BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Gastroenterol. Nov 21, 2026; 32(43): 121477
Published online Nov 21, 2026. doi: 10.3748/wjg.121477
Study on the adhesive effect of deoxyshikonin on Helicobacter pylori
Guang-Fu Pang, Qi-Hai Zhou, College of Physical Education and Health, Guangxi Normal University, Guilin 541006, Guangxi Zhuang Autonomous Region, China
Guang-Fu Pang, School of Medical Technology and Artificial Intelligence, Youjiang Medical University for Nationalities, Baise 533000, Guangxi Zhuang Autonomous Region, China
Jia-Yin Xu, Yan-Qiang Huang, Wen-Ting Zhou, Guangxi Technology Innovation Cooperation Base of Prevention and Control Pathogenic Microbes with Drug Resistance, Youjiang Medical University for Nationalities, Baise 533000, Guangxi Zhuang Autonomous Region, China
Ai-Xing Guan, Department of Gastroenterology, Affiliated Hospital of Youjiang Medical University for Nationalities, Baise 533000, Guangxi Zhuang Autonomous Region, China
Shi-Xian Yang, Guangxi Clinical Medical Research Center for Hepatobiliary Diseases, Affiliated Hospital of Youjiang Medical University for Nationalities, Baise 533000, Guangxi Zhuang Autonomous Region, China
Kwanjit Duangsonk, Wen-Ting Zhou, Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand
Yan-Qiang Huang, Wen-Ting Zhou, Guangxi Zhuang Autonomous Region Engineering Research Center of Clinical Prevention and Control Technology and Leading Drug for Microorganisms with Drug Resistance in Border Ethnic Areas, Youjiang Medical University for Nationalities, Baise 533000, Guangxi Zhuang Autonomous Region, China
Qi-Hai Zhou, College of Life Science, Guangxi Normal University, Guilin 541006, Guangxi Zhuang Autonomous Region, China
ORCID number: Guang-Fu Pang (0009-0009-4228-3065); Jia-Yin Xu (0000-0003-0423-5846); Ai-Xing Guan (0009-0007-7409-941X); Shi-Xian Yang (0009-0001-4377-4562); Kwanjit Duangsonk (0000-0002-3325-1688); Yan-Qiang Huang (0000-0002-0867-0178); Qi-Hai Zhou (0000-0002-2832-5005); Wen-Ting Zhou (0009-0004-0575-1126).
Co-corresponding authors: Qi-Hai Zhou and Wen-Ting Zhou.
Author contributions: Pang GF and Xu JY contributed equally to experimental work, data acquisition, and original drafting of the manuscript; Guan AX, Yang SX, and Duangsonk K contributed to methodology, materials, and data curation; Huang YQ and Zhou QH contributed to study supervision, project administration, and funding acquisition; Zhou WT conceived the study, supervised the project, interpreted the data, and revised the manuscript critically for important intellectual content; Zhou QH and Zhou WT contributed equally as co-corresponding authors. All authors have read and approved the final manuscript.
AI contribution statement: AI tools (specifically ChatGPT) were used solely for linguistic refinement and formatting assistance. No AI tool was involved in the generation of research data, interpretation of results, or formulation of conclusions. All AI-generated outputs were critically reviewed and revised by the authors.
Supported by Guangxi Science and Technology Major Project, No. AA23073012; National Natural Science Foundation of China, No. 32360035 and No. 32060018; and Guangxi Natural Science Foundation, No. 2025GXNSFHA069251.
Institutional review board statement: This study did not involve human participants, patient data, or human-derived specimens. All Helicobacter pylori strains used in this study were laboratory strains supplied by Professor Bi Hong-Kai. Consequently, institutional review board approval was not required.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
Data sharing statement: The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.
Corresponding author: Wen-Ting Zhou, Guangxi Technology Innovation Cooperation Base of Prevention and Control Pathogenic Microbes with Drug Resistance, Youjiang Medical University for Nationalities, No. 98 Chengxiang Road, Baise 533000, Guangxi Zhuang Autonomous Region, China. wenting_z@cmu.ac.th
Received: April 14, 2026
Revised: May 11, 2026
Accepted: June 26, 2026
Published online: November 21, 2026
Processing time: 166 Days and 23.2 Hours

Abstract
BACKGROUND

Helicobacter pylori (H. pylori) infection remains a major etiological factor in chronic gastritis, peptic ulcer disease, and gastric cancer. The increasing prevalence of antibiotic resistance underscores the urgent need for alternative anti-H. pylori agents with clearly characterised molecular targets.

