma. Ann Surg. 1990;211:28-33. [PubMed] |
| 25. | Slagle BL, Zhou YZ, Birchmeier W, Scorsone KA. Deletion of the E-cadherin gene in hepatitis B virus-positive Chinese hepatocellular carcinomas. Hepatology. 1993;18:757-762. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 52] [Cited by in RCA: 50] [Article Influence: 1.5] [Reference Citation Analysis (1)] |
| 26. | Tsuda H, Zhang WD, Shimosato Y, Yokota J, Terada M, Sugimura T, Miyamura T, Hirohashi S. Allele loss on chromosome 16 associated with progression of human hepatocellular carcinoma. Proc Natl Acad Sci USA. 1990;87:6791-6794. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 203] [Cited by in RCA: 198] [Article Influence: 5.5] [Reference Citation Analysis (0)] |
| 27. | Weissenbach J, Gyapay G, Dib C, Vignal A, Morissette J, Millasseau P, Vaysseix G, Lathrop M. A second-generation linkage map of the human genome. Nature. 1992;359:794-801. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1142] [Cited by in RCA: 1093] [Article Influence: 32.1] [Reference Citation Analysis (0)] |
| 28. | Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 14830] [Cited by in RCA: 14259] [Article Influence: 375.2] [Reference Citation Analysis (6)] |
| 29. | Oda T, Tsuda H, Scarpa A, Sakamoto M, Hirohashi S. p53 gene mutation spectrum in hepatocellular carcinoma. Cancer Res. 1992;52:6358-6364. [PubMed] |
| 30. | Fujimoto Y, Hampton LL, Wirth PJ, Wang NJ, Xie JP, Thorgeirsson SS. Alterations of tumor suppressor genes and allelic losses in human hepatocellular carcinomas in China. Cancer Res. 1994;54:281-285. [PubMed] |
| 31. | Slagle BL, Zhou YZ, Butel JS. Hepatitis B virus integration event in human chromosome 17p near the p53 gene identifies the region of the chromosome commonly deleted in virus-positive hepatocellular carcinomas. Cancer Res. 1991;51:49-54. [PubMed] |
| 32. | Wang XW, Forrester K, Yeh H, Feitelson MA, Gu JR, Harris CC. Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3. Proc Natl Acad Sci USA. 1994;91:2230-2234. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 486] [Cited by in RCA: 466] [Article Influence: 14.6] [Reference Citation Analysis (2)] |
| 33. | Kirby GM, Batist G, Fotouhi-Ardakani N, Nakazawa H, Yamasaki H, Kew M, Cameron RG, Alaoui-Jamali MA. Allele-specific PCR analysis of p53 codon 249 AGT transversion in liver tissues from patients with viral hepatitis. Int J Cancer. 1996;68:21-25. [PubMed] [DOI] [Full Text] |
| 34. | Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human cancers. Science. 1991;253:49-53. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 5804] [Cited by in RCA: 5339] [Article Influence: 152.5] [Reference Citation Analysis (4)] |
| 35. | Kapelner SN, Turner RT, Sarkar G, Bolander ME. Deletion mutation can be an unsuspected gel artifact. Biotechniques. 1994;17:64, 66-67. [PubMed] |
| 36. | Walker GJ, Hayward NK, Falvey S, Cooksley WG. Loss of somatic heterozygosity in hepatocellular carcinoma. Cancer Res. 1991;51:4367-4370. [PubMed] |
| 37. | Yumoto Y, Hanafusa T, Hada H, Morita T, Ooguchi S, Shinji N, Mitani T, Hamaya K, Koide N, Tsuji T. Loss of heterozygosity and analysis of mutation of p53 in hepatocellular carcinoma. J Gastroenterol Hepatol. 1995;10:179-185. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 53] [Cited by in RCA: 50] [Article Influence: 1.6] [Reference Citation Analysis (0)] |
| 38. | Gao X, Zacharek A, Salkowski A, Grignon DJ, Sakr W, Porter AT, Honn KV. Loss of heterozygosity of the BRCA1 and other loci on chromosome 17q in human prostate cancer. Cancer Res. 1995;55:1002-1005. [PubMed] |
| 39. | Kazachkov Y, Yoffe B, Khaoustov VI, Solomon H, Klintmalm GB, Tabor E. Microsatellite instability in human hepatocellular carcinoma: relationship to p53 abnormalities. Liver. 1998;18:156-161. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 23] [Cited by in RCA: 22] [Article Influence: 0.8] [Reference Citation Analysis (0)] |
