Robot-assisted massage is associated with improved duodenal barrier-related outcomes in a rabbit model of functional dyspepsia

Abstract

BACKGROUND

Functional dyspepsia (FD) is associated with impaired gastroduodenal motility, duodenal low-grade inflammation, and epithelial barrier dysfunction. Standardization of massage pressure remains a methodological challenge, and the pressure-response characteristics of robot-assisted massage, particularly in relation to duodenal barrier-associated outcomes, remain insufficiently characterized.

AIM

To compare the effects of three standardized robot-assisted massage pressure levels on gastrointestinal motility and duodenal barrier-related outcomes in an FD-like rabbit model and to characterize associated changes in myosin light chain kinase (MLCK)/phosphorylated myosin light chain (p-MLC)/E-cadherin-related molecular markers.

METHODS

In this randomized controlled animal pressure-response study, 50 New Zealand White rabbits were randomized to control, model, light-pressure, medium-pressure, and heavy-pressure groups (n = 10 each). An FD-like phenotype was induced using sucrose-iodoacetamide administration combined with irregular feeding. Robot-assisted massage was applied at Zhongwan (CV12) and bilateral Tianshu (ST25) once daily for 10 consecutive days. Body weight and food intake, gastrointestinal transit, duodenal histology and ultrastructure, serum biomarkers, quantitative polymerase chain reaction, Western blotting, and immunofluorescence were assessed.

RESULTS

Compared with the control group (C group), the model group (M group) showed lower body weight and food intake and reduced gastric emptying rate (38.76% ± 4.88% vs 74.21% ± 5.67%, P < 0.001) and small intestinal propulsion rate (42.94% ± 4.93% vs 67.56% ± 5.74%, P < 0.001). Among the intervention groups, gastric emptying rate was 55.13% ± 5.21%, 65.84% ± 5.09%, and 34.21% ± 4.35% in the light-pressure group (LP group), the medium-pressure group (MP group), and the heavy-pressure group (HP group), respectively, while small intestinal propulsion rate was 55.06% ± 5.24%, 60.48% ± 5.11%, and 36.05% ± 4.68%, respectively. The LP group and particularly the MP group improved both outcomes compared with the M group (P < 0.001), whereas the HP group was inferior to the M group for small intestinal propulsion rate (P < 0.05). Similar pressure-dependent patterns were observed in mucosal morphology, ultrastructure, inflammatory and barrier-related markers, and MLCK/p-MLC/E-cadherin-associated molecular measurements. The MP group showed the broadest favorable pattern across body weight, food intake, gastrointestinal motility, mucosal morphology and ultrastructure, serum inflammatory and barrier-related markers, and MLCK/p-MLC/E-cadherin-associated molecular measurements, with statistically significant improvements in several quantitative outcomes compared with the M group (P < 0.05). The LP group showed a more limited pattern of improvement, whereas the HP group showed no consistent benefit and several adverse changes. Across the three tested pressure settings, the overall response pattern appeared non-monotonic; however, no formal dose-response model was fitted.

CONCLUSION

Robot-assisted massage was associated with improved gastrointestinal motility and duodenal barrier-related outcomes in an FD-like rabbit model, with medium pressure producing the most favorable overall response. These changes were accompanied by alterations in MLCK, p-MLC, E-cadherin, and junctional proteins.

Key Words: Functional dyspepsia; Robot-assisted massage; Gastrointestinal motility; Rabbit model; Duodenal epithelial barrier; Tight junctions; Mechanical pressure

Core Tip: This study standardized robot-assisted massage pressure and showed a pressure-response pattern that was not monotonic across the three tested pressure levels in a functional dyspepsia-like rabbit model. Medium-pressure produced the most consistent improvements in body weight, food intake, gastrointestinal motility, duodenal structural integrity, inflammatory and barrier-related markers, and epithelial junction-associated proteins, whereas light-pressure produced less consistent improvements and heavy-pressure showed no consistent benefit, with unfavorable changes in several outcomes. These responses were accompanied by changes in myosin light chain kinase, phosphorylated myosin light chain, E-cadherin, and junctional proteins; however, these expression changes do not establish causal mediation through the myosin light chain kinase/phosphorylated myosin light chain/E-cadherin pathway.

INTRODUCTION

Functional dyspepsia (FD) is a common disorder of gut-brain interaction characterized by postprandial fullness, early satiety, epigastric pain, and epigastric burning, and it markedly impairs quality of life[1]. Epidemiological data based on the Rome IV criteria indicate an overall adult prevalence of approximately 7.2%, reflecting a substantial disease burden and public health impact[1]. A recent clinical study also demonstrated impaired quality of life in patients with FD[2]. Recent human studies have further identified duodenal mucosal immune activation, epithelial barrier vulnerability, and alterations in the duodenal microbiota in FD[3-5]. Notably, duodenal mucosal vulnerability has been observed specifically in patients with epigastric pain syndrome[4], and alterations in the duodenal microbiota have also been associated with gastric emptying and symptom burden in FD[5]. Current biomedical management includes Helicobacter pylori eradication, acid suppression, prokinetics, neuromodulators, and psychological or behavioral interventions. Because FD often involves overlapping subtypes, dysmotility, an altered duodenal microenvironment, and psychological comorbidity, some patients experience inconsistent symptom control, poor adherence, and recurrence[6-12]. Treatment strategies for FD therefore need to move beyond symptom suppression toward coordinated, multitarget regulation.

Massage is commonly applied as an external non-pharmacological therapy in traditional Chinese medicine and may exert systemic regulatory effects. The 2025 International Clinical Practice Guideline on Traditional Chinese Medicine for FD includes massage among integrated management options for FD[6]. Current clinical evidence indicates that massage may improve global symptom scores and quality-of-life measures[13-17]. Experimental studies also show that massage can restore gastrointestinal motility, regulate gastrointestinal hormone secretion, attenuate oxidative injury, preserve mitochondrial function, and modulate protein metabolism and inflammatory cascades in FD models[18-20]. From a mechanobiological perspective, exogenous mechanical stress can be sensed by cutaneous mechanoreceptors, the fascial network, the cytoskeleton, and mechanosensitive ion channels and converted across tissue scales into intracellular biochemical signals that regulate inflammation, tissue repair, and gastrointestinal mucosal barrier integrity[21-26]. Massage is a representative form of rhythmic mechanical manipulation. It is characterized by a small contact area, concentrated force, a stable rhythm, and relatively controllable pressure parameters. When applied to gastrointestinal-related acupoints such as Zhongwan (CV12) and Tianshu (ST25), this stimulation provides sustained and regular local mechanical input, making it suitable for analyzing the relationship between manipulation parameters and biological effects[18,20,27-29]. In this study, an artificial intelligence-controlled robotic arm was used to simulate massage at Zhongwan and Tianshu in an FD-like rabbit model under light-, medium-, and heavy-pressure conditions. We systematically evaluated gastrointestinal motility, inflammatory mediators, duodenal mucosal morphology and ultrastructure, and epithelial barrier-related molecular proteins to assess the pressure-specific effects of massage and explore potentially optimal mechanical parameters and associated molecular changes. The sucrose-iodoacetamide/irregular-feeding protocol was used as an FD-like experimental model combining dysmotility with duodenal inflammatory and barrier abnormalities; because chemical induction can produce overt mucosal lesions, it should be interpreted as a partial experimental phenotype rather than a complete replica of the Rome IV clinical disorder. The mechanotransduction literature cited above establishes biological plausibility for responses to mechanical loading but does not demonstrate that externally applied abdominal massage directly modifies duodenal epithelial signaling. Accordingly, myosin light chain kinase (MLCK)/phosphorylated myosin light chain (p-MLC)/E-cadherin measurements were treated as associated molecular endpoints rather than proof of a causal mechanism.