AIM

To investigate whether deoxyshikonin inhibits H. pylori adhesion by modulating urease-associated pathways.

METHODS

Anti-adhesion activity of deoxyshikonin was evaluated in GES-1 and BGC823 cells using Gram staining, fluorescence microscopy, the Alamar Blue Assay, and colony counting. Potential targets were identified using drug affinity-responsive target stability-mass spectrometry and molecular docking. Urease involvement was investigated using reverse transcription-quantitative polymerase chain reaction, western blotting, surface plasmon resonance, phenol red colorimetry, and urease activity assays. A low-urease-expression 26695Δcfa mutant and exogenous urease supplementation were applied for mechanistic validation.

RESULTS

Deoxyshikonin reduced cell-associated H. pylori in a concentration-dependent manner. Molecular docking suggested a stronger binding of deoxyshikonin to UreB than to UreA (-6.1 kcal/mol vs -4.9 kcal/mol). Deoxyshikonin downregulated ureA/ureB and SabA/BabA transcripts; reduced UreB protein abundance; inhibited urease activity; and directly bound to UreB, as demonstrated by surface plasmon resonance analysis (KD = 1.193 μM). The H. pylori 26695Δcfa mutant was less susceptible to deoxyshikonin, whereas exogenous urease promoted bacterial adhesion.

CONCLUSION

Deoxyshikonin inhibits H. pylori adhesion. The current evidence indicates that the urease subunits UreA and UreB are involved as molecular targets in this effect.

Key Words: Helicobacter pylori; Deoxyshikonin; Urease; Adhesion; Mechanism

Core Tip: Deoxyshikonin exerted dose-responsive anti-adhesion activity against Helicobacter pylori in gastric epithelial cell models. Using an integrated approach combining drug affinity-responsive target stability-mass spectrometry, molecular docking, reverse transcription-quantitative polymerase chain reaction, western blotting, surface plasmon resonance, and urease activity assays, this study identifies urease, particularly UreB, as a key molecular target of deoxyshikonin. The findings further suggest that interference with urease is accompanied by concomitant changes in SabA and BabA expression; however, the precise regulatory mechanism underlying this coordinated response requires further investigation.



INTRODUCTION

A substantial proportion of the global population is infected with Helicobacter pylori (H. pylori). This organism is a major cause of chronic gastritis, peptic ulcers, and gastric cancer and has been linked to a variety of extragastric diseases. From 1980 to 2022, the global prevalence of H. pylori infection decreased from 58.2% to 43.1%; however, it remains an important clinical and public health concern[1-3]. Therapeutic strategies for H. pylori infection vary across regions. In the United States, where the infection rate is approximately 36%, bismuth-containing quadruple therapy is recommended as a first-line treatment. However, rising clarithromycin resistance complicates regimen selection and may compromise eradication success[4].

Shikonin is a bioactive naphthoquinone derived from Zicao, a traditional Chinese medicinal herb, and has a long history of medicinal use. Shikonin and its derivatives have been reported to possess broad pharmacological activities, including anti-inflammatory, anti-tumour, and antimicrobial effects[5,6]. Recent studies have also shown that deoxyshikonin inhibits H. pylori, particularly under acidic conditions; however, its direct molecular targets remain incompletely defined[7]. Shikonin has also been evaluated for anti-H. pylori activity. For example, Kuo et al[8] demonstrated that shikonin inhibited H. pylori growth in vitro. In addition, screening studies of traditional Chinese herbal medicines have shown that several herbal extracts exert inhibitory or bactericidal activity against H. pylori within selected concentration ranges and that these effects generally increase with increasing concentration[9,10]. Natural products often exert antibacterial effects through complex mechanisms involving multiple bacterial targets. Many plant-derived compounds have demonstrated anti-H. pylori effects through multiple mechanisms, ranging from direct bactericidal activity to suppression of virulence-associated factors[11,12]. Flagellar motility is closely associated with successful gastric colonization and robust infection by H. pylori[13]. BabA and SabA are two major adhesins of H. pylori that mediate bacterial attachment to gastric epithelial cells and contribute to persistent colonization[14-16]. Urease also serves as a central virulence factor. By converting urea into ammonia and carbon dioxide, urease buffers gastric acidity, facilitating survival and colonisation of H. pylori in the stomach[17,18]. Although urease has long been considered a promising therapeutic target and numerous urease inhibitors have been investigated, the clinical translation of urease-targeted agents remains limited. Notably, ecabet sodium has been used in certain countries as an adjunctive agent to suppress H. pylori urease activity; however, no urease-specific inhibitor has been widely adopted as a first-line eradication option[19,20].