| 40. | Salvucci M, Lemoine A, Azoulay D, Sebagh M, Bismuth H, Reyns M, May E, Debuire B. Frequent microsatellite instability in post hepatitis B viral cirrhosis. Oncogene. 1996;13:2681-2685. [PubMed] |
| 41. | Li C, Larsson C, Futreal A, Lancaster J, Phelan C, Aspenblad U, Sundelin B, Liu Y, Ekman P, Auer G, Bergerheim US. Identification of two distinct deleted regions on chromosome 13 in prostate cancer. Oncogene. 1998;16:481-487. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 74] [Cited by in RCA: 64] [Article Influence: 2.3] [Reference Citation Analysis (0)] |
| 42. | Butel JS, Lee TH, Slagle BL. Is the DNA repair system involved in hepatitis-B-virus-mediated hepatocellular carcinogenesis. Trends Microbiol. 1996;4:119-124. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 22] [Cited by in RCA: 21] [Article Influence: 0.7] [Reference Citation Analysis (0)] |
| 43. | Futreal PA, Barrett JC, Wiseman RW. An Alu polymorphism intragenic to the TP53 gene. Nucleic Acids Res. 1991;19:6977. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 64] [Cited by in RCA: 74] [Article Influence: 2.1] [Reference Citation Analysis (0)] |
| 44. | Bowcock A, Osborne-Lawrence S, Barnes R, Chakravarti A, Washington S, Dunn C. Microsatellite polymorphism linkage map of human chromosome 13q. Genomics. 1993;15:376-386. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 33] [Cited by in RCA: 33] [Article Influence: 1.0] [Reference Citation Analysis (0)] |
| 45. | Flejter WL, Kukowska-Latallo JF, Kiousis S, Chandrasekharappa SC, King SE, Chamberlain JS. Tetranucleotide repeat polymorphism at D17S846 maps within 40 kb of GAS at 17q12-q22. Hum Mol Genet. 1993;2:1080. [PubMed] |
| 46. | Anderson LA, Friedman L, Osborne-Lawrence S, Lynch E, Weissenbach J, Bowcock A, King MC. High-density genetic map of the BRCA1 region of chromosome 17q12-q21. Genomics. 1993;17:618-623. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 63] [Cited by in RCA: 61] [Article Influence: 1.8] [Reference Citation Analysis (0)] |
| 47. | Haber DA, Buckler AJ, Glaser T, Call KM, Pelletier J, Sohn RL, Douglass EC, Housman DE. An internal deletion within an 11p13 zinc finger gene contributes to the development of Wilms' tumor. Cell. 1990;61:1257-1269. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 429] [Cited by in RCA: 398] [Article Influence: 11.1] [Reference Citation Analysis (0)] |
| 48. | Henson JW, Schnitker BL, Correa KM, von Deimling A, Fassbender F, Xu HJ, Benedict WF, Yandell DW, Louis DN. The retinoblastoma gene is involved in malignant progression of astrocytomas. Ann Neurol. 1994;36:714-721. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 167] [Cited by in RCA: 148] [Article Influence: 4.6] [Reference Citation Analysis (0)] |
| 49. | Yandell DW, Dryja TP. Detection of DNA sequence polymorphisms by enzymatic amplification and direct genomic sequencing. Am J Hum Genet. 1989;45:547-555. [PubMed] |
| 50. | Petrukhin KE, Speer MC, Cayanis E, Bonaldo MF, Tantravahi U, Soares MB, Fischer SG, Warburton D, Gilliam TC, Ott J. A microsatellite genetic linkage map of human chromosome 13. Genomics. 1993;15:76-85. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 29] [Cited by in RCA: 26] [Article Influence: 0.8] [Reference Citation Analysis (0)] |
| 51. | Thompson AD, Shen Y, Holman K, Sutherland GR, Callen DF, Richards RI. Isolation and characterisation of (AC)n microsatellite genetic markers from human chromosome 16. Genomics. 1992;13:402-408. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 54] [Cited by in RCA: 54] [Article Influence: 1.6] [Reference Citation Analysis (0)] |
| 52. | Weber JL, Kwitek AE, May PE. Dinucleotide repeat polymorphisms at the D16S260, D16S261, D16S265, D16S266, and D16S267 loci. Nucleic Acids Res. 1990;18:4034. [PubMed] |
Supported in part by grants/bursaries from the University of the Witwatersrand, and the Foundation for Research Development, Pretoria, South Africa.
Edited by Jing-Yun Ma