MATERIALS AND METHODS

Animal modeling and intervention

Experimental animals and ethical approval: Fifty healthy New Zealand White rabbits, 12 weeks of age, with equal numbers of males and females and a body weight of 2.0 ± 0.05 kg, were obtained from the Guangdong Medical Laboratory Animal Center laboratory animal production license, No. 44411600016796. All animal procedures complied with the Guide for the Care and Use of Laboratory Animals and were reviewed and approved by the Animal Ethics Committee of Guangzhou University of Chinese Medicine, approval No. 20241118009. Animal-welfare procedures followed the 3R principle. Before formal experimentation, rabbits underwent acclimation and gradual habituation to gentle handling and positional restraint, and gavage, restraint, and robotic procedures were performed by trained personnel.

Housing conditions: All rabbits were maintained at the Laboratory Animal Center of Guangzhou University of Chinese Medicine under standardized housing conditions. To reduce interanimal competition and stress transmission, each rabbit was kept in a separate cage. The animal room was regulated at 25 °C ± 2 °C with 55% ± 5% relative humidity under a 12-hour light/12-hour dark cycle. Animals had free access to a standard pellet diet and water throughout the study.

Animal welfare and humane endpoints: Animal welfare was monitored throughout the modeling and intervention periods. General health status, including activity, posture, respiration, body weight, and food and water intake, was evaluated before, during, and after experimental procedures. During robotic massage, animals were continuously observed for signs of procedure-related distress; if excessive struggling, abnormal respiration, or instability occurred, the intervention was temporarily interrupted and resumed only after recovery to a stable behavioral state. Humane endpoint criteria included inability to access food or water, severe weight loss, dehydration, respiratory distress, inability to maintain normal posture, or persistent unrelieved distress. Animals meeting these criteria would have been withdrawn and euthanized according to the approved protocol. No animals reached humane endpoints or were withdrawn during the study.

Grouping and randomization: Following a 7-day acclimation period, the 50 rabbits were allocated using a random-number table to five groups of 10 animals each: The control group (C group), the model group (M group), the light-pressure group (LP group), the medium-pressure group (MP group) group, and the heavy-pressure group (HP group). Group size was determined based on previous experimental observations from the same research program and the feasibility requirements of the planned experimental procedures. Previous histological observations indicated that a minimum of eight animals per group would be sufficient under an α level of 0.05 and 80% power; therefore, ten animals per group were enrolled to accommodate planned tissue allocation and possible attrition. Because the present study included multiple exploratory functional, morphological, biochemical, and molecular endpoints without a prospectively defined single primary endpoint, this calculation was considered a rationale for sample allocation rather than a formal endpoint-specific power analysis.

Animals were randomly assigned before intervention. A separate allocation-concealment procedure was not prospectively documented. All randomized animals completed the experimental protocol, with no deaths, withdrawals, or exclusions; therefore, no missing-data imputation was required. The individual rabbit was considered the experimental unit for all statistical analyses. Technical replicates from molecular assays were summarized at the animal level before inferential analysis and were not treated as independent biological observations.

Animal modeling: Except for the C group (n = 10), rabbits in the remaining groups (n = 40) were used to establish an FD-like model using a combination of sucrose-iodoacetamide solution administration and irregular feeding[28-30]. Based on body surface area-equivalent dose conversion, rabbits in the modeling groups received iodoacetamide-sucrose solution by gavage at 12 mg/kg per day, with a fixed gavage volume of 20 mL/kg. The solution was freshly prepared before each administration by dissolving iodoacetamide powder (1021499, Shanghai Haohong Biomedical Technology Co., Ltd.) in 5% sucrose saline to a final concentration of 0.6 mg/mL, followed by thorough vortexing. During the 20-day gavage period, the modeling groups also underwent irregular feeding, alternating 24 hours of fasting with 24 hours of normal feeding. Control rabbits received a normal diet and an equal volume of sterile 0.9% saline by gavage at the same time points. This protocol was designed to induce an FD-like experimental phenotype characterized by impaired gastrointestinal transit together with duodenal inflammatory and barrier-related abnormalities. Because iodoacetamide administration may introduce a superimposed chemical mucosal injury component, this model was interpreted as a partial FD-like experimental phenotype rather than a complete reproduction of clinical FD.

Animal intervention: Acupoint localization was performed according to Experimental Acupuncturology[31], rabbit surface anatomy, and comparative anatomical references. Zhongwan (CV12) was located on the anterior abdominal midline between the umbilicus and the inferior border of the sternum, and bilateral Tianshu (ST25) were identified at the umbilical level along the line between the umbilicus and the lateral abdominal wall. Following abdominal hair removal and acupoint marking, rabbits were placed in the supine position and gently restrained by trained personnel to maintain stable positioning throughout the intervention. Robot-assisted one-finger Chan manipulation was delivered using a DOBOT Magician robotic arm controlled by DobotStudio V1.9.2. The end effector was fitted with a flexible silicone simulated-thumb sleeve incorporating a temperature-control module, maintaining a contact temperature of 36.5 °C-36.9 °C. The manipulation program followed a reciprocating P0 → P1 → P0 trajectory in Move Joint mode, with an 8-mm peak-to-peak displacement, 30% acceleration setting, 1000 cycles, and a target frequency of 150 movements/min. Contact force was monitored using a single-point thin-film sensor integrated into the Multi-point Film Force-measurement system. Before intervention, the sensor was calibrated using an Multi-point Film Force-B-(0-1K) calibrator, and voltage signals were converted into force values according to the calibration equation F (N) = a + bV (V). Real-time force-time feedback was used to adjust the Z-axis position and maintain target forces of 1.00 ± 0.38 N, 2.34 ± 0.96 N, and 4.39 ± 0.47 N in the light-, medium-, and heavy-pressure groups, respectively. Each acupoint was stimulated for 5 minutes in the sequence of CV12, left ST25, and right ST25, resulting in a total intervention duration of 15 minutes per rabbit per day for 10 consecutive days. Because force measurement was obtained using a single-point sensor, the present study quantified normal contact force and temporal variation but did not characterize spatial pressure distribution. The applied forces levels represent experimental intervention conditions in rabbit and were not designed to directly simulate human clinical massage intensity. The control and M groups underwent matched handling and restraint procedures without robotic stimulation.