The drug affinity responsive target stability (DARTS) method is a label-free strategy for target discovery that can identify small-molecule targets without chemically modifying the compound[21]. In the present study, we combined DARTS-based screening with analyses using a low-urease-expression mutant, molecular interaction assays, and functional activity assays to assess whether deoxyshikonin inhibits H. pylori adhesion by directly targeting urease and whether parallel changes in adhesin-related gene expression are involved.

MATERIALS AND METHODS
Bacterial strains and culture conditions

H. pylori strains (G27, 26695, and 26695Δcfa) were provided by Professor Hongkai Bi (Nanjing Medical University). All strains used in this study were laboratory strains; no clinical isolates, patient specimens, or human-derived materials were involved. Bacteria were cultured and routinely handled following previously described laboratory procedures[22].

Cell culture

Human gastric epithelial GES-1 cells and human gastric carcinoma BGC823 cells were maintained according to the protocol described in our previous study[22]. Cells were cultured under standard conditions and used for adhesion-related experiments upon reaching the required density for each assay.

Adhesion assays

For microscopic adhesion assessment, GES-1 cells (3 × 105 cells/well) were seeded in 6-well plates (WHB-6, lot no. 2022120701) and cultured for 24 hours. H. pylori G27 was added at a multiplicity of infection of 100:1 and treated with deoxyshikonin (Chengdu Ruifensi Biotechnology Co., Ltd, CAS: 43043-74-9, 99.53% by HPLC) at 2, 8, and 16 μg/mL for 2 hours. After Gram staining, bacterial adhesion was evaluated by light microscopy.

In fluorescence-based assays, BGC823 cells (5 × 104 cells/well) were seeded in 24-well plates (WHB-24, lot no. 2022111601) and cultured for 24 hours. H. pylori G27, 26695, or 26695Δcfa was labeled with SYTO9 (Thermo Fisher, L-7012, United States), added to the cells under the same above-mentioned treatment conditions, and observed using a fluorescence microscope (Olympus, IX73+DP80, Japan). Non-adherent bacteria were removed by washing with phosphate-buffered saline (PBS). Cells were then lysed with 5 g/L saponin (McLean, CAS: 8047-15-2, United States), and adherent bacteria were quantified by Alamar Blue fluorescence assay and dilution plating for colony enumeration. Amoxicillin was used as a positive control.

DARTS assay and protein identification

Logarithmic-phase H. pylori G27 cultures were adjusted to 1 × 108 CFU/mL and treated with deoxyshikonin at 4 μg/mL, which corresponded to the half-maximal inhibitory concentration (IC50) value determined in this study. Bacterial proteins were extracted using a lysis buffer containing Triton X-100, and the protein concentration was determined with a bicinchoninic acid protein assay kit (Beyotime, P0010, China). Deoxyshikonin (4 mg/mL) was prepared in TNC buffer (Tris, NaCl, and CaCl2) and incubated with the protein lysate at 25 °C for 30 minutes, followed by limited proteolysis with protease from Streptomyces griseus (Yuanye Bio-Technology Co., Ltd, CAS: 9036-06-0, China) at 37 °C for 5 minutes. The reaction was stopped by adding 5 × sodium-dodecyl sulfate loading buffer (Solarbio, P1040, China), and the samples were immediately boiled for 10 minutes. Proteins were separated by sodium-dodecyl sulfate gel electrophoresis at 100 V for 90 minutes and stained with Coomassie Brilliant Blue. Bands showing differential staining intensity were excised and sent to Wuhan GeneCreate Biological Engineering Co., Ltd. for mass spectrometry-based protein identification and downstream bioinformatics analysis.

Reverse transcription-quantitative polymerase chain reaction

Logarithmic-phase H. pylori G27 cultures were adjusted to 1 × 108 CFU/mL and treated with deoxyshikonin (4 μg/mL) for 8 hours. Total RNA was extracted using a Vazyme FastPure Cell/Tissue Total RNA Isolation Kit V2 following the instructions provided by the manufacturer and stored at -80 °C until use. The RNA was subsequently reverse-transcribed into complementary DNA using a reverse transcription kit (Monad, MR05101M, China). Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed on a LightCycler instrument following the kit instructions (Monad, MQ10301S, China): Pre-denaturation at 95 °C for 30 seconds, denaturation at 95 °C for 10 seconds, and extension at 60 °C for 30 seconds, for a total of 40 cycles. A dissociation curve analysis was performed to confirm amplification specificity. The 16S ribosomal RNA gene served as an internal control for data normalisation, and relative transcription levels were calculated using the 2-∆∆CT method. Each group was prepared in triplicate.

Western blotting

Logarithmic-phase H. pylori G27 cultures were adjusted to 1 × 108 CFU/mL and incubated with deoxyshikonin at 0, 4, and 16 μg/mL for 8 hours. Bacterial pellets were collected, washed twice with sterile PBS (Sangon, B040100-0005, China), and lysed in radioimmunoprecipitation assay buffer containing a protease inhibitor cocktail (Beyotime, P1005, China). Total protein was quantified using a bicinchoninic acid protein assay kit. Equal amounts of protein were separated by sodium-dodecyl sulfate gel electrophoresis and transferred onto polyvinylidene fluoride membranes. The membranes were incubated with an anti-UreB antibody (GeneTex, GTX627292; 1:10000, United States), followed by incubation with an appropriate horseradish peroxidase-conjugated secondary antibody. UreB band intensity was quantified by densitometry and normalised to total protein loading. All experiments were independently repeated three times.

Urease activity assay

Logarithmic-phase H. pylori G27 cultures were adjusted to 1 × 108 CFU/mL and treated with deoxyshikonin at 4 or 16 μg/mL for 4 hours. Acetohydroxamic acid (75 μg/mL; McLean, CAS: 546-88-3, United States) served as the positive control. Urease activity was then measured using a Urease Activity Assay Kit (Boxbio, China) following the manufacturer’s instructions, with each group tested in triplicate.

Phenol red colorimetric assay for urease activity

H. pylori G27 cultures were suspended in normal saline and adjusted to 1 × 107 CFU/mL. The bacterial suspension was mixed with a urease reaction mixture containing 15 g/L urea and phenol red indicator, and the absorbance at 590 nm was measured after 30 minutes using a microplate reader. Normal saline was used as the blank control, and acetohydroxamic acid was used as the positive control. The volume ratio of bacterial suspension to working solution was set at 5:200. Each group was measured in triplicate. This assay was performed with reference to the method reported by Lee et al[23].

Disk diffusion assay

H. pylori strains were cultured as described above, and the H. pylori 26695Δcfa strain was constructed as previously described[24]. Bacterial suspensions (OD600 nm = 0.3 and 3) were evenly spread on Columbia agar plates containing 100 mL/L calf serum using sterile cotton swabs. Filter paper discs (6 mm) were loaded with deoxyshikonin (50 or 100 μg) and placed on the inoculated plates. After incubation for 5 days under microaerobic conditions, the plates were photographed, and inhibition-zone diameters (mm) were measured.

Surface plasmon resonance experiments

A Biacore T200 instrument (Cytiva, United States) was used to determine the binding affinity of deoxyshikonin for UreB by surface plasmon resonance (SPR). After the NTA chip (Cytiva, United States) was conditioned with EDTA (350 mmol/L) and NaOH (50 mmol/L), UreB at a concentration of 25 μg/mL was immobilised on its surface for 420 seconds at a flow rate of 10 μL/minutes in PBS containing 0.5 mL/L Tween-20. Deoxyshikonin was injected at a series of concentrations: 0, 0.7812, 1.5625, 3.125, 6.25, 12.5, and 25 μM, and the binding responses were recorded. All binding analyses were conducted in PBS containing 0.5 mL/L Tween-20 at pH 7.4 and 25 °C. The association and dissociation phases were set to 120 seconds and 180 seconds, respectively. The chip surface was regenerated after each cycle using EDTA (350 mmol/L) and NaOH (50 mmol/L). Before analysis, multiple reference subtractions were conducted to remove bulk refractive index variations, injection noise, and data drift. Binding affinity was calculated by global fitting to a Langmuir 1:1 model using Biacore Evaluation software (Cytiva, United States). The reagents used included NTA chips (BR100532) and NTA kits containing Ni (28995043).