Predefined sample allocation for molecular analyses

Gastrointestinal motility measurements and serum biomarker analyses were performed in all animals in each group (n = 10). For quantitative polymerase chain reaction (qPCR), Western blotting, and immunofluorescence (IF) analyses, six animals per group (n = 6) were predefined at the experimental design stage based on planned tissue allocation and molecular assay workflow. The sample-allocation plan was established before experimental procedures and was not modified according to animal condition, experimental outcomes, or molecular assay results. Each rabbit was considered the experimental unit, and statistical analyses were performed using individual animals as independent biological observations. Technical replicates were summarized at the animal level before analysis. All 50 randomized animals completed the study, with no deaths or exclusions.

Assessment of gastric emptying and small intestinal propulsion

Twenty-four hours after the final intervention, all rabbits were fasted but allowed free access to water. A nutritive semi-solid paste was administered by gavage at a dose of 20 mL/kg. The paste was prepared using 5% sodium carboxymethylcellulose as the matrix, mixed with milk powder, sucrose, and starch, heated, and supplemented with activated charcoal powder as a tracer. Thirty minutes after gavage, rabbits were anesthetized with sodium pentobarbital (30 mg/kg, intravenous injection via the marginal ear vein). Anesthesia was considered adequate when the righting reflex was absent and no withdrawal response was observed after toe pinch. Blood samples were collected from the central auricular artery under anesthesia. Euthanasia was then performed by additional sodium pentobarbital administration until the cumulative dose reached approximately 100 mg/kg. Death was confirmed by sustained absence of spontaneous respiration, heartbeat, and reflexes before laparotomy and tissue collection.

After the cardia and pylorus had been isolated and tied off, the stomach was excised and weighed to obtain the gross gastric weight. A longitudinal incision was then made along the greater curvature, and the luminal contents were carefully washed out with phosphate-buffered saline (PBS). After excess fluid was removed with filter paper, the empty stomach was weighed and recorded as the net gastric weight[30]. After separation of the mesentery, the small intestine was removed en bloc from the pyloric outlet to the ileocecal junction and gently straightened on the dissecting surface. The full length of the small intestine was recorded, and the migration distance of the charcoal front from the pylorus was measured[30].

Histopathological changes in gastric antral and duodenal tissues observed by hematoxylin-eosin staining

Gastric antral and duodenal tissues were rapidly isolated from rabbits in each group, rinsed thoroughly with precooled PBS to remove blood and luminal contents, and fixed in 4% paraformaldehyde for more than 24 hours with complete specimen immersion. After fixation, the specimens were processed by serial ethanol dehydration, xylene clearing, and paraffin embedding. Consecutive 4-5 μm sections were then cut using a microtome. Following routine hematoxylin-eosin staining, gastrointestinal histopathological injury was examined under light microscopy. Histological morphometric analysis was performed by an investigator blinded to group allocation. Gastric antral mucosal thickness and duodenal villus height, crypt depth, and villus height-to-crypt depth ratio were measured in randomly selected, non-overlapping microscopic fields using a light microscope equipped with an image analysis system. Measurements from multiple fields within each animal were averaged, and each animal was considered the independent statistical unit for subsequent analysis.

Observation of duodenal epithelial barrier ultrastructure by transmission electron microscope

Duodenal tissue samples of approximately 1 mm³ were excised from each group, immediately washed on ice with precooled PBS, and fixed overnight at 4 °C in 2.5% glutaraldehyde. After buffer washes, the samples were subjected to secondary fixation with 1% osmium tetroxide at room temperature for 1 hour. After an additional rinse, tissue blocks were stained en bloc with uranyl acetate for 1 hour, dehydrated using an ascending ethanol series, and then impregnated with epoxy resin before embedding. Resin polymerization was carried out at 75 °C for 24 hours. Ultrathin sections were cut, collected on copper grids, and observed under a transmission electron microscope (TEM). Ultrastructural analysis of duodenal epithelial tight junctions was performed by an investigator blinded to group allocation. Transmission electron microscopy images were acquired from randomly selected regions of duodenal epithelial tissue, and tight junction intercellular widths were measured using image analysis software. Multiple tight junctions from each animal were analyzed and averaged, with each animal considered the independent statistical unit for subsequent analysis.

Determination of the levels of gastrointestinal hormones, inflammatory cytokines, and barrier injury markers

Blood collected from the central dorsal auricular artery was placed in tubes without anticoagulant and allowed to clot naturally. Samples were centrifuged at 3000 r/minute for 5 minutes at 4 °C, and serum supernatants were collected, aliquoted, stored at low temperature, and protected from repeated freeze-thaw cycles. Serum gastrin (GAS, MM-82568O1), motilin (MTL, MM-82946O1), diamine oxidase (DAO, MM-8253301), interleukin-6 (IL-6, MM-030201), complement receptor 1 (CR1, MM-1094T1), lipopolysaccharide (LPS, MM-3687001), tumor necrosis factor-alpha (TNF-α, MM-0240O1), interferon-γ (IFN-γ, MM-029001), tissue plasminogen activator (t-PA, MM-023601), and circulating immune complexes (CIC, MM-1092T1) levels were measured by enzyme-linked immunosorbent assay using kits purchased from Jiangsu Meimian. Serum nitric oxide (NO, ADS-W-N005-96) was measured using the nitrate reductase method. All assays were performed according to the manufacturers’ instructions. GAS and MTL were measured as gastrointestinal motility-related hormones; DAO and LPS as indirect indicators associated with intestinal barrier alterations; IL-6, TNF-α, and IFN-γ as inflammatory cytokines; CIC and CR1 as immune-related parameters; and NO and t-PA as vascular and fibrinolytic-related biochemical parameters.

qPCR analysis of MLCK, MLC, and E-cadherin mRNA expression

Frozen duodenal tissues from six animals per group were randomly selected for total RNA extraction. Total RNA was isolated using a commercial RNA extraction kit according to the manufacturer’s instructions. RNA concentration and purity were assessed before reverse transcription. First-strand cDNA was synthesized using the SwepScript All-in-One First-Strand cDNA Synthesis SuperMix Kit according to the manufacturer’s protocol. Quantitative real-time polymerase chain reaction was performed using SYBR Green-based chemistry. Each reaction mixture was prepared according to the manufacturer’s instructions. Amplification was conducted with an initial denaturation at 95 °C for 30 seconds, followed by 40 cycles of denaturation at 95 °C for 15 seconds and annealing/extension at 60 °C for 30 seconds. Melting curve analysis was performed to confirm amplification specificity. Relative mRNA expression levels of MLCK, MLC, and E-cadherin were calculated using the 2^-ΔΔCt method, with β-actin used as the endogenous reference gene. The C group was used as the calibrator. Primer sequences are provided in Table 1. Each biological sample was analyzed in technical triplicates. The mean Ct value of technical replicates was used for each individual animal, and each animal was considered an independent biological replicate for statistical analysis.