RNA interaction analysis

Nucleotide sequences of ureA, ureB, SabA, and BabA were downloaded from the NCBI Nucleotide database. Pairwise RNA-RNA interaction prediction was performed using IntaRNA via the Freiburg RNA Tools web server under default settings. As this was an exploratory and prediction-based analysis, the results were used only to assess potential transcript-level interactions and were not considered evidence of a direct regulatory relationship.

Correlation experiment between urease and adhesion

To examine the functional relationship between urease activity and bacterial adhesion, wild-type H. pylori 26695, the low-urease-expressing mutant H. pylori 26695Δcfa, and Staphylococcus aureus (S. aureus) Newman was grown to the logarithmic phase and adjusted to 1 × 108 CFU/mL. Urea was added to each bacterial suspension at a final concentration of 1.5%, and exogenous urease was added at final concentrations of 0.25, 1, or 4 μg/mL. Bacteria were labelled with SYTO9, washed thrice with PBS, and resuspended in antibiotic-free RPMI 1640 medium. BGC823 cells were seeded in 24-well plates at 1 × 105 cells/well and cultured for 24 hours. The labelled bacteria were then added to BGC823 cells at a multiplicity of infection of 100:1 and co-incubated for 2 hours in the presence or absence of deoxyshikonin (16 μg/mL). After washing, bacterial adhesion was examined using an inverted fluorescence microscope.

Statistical analysis

Data were analysed using GraphPad Prism 7.0. Results are expressed as the mean ± SD from three independent experiments. Two-group comparisons were performed using Student’s t test, whereas multiple-group comparisons were performed using one-way analysis of variance followed by an appropriate post hoc multiple-comparison test. Statistical significance was defined as P < 0.05.

RESULTS
Deoxyshikonin inhibits H. pylori adhesion

Gram staining showed that H. pylori attached abundantly to GES-1 cells in the PBS control group, and the extent of adhesion decreased with increasing deoxyshikonin concentrations (Figure 1A). SYTO9 labelling showed that BGC823 cells exhibited red fluorescence, whereas bacteria exhibited green fluorescence. Consistently, H. pylori adhesion showed a concentration-dependent decrease, in agreement with the Gram staining results (Figure 1B).

Figure 1
Figure 1 Anti-adhesion activity of deoxyshikonin on Helicobacter pylori. A: Helicobacter pylori (H. pylori) adhesion to GES-1 cells after deoxyshikonin exposure, assessed by Gram staining; B: Adhesion of extracellular H. pylori to BGC823 cells after deoxyshikonin treatment, assessed by inverted fluorescence microscopy; C: Quantification of cell-associated H. pylori in BGC823 cells after deoxyshikonin exposure, assessed by the Alamar Blue assay; D: Inhibitory effect of deoxyshikonin on cell-associated H. pylori in BGC823 cells, assessed using the dilution plating method. aP < 0.05 vs phosphate-buffered saline, bP < 0.01 vs phosphate-buffered saline, fP < 0.01 vs amoxicillin, and gP < 0.001 vs amoxicillin. PBS: Phosphate-buffered saline; AMX: Amoxicillin; MIC: Minimum inhibitory concentration; RFU: Relative fluorescence units.

Quantitative analysis further showed that cell-associated H. pylori progressively decreased with increasing deoxyshikonin concentrations (Figure 1C). Colony counting also confirmed that the number of recovered H. pylori colonies decreased in a concentration-dependent manner (Figure 1D). Together, these data indicate that deoxyshikonin reduces H. pylori cell association and colony recovery in a concentration-dependent manner.

Identification of deoxyshikonin-binding proteins in H. pylori by DARTS

The IC50 of deoxyshikonin against H. pylori strain G27 was determined to be 4 μg/mL (Figure 2A). DARTS performed at this concentration revealed differential protein bands (Figure 2B). These bands were excised and sent to Wuhan GeneCreate Biological Engineering Co., Ltd. for protein identification. The data were analysed using the ProteinPilot software with the AB SCIEX TripleTOF® 5600+ mass spectrometer. The Venn diagram showed that 91 proteins were identified, including 21 and 25 unique proteins in the control and experimental groups, respectively (Figure 2C). Gene Ontology (GO) enrichment analysis indicated that the identified proteins were mainly associated with cellular and metabolic processes (Figure 2D). Cluster of Orthologous Groups (COG) annotation primarily associated these proteins with translation, ribosomal structure and biogenesis, as well as posttranslational modification, protein turnover, and chaperones (Figure 2E). Paralog analysis revealed enrichment of P-loop-containing nucleoside triphosphate hydrolases (Figure 2F). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis highlighted metabolic pathways, biosynthesis of secondary metabolites, and microbial metabolism in diverse environments (Figure 2G). Subcellular localization prediction using WoLFPSORT and PSORTb indicated that most of the identified proteins were localised to the cytoplasm, whereas a smaller proportion was predicted to reside in the cytoplasmic membrane (Figure 2H).

Figure 2
Figure 2 Drug affinity responsive target stability-based identification of candidate deoxyshikonin-binding proteins. A: Half-maximal inhibitory concentration curve for deoxyshikonin against Helicobacter pylori G27; B: Sodium-dodecyl sulfate gel electrophoresis gel image showing differential protein bands generated at different protease concentrations; C: Venn diagram of identified proteins; D: Gene Ontology functional annotation; E: Cluster of Orthologous Groups functional annotation; F: Paralog analysis; G: Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis; H: Subcellular localization prediction. PBS: Phosphate-buffered saline; MIC: Minimum inhibitory concentration; COG: Cluster of Orthologous Groups.
Molecular docking of deoxyshikonin with H. pylori-related proteins

Based on protein identification and quantitative results, 11 candidate target proteins were selected through integrated analysis of protein identification confidence (unused ProtScore ≥ 1.3, corresponding to ≥ 95% confidence); quantitative differences between the deoxyshikonin-treated (S2) and dimethyl sulfoxide control (D1) groups; GO and COG functional annotations; KEGG pathway enrichment; and subcellular localisation predictions (WoLF PSORT/PSORTb). GO analysis indicated that the 91 overlapping proteins were predominantly enriched in cellular and metabolic processes; COG annotation revealed that these proteins were associated with translation, ribosomal biogenesis, and post-translational modification; KEGG enrichment analysis further highlighted their involvement in metabolic pathways and the biosynthesis of secondary metabolites. Subcellular localisation prediction indicated that most candidates were cytoplasmic, with a subset predicted to localise to the cytoplasmic membrane. Based on these combined criteria, 11 proteins with potential relevance to H. pylori virulence, colonisation, or metabolic fitness were selected for STRING protein-protein interaction network analysis. A complete list of these 11 proteins, together with their mass spectrometry identification parameters, is provided in Supplementary Table 1. It should be noted that DARTS detects changes in protease sensitivity upon ligand binding; therefore, the resulting candidate list may include indirect interactors or spatially proximate proteins. Accordingly, these hits were considered preliminary candidates requiring orthogonal validation. Notably, the outer-membrane adhesins SabA and BabA were not identified among the DARTS candidates, suggesting that deoxyshikonin does not directly bind to these proteins. Protein network interaction analysis was performed using the STRING database (Figure 3A). The network revealed a high-confidence interaction between UreA and UreB. The three-dimensional structures of the corresponding proteins were retrieved from UniProt (https://www.uniprot.org/). Deoxyshikonin was docked with each target protein using AutoDockTools 1.5.6 software, and the lowest-energy binding conformation was selected for visualisation in PyMOL. Deoxyshikonin could occupy the binding pockets of UreA (Figure 3B) and UreB (Figure 3C), with binding energies of -4.9 and -6.1 kcal/mol, respectively. The docking analysis indicated that deoxyshikonin formed hydrogen bonds, van der Waals interactions, and π- Sigma/alkyl interactions within the protein binding pockets. For UreA, deoxyshikonin formed hydrogen bond interactions with Leu65, along with additional van der Waals interactions involving Gln59, Thr63, Leu64, Pro99, and Ile100. Meanwhile, the naphthoquinone ring of deoxyshikonin formed π-alkyl interactions with Arg62, Lys66, and Pro67. For UreB, a hydrogen bond was formed with Gly279, and van der Waals interactions were observed with Asn168, Gly280, His248, His274, and His322. The naphthoquinone ring of deoxyshikonin further formed π-Cation, π-π stacking, and π-Sigma interactions with Arg348, His221, and Ala169 of UreB. These contacts support the formation of stable deoxyshikonin-protein complexes within the predicted pockets. AutoDock Vina was used for semi-flexible docking, and the binding energy data are summarised in Table 1. As previously reported, an AutoDock Vina docking score lower than -7.0 kcal/mol indicates strong binding affinity, a score between -5.0 and -7.0 kcal/mol indicates favourable binding capability, while a score between -5.0 and -4.25 kcal/mol suggests detectable interaction. The docking scores suggest that deoxyshikonin can interact with both UreA and UreB, with a preferential affinity for UreB.