Table 1 Primer sequences.

Gene	Primer	Sequence (5’-3’)	PCR products (bp)
MLCK	Forward	TGGCAATGATCTCAGGGCTC	100
	Reverse	GCTTGGGAGACATCTTCGGT
MLC	Forward	ACGTCCAATGTCTTCGCCAT	154
	Reverse	GGTATTCGTCCGTGGGGTTT
E-cadherin	Forward	GAGGCGAAGCAGCAGTACATT	198
	Reverse	GGCGGTGTAGGATGTGATTTCT
β-actin	Forward	CGCAGAAACGAGACGAGATTG	146
	Reverse	GATGCTCGCTCCAACGACTG

PCR: Polymerase chain reaction.

Detection of the expression of MLCK, MLC, E-cadherin, ZO-1, Occludin, F-actin, Claudin-1, p-MLC, and glyceraldehyde-3-phosphate dehydrogenase in duodenal tissue by western blot

Frozen duodenal tissues from six randomly selected animals per group were homogenized in radioimmunoprecipitation assay lysis buffer containing protease and phosphatase inhibitors for total protein extraction. After low-temperature centrifugation, the supernatant was collected, and total protein concentration was determined using a bicinchoninic acid protein assay kit (Beyotime Biotechnology, Shanghai, China; P0012). Equal amounts of protein were mixed with loading buffer and denatured. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Merck Millipore, IPVH00010). Membranes were blocked with 5% nonfat milk at room temperature for 2 hours and washed three times with Tris-buffered saline containing Tween-20 (TBST). Membranes were then incubated overnight at 4 °C with gentle shaking with the following primary antibodies: F-actin (No. ab205, 1:500, Abcam, United Kingdom) MLC (No. bs-7052R, 1:1000, Bioss, China), ZO-1 (No. 21773-1-AP, 1:5000, Proteintech, China), E-cadherin (No. bs-10009R, 1:1000, Bioss, China), MLCK (No. T55428, 1:1000, Abmart, China), p-MLC (No. AF8618, 1:1000, Affinity Biosciences, China), Occludin (No. ET1701-76, 1:1000, HUABIO, China), Claudin-1 (No. HA721248, 1:1000, HUABIO, China), and glyceraldehyde-3-phosphate dehydrogenase (No. GB15002-100, 1:3000, Servicebio, China). After three TBST washes on the following day, the membranes were incubated with species-appropriate secondary antibodies at room temperature for 1 hour. Secondary antibodies included goat anti-mouse IgM (No. 550110, 1:5000, Zen-Bio, China) and goat anti-rabbit IgG (No. HA1001, 1:50000, HUABIO, China). After further TBST washes, bands were visualized using an enhanced chemiluminescence kit (ECL, Chengdu Obios Technology, PD203-120 mL). Band images were acquired, and densitometric analysis was performed using ImageJ, followed by normalization. In this manuscript, p-MLC denotes the phospho-MLC2 signal detected at Ser15, whereas MLC denotes the total MLC assay signal.

Detection of MLCK, MLC, and E-cadherin expression by IF

IF staining was performed on duodenal tissue sections from all animals (n = 6 per group). For quantitative analysis, fluorescence intensity was measured in randomly selected microscopic fields from each animal. The fluorescence intensity values from all evaluated fields within each animal were averaged, and the resulting mean value for each animal was used as the experimental unit for statistical analysis. Tyramide signal amplification (TSA)-based multiplex IF was used to assess the in situ expression and colocalization of MLCK, MLC, and E-cadherin in intestinal tissue sections. After routine deparaffinization and antigen retrieval, sections were treated sequentially with 3% H₂O₂ and 3% bovine serum albumin to block endogenous peroxidase activity and nonspecific binding. Multiple TSA labeling cycles were then performed: (1) Incubation with the specific primary antibody overnight at 4 °C and the corresponding horseradish peroxidase-conjugated secondary antibody for 50 minutes at room temperature; (2) Incubation with the TSA fluorescent substrate for 10 minutes to achieve covalent fluorescence deposition; and (3) Antibody stripping at 37 °C for 30 minutes to remove noncovalent antibody complexes and prevent cross-reactivity. This cycle was repeated to sequentially label the three target proteins. Nuclei were counterstained with 4’,6-diamidino-2-phenylindole for 10 minutes, and the slides were mounted. Images were acquired by fluorescence microscopy, and the relative fluorescence intensity of positive signals was quantified using ImageJ.

Experimental design and outcome assessment

This study was designed as an exploratory randomized controlled animal study incorporating functional, morphological, biochemical, and molecular outcome assessments. Because multiple biological domains were evaluated, no single primary endpoint was prospectively designated. To improve transparency and reduce selective interpretation, outcomes were predefined according to their biological relevance. Gastric emptying rate and small intestinal propulsion rate were considered key functional outcomes reflecting gastrointestinal motor function. Additional assessments included duodenal morphology and ultrastructure, serum barrier- and inflammation-related biomarkers, epithelial junction-associated proteins, and MLCK/p-MLC/E-cadherin-associated molecular changes. Structural, biochemical, and molecular findings were interpreted as biological changes associated with functional outcomes and were not considered independent evidence of causal mechanisms.

Statistical analysis

Statistical analyses were performed using GraphPad Prism version 8.0. The individual rabbit was considered the experimental unit, and technical replicates from the same animal were averaged before analysis. Data are presented as mean ± SD or median (interquartile range), as appropriate. Normality and variance homogeneity were assessed using the Shapiro-Wilk and Brown-Forsythe tests. Normally distributed data were analyzed using one-way analysis of variance (ANOVA) with Tukey’s test, whereas Welch’s ANOVA with Dunnett’s T3 test was applied for data with unequal variances. Non-normally distributed data were analyzed using the Kruskal-Wallis test with Dunn’s multiple comparisons test. A two-sided P value < 0.05 was considered statistically significant.