Figure 3
Figure 3 Molecular docking. A: STRING protein interaction network; B: Docking model of deoxyshikonin bound to UreA; C: Docking model of deoxyshikonin bound to UreB.
Table 1 Molecular docking binding energy data.
UniProt accession
Target protein
PDB ID
Ligand
Binding energy (kcal/mol)
Grid center (x, y, z)
Grid size (x, y, z)
P69996UreB1E9YDeoxyshikonin-6.1127.68, 126.29, 87.3720, 20, 20
P14916UreA1E9ZDeoxyshikonin-4.9146.94, 115.36, 52.2120, 20, 20
Deoxyshikonin specifically binds to H. pylori urease

After identifying urease as a candidate target through DARTS and molecular docking, we examined whether deoxyshikonin treatment affected urease expression and enzymatic activity. In the phenol red assay, yellow colouration inhibits urease activity (maintenance of an acidic pH), whereas red colouration indicates active urease (alkaline pH shift). Deoxyshikonin (128 μg/mL) significantly inhibited H. pylori urease activity, as evidenced by the yellow colouration (Figure 4A and B). To further assess urease involvement in the antibacterial activity of deoxyshikonin to urease, the H. pylori 26695Δcfa strain, which exhibits reduced urease expression, was used. RT-qPCR analysis showed (Figure 4C) that the expression levels of ureA and ureB were significantly reduced in this mutant. The antibacterial activity of deoxyshikonin on H. pylori 26695Δcfa was assessed using the disc diffusion assay. It showed that the inhibition zone for H. pylori 26695Δcfa was smaller than that for wild-type H. pylori 26695 (Figure 4D; Table 2), indicating that reduced urease expression in the Δcfa mutant was associated with decreased susceptibility to deoxyshikonin. At 4 μg/mL, deoxyshikonin inhibited urease activity by 43%, and at 8 μg/mL, it significantly inhibited urease activity (Figure 4E).

Figure 4
Figure 4 Deoxyshikonin-mediated inhibition of Helicobacter pylori urease activity. A and B: Representative phenol red colorimetric images and quantitative analysis of deoxyshikonin-mediated urease inhibition in the G27 strain. aP < 0.05 vs phosphate-buffered saline, bP < 0.01 vs phosphate-buffered saline, cP < 0.001 vs phosphate-buffered saline, eP < 0.05 vs acetohydroxamic acid, and fP < 0.01 vs acetohydroxamic acid; C: Relative mRNA expression measured by reverse transcription-quantitative polymerase chain reaction in the standard Helicobacter pylori (H. pylori) 26695 strain and the mutant strain 26695Δcfa. bP < 0.01 vs control, dP < 0.0001 vs control; D: Inhibition-zone results for the standard H. pylori 26695 strain and the mutant strain H. pylori 26695Δcfa following exposure to different concentrations of deoxyshikonin; E: Inhibition rate of deoxyshikonin against urease activity in the G27 strain, determined using a urease assay kit. cP < 0.001 vs phosphate-buffered saline, dP < 0.0001 vs phosphate-buffered saline, and jP < 0.001 vs acetohydroxamic acid. PBS: Phosphate-buffered saline; AHA: Acetohydroxamic acid.
Table 2 Diameters of inhibition zones (mm) in wild-type Helicobacter pylori 26695 and 26695Δcfa strains after deoxyshikonin treatment.
Strains (amount of bacteria)
50 μg/disk deoxyshikonin
100 μg/disk deoxyshikonin
H. pylori 26695 (109 CFU/mL)7.2259.25
H. pylori 26695Δcfa (109 CFU/mL)7.1758.4
H. pylori 26695 (108 CFU/mL)8.27510.3
H. pylori 26695Δcfa (108 CFU/mL)8.059.3
Deoxyshikonin-induced downregulation of urease and adhesin genes in H. pylori