RESULTS

General condition of rabbits in each group

Rabbits in the C group were alert and responsive, with high activity levels, smooth and glossy fur, stable food intake, normally formed feces, clean perianal regions, and relatively stable body weight. Rabbits in the M and HP groups showed weight loss, reduced daily food intake, lethargy, a curled resting posture, prolonged eye closure, decreased spontaneous activity, sluggish responses, dull and coarse fur, localized hair loss, and loose or watery stools. After the intervention, the MP group showed the most obvious recovery, followed by the LP group, whereas the HP group showed weaker improvement. Mental status and coat appearance improved; activity and responsiveness increased; food intake and body weight rose, and feces became better formed.

Changes in body weight and food intake

Quantitatively, compared with the C group, the M group exhibited lower body weight and food intake (P < 0.001). Both indices increased with light and especially medium pressure, whereas the HP group remained low; compared with the M group, both body weight and food intake increased in the LP group and increased further in the MP group (P < 0.05). Compared with the LP group or MP group, the HP group showed lower body weight and food intake (P < 0.001) (Figure 1).

Figure 1 Effect of massage on body weight and food intake in rabbits with functional dyspepsia (n = 10). Data are expressed as mean ± SD. ^bP < 0.001 vs the control group; ^cP < 0.05 vs the model group; ^eP < 0.001 vs the model group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. A: Body weight; B: Food intake. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Changes in gastric emptying and small intestinal propulsion

Compared with the C group, the M group exhibited reductions in gastric emptying and small intestinal propulsion (P < 0.001), indicating impaired gastrointestinal motility in FD model rabbits. Compared with the M group, both gastric emptying and small intestinal propulsion increased in the LP group and increased further in the MP group (P < 0.001). In contrast, small intestinal propulsion was reduced in the HP group (P < 0.05). Compared with the LP group, gastric emptying was higher in the MP group and lower in the HP group (P < 0.001), small intestinal propulsion was lower in the HP group (P < 0.001). Compared with the MP group, the HP group showed lower gastric emptying and small intestinal propulsion (P < 0.001) (Figure 2).

Figure 2 Effect of massage on gastric emptying and small intestinal propulsion in rabbits with functional dyspepsia (n = 10). ^bP < 0.001 vs the control group; ^cP < 0.05 vs the model group; ^eP < 0.001 vs the model group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. A: Gastric emptying rate; B: Small intestinal propulsion rate. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Histopathological changes in gastric antral and duodenal tissues

The gastric antral mucosa in the C group was intact, with continuous surface epithelium, regularly arranged gastric pits and antral glands, orderly glandular cells, and no evident inflammatory infiltration, edema, hemorrhage, necrosis, or erosion in the lamina propria. In the M group, the antral mucosa showed architectural disorganization, focal discontinuity of the surface epithelium, irregular gastric pits, disordered glands with focal glandular lumen dilation, increased inflammatory cell infiltration in the lamina propria, and widened interstitial spaces. These changes indicated inflammatory injury and structural abnormalities without ulceration or necrosis. Compared with the M group, the LP group showed partial recovery of antral mucosal architecture, with better epithelial continuity, more regular gastric pits and glands, and reduced inflammatory infiltration, although mild focal disorganization remained. The MP group showed the most evident improvement, with relatively intact mucosal epithelium, orderly gastric pits and antral glands, regular glandular morphology, and reduced inflammatory infiltration and edema; the overall morphology approximated that of the C group. In the HP group, the antral mucosal structure remained disorganized, with focal epithelial discontinuity, irregular gastric pits and glands, marked glandular lumen dilation, abundant inflammatory infiltration, and more severe local mucosal injury than in the M group. These findings indicate that the MP exerted a more pronounced protective effect on gastric antral pathology in rabbits with FD, whereas the LP provided partial benefit and the HP did not show a clear protective effect and aggravated some antral mucosal lesions (Figure 3).

Figure 3 Effect of massage on gastric antral histopathology in rabbits with functional dyspepsia (hematoxylin and eosin staining, n = 6). Representative photomicrographs are shown at original magnifications of × 200 (upper row; scale bar, 200 μm) and × 400 (lower row; scale bar, 100 μm). Black arrows indicate surface epithelial exfoliation or discontinuity; yellow arrows indicate inflammatory infiltration in the lamina propria; orange asterisks indicate interstitial edema; blue arrowheads indicate distorted gastric pits. Orange double-headed arrows indicate gastric antral mucosal thickness. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Changes in antral mucosal thickness

Compared with the C group, the M group exhibited reductions in antral mucosal thickness (P < 0.001). Compared with the M group, antral mucosal thickness increased in the LP group and increased further in the MP group (P < 0.01). In contrast, antral mucosal thickness was reduced in the HP group (P < 0.05). Compared with the LP group, antral mucosal thickness was higher in the MP group and lower in the HP group (P < 0.01). Compared with the MP group, the HP group showed lower antral mucosal thickness (P < 0.001) (Figure 4).

Figure 4 Effect of massage on antral mucosal thickness in rabbits with functional dyspepsia (n = 6). ^bP < 0.001 vs the control group; ^cP < 0.05 vs the model group; ^dP < 0.01 vs the model group; ^eP < 0.001 vs the model group; ^gP < 0.01 vs the light-pressure group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

In the C group, the duodenal mucosa was intact, with regular and orderly villi, continuous surface epithelium, and no obvious inflammatory infiltration or edema in the lamina propria. The M group showed clear mucosal injury, including disordered villous arrangement, partial villous shortening, villous rupture or shedding, focal epithelial discontinuity, inflammatory infiltration, and mild lamina propria edema. The MP group showed substantial recovery, with more regular villous morphology and arrangement, restored epithelial continuity, and reduced inflammatory infiltration and edema. The LP group also showed partial mucosal repair, although the effect was weaker than that in the MP group. The HP group showed no clear improvement; in some regions, villous disorganization, rupture, and inflammatory changes were more severe than in the M group. These results indicate that the MP markedly attenuated duodenal mucosal pathological injury in rabbits with FD, whereas the LP provided partial repair and the HP did not confer clear protection, with aggravation of villous damage, epithelial disruption, and inflammatory changes in some areas (Figure 5).

Figure 5 Effect of massage on duodenal histopathology in rabbits with functional dyspepsia (hematoxylin and eosin staining, n = 6). Representative photomicrographs are shown at original magnifications of × 200 (upper row; scale bar, 200 μm) and × 400 (lower row; scale bar, 100 μm). Black arrows indicate epithelial shedding or discontinuity; yellow arrows indicate inflammatory cell infiltration in the lamina propria; orange asterisks indicate submucosal edema; blue arrowheads indicate crypt disruption. Cornflower-blue double-headed arrows indicate villus height, and chocolate-yellow solid double-headed arrows indicate crypt depth. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Changes in villus height and crypt depth

Compared with the C group, the M group showed decreased duodenal villus height and increased crypt depth (P < 0.001). Compared with the M group, the LP group showed increased villus height and decreased crypt depth, whereas the MP group showed a further increase in villus height and decrease in crypt depth, in contrast, the HP group showed decreased villus height and increased crypt depth (P < 0.001). Compared with the LP group, the MP group had greater villus height and lower crypt depth, whereas the HP group had lower villus height and greater crypt depth (P < 0.001). Compared with the MP group, the HP group showed lower villus height and greater crypt depth (P < 0.001) (Figure 6).

Figure 6 Effect of massage on villus height and crypt depth in rabbits with functional dyspepsia (n = 6). ^bP < 0.001 vs the control group; ^dP < 0.01 vs the model group; ^eP < 0.001 vs the model group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. A: Villus height; B: Crypt depth. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

TEM-based ultrastructural changes in the duodenal mucosa

In the C group, duodenal epithelial cells were orderly arranged, intercellular spaces were narrow, tight junctions were continuous and dense, microvilli were upright and uniform in length, mitochondria and endoplasmic reticulum were structurally intact, and autophagosomes and vacuoles were rare, indicating an intact mucosal barrier. In the M group, intercellular spaces were markedly widened, tight junctions were blurred and disrupted, microvilli were sparse, collapsed, or fractured, mitochondrial cristae were disorganized or broken, the endoplasmic reticulum was dilated, and autophagosomes and vacuoles increased, suggesting increased barrier permeability. In the LP group, the microvillar arrangement improved; some fractured microvilli were repaired; tight junctions partially recovered; injury to the mitochondria and endoplasmic reticulum was mildly alleviated, and autophagosomes decreased. In the MP group, intercellular spaces approached those of the C group; tight junctions were continuous and intact; microvilli were orderly and upright; mitochondrial cristae were clear and more abundant; autophagosomes decreased; and the overall ultrastructure showed the most prominent recovery. In the HP group, intercellular spaces widened, microvilli were disorganized and uneven in length, most microvilli were ruptured or detached, tight junctions were shortened and focally disrupted, mitochondrial injury worsened, and autophagosomes increased (Figure 7).

Figure 7 Effect of massage on duodenal epithelial ultrastructure in rabbits with functional dyspepsia (n = 3). Representative transmission electron microscope images are shown at original magnifications of × 15000 (upper row; scale bar, 1 μm) and × 25000 (lower row; scale bar, 500 nm). White arrows indicate intact, densely arranged microvilli; yellow arrows indicate detached, disorganized, or sparse damaged microvilli; orange triangles indicate tight junctions. Light-blue short lines indicate the intercellular space width. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Changes in intercellular space width

Compared with the C group, the M group exhibited increases in intercellular space width (P < 0.001). Compared with the M group, intercellular space width reduced in the LP group and reduced further in the MP group (P < 0.05). In contrast, intercellular space width increased in the HP group (P < 0.001). Compared with the LP group, intercellular space width was lower in the MP group and higher in the HP group (P < 0.05). Compared with the MP group, the HP group showed higher intercellular space width (P < 0.001) (Figure 8).

Figure 8 Effect of massage on intercellular space width in rabbits with functional dyspepsia (n = 3). ^bP < 0.001 vs the control group; ^cP < 0.05 vs the model group; ^eP < 0.001 vs the model group; ^fP < 0.05, vs the light-pressure group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Serum levels of gastrointestinal hormones, inflammatory cytokines, intestinal barrier injury markers, and immune markers

Compared with the C group, the M group showed lower serum levels of GAS, MTL, CR1, t-PA and higher levels of IL-6, CIC, LPS, DAO, TNF-α, IFN-γ, NO (P < 0.001). Compared with the M group, the LP group showed increased in CR1, t-PA and reduced in DAO, TNF-α (P < 0.05). The MP group broadly corrected these abnormal markers (P < 0.05) and produced the strongest intervention effect. The HP group showed no improvement and further deterioration in several markers (P < 0.05) (Figure 9).

Figure 9 Effect of massage on serum gastrointestinal hormones, inflammatory cytokines, intestinal barrier injury markers, and immune markers in rabbits with functional dyspepsia (n = 10). ^bP < 0.001 vs the control group; ^cP < 0.05 vs the model group; ^dP < 0.01 vs the model group; ^eP < 0.001 vs the model group; ^fP < 0.05, vs the light-pressure group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. A: Gastrin; B: Motilin; C: Interleukin-6; D: Circulating immune complex; E: Complement receptor 1; F: Lipopolysaccharide; G: Diamine oxidase; H: Tumor necrosis factor-alpha; I: Interferon-gamma; J: Tissue plasminogen activator; K: Nitric oxide. GAS: Gastrin; MTL: Motilin; IL-6: Interleukin-6; CIC: Circulating immune complex; CR1: Complement receptor 1; LPS: Lipopolysaccharide; DAO: Diamine oxidase; TNF-α: Tumor necrosis factor-alpha; IFN-γ: Interferon-gamma; T-PA: Tissue plasminogen activator; NO: Nitric oxide; C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Duodenal tissue mRNA expression of MLCK, MLC, and E-cadherin

Compared with the C group, the M group showed increased duodenal MLCK and MLC mRNA expression (P < 0.001) and reduced E-cadherin mRNA expression (P < 0.01). Compared with the M group, MLCK and MLC mRNA expression reduced in the LP group and the MP group (P < 0.05), E-cadherin mRNA increased in the MP group (P < 0.05). Compared with the LP group, MLCK and MLC mRNA expression increased in the HP group (P < 0.001). Compared with the MP group, MLCK and MLC mRNA expression increased and E-cadherin mRNA reduced in the HP group (P < 0.001) (Figure 10).

Figure 10 Effect of massage on duodenal myosin light chain kinase, myosin light chain, and E-cadherin mRNA expression in rabbits with functional dyspepsia (n = 6). ^aP < 0.01 vs the control group; ^bP < 0.001 vs the control group; ^cP < 0.05 vs the model group; ^eP < 0.001 vs the model group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. Quantitative real-time polymerase chain reaction was used to determine mRNA expression levels in duodenal tissue. A: Myosin light chain kinase; B: Myosin light chain; C: E-cadherin. C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Expression of MLCK/p-MLC/E-cadherin axis proteins and epithelial barrier-related proteins in duodenal tissue

Compared with the C group, the M group increased MLCK protein expression and p-MLC/MLC ratio in duodenal tissue, accompanied by reduced E-cadherin, ZO-1, F-actin, Occludin, and Claudin-1 protein expression (P < 0.001). Compared with the M group, the LP group showed a reduced p-MLC/MLC ratio (P < 0.01) and increased expression of E-cadherin, ZO-1, F-actin, Occludin, and Claudin-1 (P < 0.001). The MP group broadly corrected these abnormal protein changes (P < 0.001) and showed the strongest effect. The HP group showed no improvement, and several abnormalities were further aggravated (P < 0.001) (Figures 11 and 12).

Figure 11 Effect of massage on duodenal ZO-1 protein expression in rabbits with functional dyspepsia (n = 6). ^bP < 0.001 vs the control group; ^eP < 0.001 vs the model group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. GAPHD: Glyceraldehyde-3-phosphate dehydrogenase; C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Figure 12 Effect of massage on the myosin light chain kinase/phosphorylated myosin light chain/E-cadherin signaling axis and epithelial barrier-related protein expression in duodenal tissue of rabbits with functional dyspepsia (n = 6). ^bP < 0.001 vs the control group; ^dP < 0.01 vs the model group; ^eP < 0.001 vs the model group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. A-F: Representative western blot bands show protein expression of myosin light chain kinase, E-cadherin, Occludin, F-actin, Claudin-1, myosin light chain, phosphorylated myosin light chain, and glyceraldehyde-3-phosphate dehydrogenase in duodenal tissue. MLC: Myosin light chain; p-MLC: Phosphorylated myosin light chain; MLCK: Myosin light chain kinase; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Relative fluorescence intensity and spatial distribution of MLCK, MLC, and E-cadherin in duodenal tissue

In the C group, duodenal mucosal MLCK and MLC fluorescence signals were weak, whereas E-cadherin showed a relatively continuous distribution along intercellular junctions. Compared with the C group, the M group showed enhanced MLCK and MLC fluorescence signals and weakened, discontinuous E-cadherin fluorescence. Compared with the M group, the LP and MP groups showed reduced MLCK and MLC fluorescence and enhanced E-cadherin fluorescence; the MP group showed the most pronounced improvement, with more intact epithelial intercellular junctions and a more continuous and uniform E-cadherin distribution. The HP group showed no clear improvement and exhibited adverse changes (Figure 9). Semiquantitative analysis showed that, compared with the C group, relative MLCK and MLC fluorescence intensities were increased in the M group (P < 0.001), whereas E-cadherin fluorescence intensity was reduced (P < 0.01). Compared with the M group, the LP group showed reduced MLC fluorescence intensity and increased E-cadherin fluorescence intensity (P < 0.05), and the MP group showed reduced MLCK and MLC fluorescence intensity and increased E-cadherin fluorescence intensity (P < 0.01).Compared with the LP or MP group, the HP group showed increased MLC fluorescence intensity and reduced E-cadherin fluorescence intensity (P < 0.01) (Figures 13 and 14).

Figure 13 Effect of massage on the expression and spatial distribution of myosin light chain kinase, myosin light chain, and E-cadherin in duodenal tissue of rabbits with functional dyspepsia (immunofluorescence, × 20/× 40). Representative immunofluorescence images show 4’,6-diamidino-2-phenylindole-stained nuclei (blue), myosin light chain kinase (green), myosin light chain (red), E-cadherin (yellow), and merged signals. The first five panels in each group show 4’,6-diamidino-2-phenylindole, myosin light chain kinase, myosin light chain, E-cadherin, and merged images, respectively. The sixth panel shows an enlarged view of the boxed region in the merged image. Scale bars: 200 μm at × 20 magnification and 100 μm at × 40 magnification (n = 6). DAPI: 4’,6-diamidino-2-phenylindole; MLCK: Myosin light chain kinase; MLC: Myosin light chain; C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

Figure 14 Effect of massage on the relative fluorescence intensities in duodenal tissue of rabbits with functional dyspepsia (n = 6). ^aP < 0.01 vs the control group; ^bP < 0.001 vs the control group; ^cP < 0.05 vs the model group; ^dP < 0.01 vs the model group; ^eP < 0.001 vs the model group; ^gP < 0.01 vs the light-pressure group; ^hP < 0.001 vs the light-pressure group; ⁱP < 0.001 vs the medium-pressure group. A: Myosin light chain kinase; B: Myosin light chain; C: E-cadherin. MLCK: Myosin light chain kinase; MLC: Myosin light chain; C: The control group; M: The model group; LP: The light-pressure group; MP: The medium-pressure group; HP: The heavy-pressure group.

DISCUSSION

FD comprises a multidimensional pathophysiological spectrum that includes impaired gastric motility, defective gastric accommodation, gastroduodenal sensorimotor dysfunction, low-grade inflammation, and mucosal barrier disruption. Delayed gastric emptying and impaired gastroduodenal coordination contribute to core symptoms such as postprandial fullness, early satiety, and epigastric discomfort[7,32-34]. Abnormal secretion of GAS and MTL can disrupt the rhythmicity of gastrointestinal peristalsis[35]. Under conditions of delayed motility, the duodenum is vulnerable to low-grade inflammation, epithelial discontinuity, and microvillar damage, which may increase epithelial permeability. Inflammatory mediators and gut-derived endotoxin that cross the barrier can disturb local mucosal homeostasis and may further aggravate dysmotility through gut-brain and endocrine signaling. In this study, FD model rabbits exhibited impaired gastrointestinal motility, low-grade duodenal inflammation, and epithelial barrier injury. Serum GAS and MTL levels decreased, whereas DAO and LPS levels increased, suggesting impaired gastrointestinal propulsion accompanied by disruption of the duodenal barrier. Concurrent increases in IL-6, TNF-α, IFN-γ, NO, and CIC, together with abnormal CR1 and t-PA levels, indicated enhanced inflammation and dysregulated microcirculatory and immune responses. These findings are consistent with previous evidence of duodenal low-grade inflammation and immune activation in FD[33,36-41], including studies associating eosinophil counts with symptom severity and disease status[40,41]. Clinically, similar alterations in circulating inflammatory and barrier-related biomarkers have also been reported in patients with FD[42]. Low-grade inflammation can suppress tight-junction proteins such as Occludin, Claudin-1, and ZO-1, thereby compromising paracellular barrier function[43-47]. Duodenal barrier dysfunction is implicated in FD pathophysiology, yet evidence regarding junctional proteins remains heterogeneous. A meta-analysis found inconsistent alterations in tight- and adherens-junction proteins across FD populations, suggesting that barrier defects cannot be inferred from a single molecular marker[48]. After massage, particularly in the MP group, gastrointestinal motility and inflammatory indices were broadly improved, and mucosal structure was restored. These data suggest that massage may attenuate endotoxin translocation and inflammatory burden, thereby improving delayed gastrointestinal transit and structural barrier injury in rabbits with FD[17-19]. Comparable improvements in gastric motility and antral structure have also been reported with electroacupuncture in FD rats[49]. Recent systematic reviews and meta-analyses suggest that Tuina or therapeutic massage, either alone or combined with conventional therapy, may improve overall symptoms and selected symptom-specific or quality-of-life outcomes in patients with FD. However, the certainty of the available evidence remains limited[13-15]. These clinical findings provide preliminary support for the therapeutic potential of massage in FD, whereas the present experimental study further examined its pressure-response characteristics and associated biological changes. The newly quantified general-condition and morphometric outcomes strengthen this interpretation: The M group had lower body weight and food intake, reduced antral mucosal thickness and villus height, and wider crypt depth and intercellular space width, whereas the MP group showed the most consistent improvements across these measures.

At the molecular level, MLCK-mediated cytoskeletal contraction appears to be an important link in the pathogenesis of barrier injury. Under sustained inflammatory stress, aberrant MLCK expression promotes MLC phosphorylation, driving excessive contractile tension in the perijunctional F-actin ring and aggravating tight-junction and intestinal barrier dysfunction[50]. This tensile overload can destabilize epithelial intercellular junctions and disrupt barrier integrity[43,44,46,51,52]. E-cadherin, which maintains adherens junctions; ZO-1, which anchors tight junctions to the cytoskeleton; and Occludin and Claudin-1, which regulate selective barrier channels, are all vulnerable to this pathological tension[44-47,51,53]. The qPCR, Western blot, and IF data in this study showed that MLCK and p-MLC were elevated in the FD state, whereas E-cadherin and tight-junction proteins were reduced. Massage reversed these abnormalities to varying degrees, with the MP group showing the greatest effect, suggesting that this intervention may contribute to barrier reconstruction by regulating cytoskeletal tension and adherens-junction stability. The reduced intercellular space width on TEM together with higher expression of ZO-1, Occludin, Claudin-1, and E-cadherin, was consistent with improved epithelial junctional integrity. These findings remain associative and do not establish causal pathway involvement.

Massage mechanically stimulated Zhongwan and Tianshu, acupoints selected according to the traditional pathogenesis of FD, in which impaired spleen transportation and failure of stomach descent are central features[6,9,20]. The combined use of Zhongwan and Tianshu reflects the therapeutic principle of coordinated gastrointestinal regulation and harmonization of ascending and descending functions[54]. From a mechanobiological perspective, massage delivers pressure-dependent mechanical input to the gastrointestinal tract, and the stretch responsiveness of enterocyte Piezo1 supports the biological plausibility that external mechanical inputs can modulate intestinal epithelial function[55,56]. This input may be transduced through the cytoskeleton and cell-adhesion structures into distinct biological responses, thereby regulating gastrointestinal motility and epithelial barrier homeostasis. The present results show that this intervention attenuated key FD-like features, including delayed gastric emptying and reduced food intake. These findings are consistent with recent evidence from FD rat models showing that biomechanical modulation can improve gastric motility, inflammation, and mucosal barrier function[56]. The MP group showed the most favorable overall response in terms of motility and barrier repair among the three pressure levels. In contrast, the low-pressure group was associated with a less pronounced response, whereas the HP group was associated with less favorable motility and barrier-related outcomes, suggesting that increasing pressure does not necessarily result in greater biological benefit[21-24,26]. Recent experimental evidence indicates that mechanical stimulation can regulate intestinal epithelial function through Piezo1-dependent mechanosensing and Arp2/3-mediated cytoskeletal-junctional remodeling[55,57]. Together, this provides a mechanobiological interpretation of the massage principle of controlling firmness, softness, and depth and suggests a biphasic mechanical response to massage, with medium-pressure being more favorable for restoring gastrointestinal motility.

This study provides experimental evidence that pressure-calibrated massage is associated with improvements in gastrointestinal motility and duodenal epithelial barrier-related outcomes in an FD-like rabbit model. Consistent with previous findings in IBS-D rat models, abdominal massage has been reported to improve gastrointestinal motility, epithelial ultrastructure, permeability, and the expression of MLCK and junctional proteins, supporting the potential role of mechanical stimulation in regulating intestinal barrier-related processes across different gastrointestinal disease models[58]. By quantitatively controlling mechanical parameters and evaluating MLCK/p-MLC/E-cadherin-associated molecular alterations, the present study suggested a nonmonotonic pressure-response pattern, with medium-pressure stimulation producing the greatest overall improvement among the tested pressure levels.

Several limitations should be acknowledged. First, non-acupoint, passive-contact, and positive-treatment C groups were not included. Although the C and M groups received matched handling and restraint without robotic stimulation, this design cannot distinguish acupoint-specific effects from nonspecific responses induced by mechanical stimulation, physical contact, or contextual factors. Furthermore, the lack of a positive-treatment control prevents direct comparison with established therapeutic approaches. In addition, the use of a single rabbit FD-like model and a relatively short intervention period may limit the generalizability of our findings to other disease phenotypes and longer-term clinical scenarios. Second, although the robot-assisted massage enabled quantitative standardization of mechanical parameters, it cannot completely replicate the multidimensional force application, tissue adaptation, and sensory feedback involved in clinical manual manipulation. Future studies incorporating multiple models, extended intervention periods, appropriate C groups, advanced force-monitoring systems, and clinical validation are warranted to further clarify the specificity, clinical relevance, and applicability of pressure-dependent massage effects.

CONCLUSION

In this FD-like rabbit model and under the three tested robotic force settings, robot-assisted massage was associated with improved gastrointestinal motility and favorable duodenal barrier-related morphological, serum, and molecular outcomes. Both light- and medium-pressure massage significantly improved gastric emptying and small intestinal propulsion compared with the M group (P < 0.001), whereas medium-pressure massage produced the broadest significant improvements across motility, inflammatory and barrier-related markers, and MLCK/p-MLC/E-cadherin-associated proteins (P < 0.05). Light-pressure massage showed weaker effects, whereas heavy-pressure massage provided no consistent benefit and aggravated several indices (P < 0.05). These findings suggest that medium-pressure massage achieved the most favorable overall effects among the tested pressure settings under the current experimental conditions.

ACKNOWLEDGEMENTS

We sincerely thank Prof. Li-Rong Wang from Science and Technology Innovation Center, Guangzhou University of Chinese Medicine for her valuable technical guidance in transmission electron microscopy examination and interpretation.