Urease subunits UreA and UreB are mainly synthesised in the cytosol, with a fraction associated with the cell membrane. SabA and BabA are outer-membrane adhesins. Exploratory computational RNA-RNA interaction analysis using IntaRNA predicted potential transcript-level interactions among the mRNAs encoding these genes (Supplementary Figure 1), although these predictions require further experimental validation. To experimentally assess the effects of deoxyshikonin on these transcripts, RT-qPCR was performed. After treatment with deoxyshikonin (4 μg/mL) for 8 hours, the transcript levels of SabA, BabA, ureA, and ureB were significantly downregulated (Figure 5A). Western blotting was used to evaluate UreB protein expression in H. pylori treated with deoxyshikonin (0, 4, and 16 μg/mL). The results showed that deoxyshikonin (4 and 16 μg/mL) reduced UreB protein expression in a concentration-dependent manner (Figure 5B and C). The primer sequences are listed in Table 3. SPR analysis demonstrated that deoxyshikonin, tested at concentrations of 0, 0.7812, 1.5625, 3.125, 6.25, 12.5, and 25 μM, directly bound to the UreB protein immobilised on the chip surface, indicating a specific interaction (Figure 5D, KD = 1.193 μM). These findings support the interpretation that deoxyshikonin binds to H. pylori urease and inhibits its activity.

Figure 5
Figure 5 Deoxyshikonin reduces the expression of Helicobacter pylori adhesion- and urease-related genes. A: Reverse transcription-quantitative polymerase chain reaction analysis of the relative mRNA expression levels of SabA, BabA, ureA, and ureB after deoxyshikonin treatment; dP < 0.0001 vs the control group; B: Representative western blot showing UreB protein expression in Helicobacter pylori treated with 0, 4, and 16 μg/mL deoxyshikonin; C: Quantification of UreB protein expression normalised to total protein loading; bP < 0.01 vs the 0 μg/mL deoxyshikonin group, dP < 0.0001 vs the 0 μg/mL deoxyshikonin group, gP < 0.001 vs the 4 μg/mL deoxyshikonin; D: Surface plasmon resonance sensorgrams showing the binding interaction between deoxyshikonin and UreB protein.
Table 3 Primer sequences used in this study.
Number
Primer name
Sequence (5’-3’)
1UreA-FGCCAATGGTAAATTAGTT
2UreA-RCTCCTTAATTGTTTTTAC
3UreB-FTCTATCCCTACCCCACAACC
4UreB-RCCATCCACGAACACATGGTA
5SabA-FAAAGCATTCAAAACGCCAAC
6SabA-RCCCGCATAAAGACTCCAAAA
7BabA-FATCGATCCACTTCCATCACT
8BabA-RGTTACGCTTTTGCCGTCTAT

To further evaluate the relationship between urease and adhesion, adhesion of wild-type H. pylori 26695 and the low-urease-expression mutant H. pylori 26695Δcfa to BGC823 cells was compared following deoxyshikonin treatment. Fluorescence microscopy showed that under the same deoxyshikonin treatment, the green fluorescence signal, which indicates bacterial adhesion, was weaker for the Δcfa mutant than for the wild-type strain, indicating a reduced adhesion capacity (Figure 6).

Figure 6
Figure 6 Deoxyshikonin reduces the adhesion of wild-type and low-urease-expression Helicobacter pylori strains to BGC823 cells. PBS: Phosphate-buffered saline.

To further test the functional link between urease and adhesion, exogenous urease supplementation experiments were performed (Figure 7). Wild-type H. pylori 26695, the Δcfa mutant, and S. aureus Newman, which served as a urease-negative control, were co-incubated with BGC823 cells in the presence of increasing concentrations of exogenous urease (0.25, 1, and 4 μg/mL), urea, and deoxyshikonin. BGC823 cells exhibited endogenous Rhodamine red fluorescence, whereas bacteria were labelled with SYTO9 and visualised in green. The adhesion capacity of all three strains increased with increasing concentrations of exogenous urease, including the urease-negative S. aureus, suggesting that urease may facilitate bacterial-cell interaction, at least in part, through a non-species-specific mechanism. In the presence of deoxyshikonin, adhesion was attenuated but not completely abolished at higher urease concentrations, supporting the notion that deoxyshikonin exerts its anti-adhesion effect, at least partially, by interfering with urease function. The differential adhesion observed among strains with varying endogenous urease levels further supports a functional association between urease activity and bacterial adhesion.

Figure 7
Figure 7 Exogenous urease enhances bacterial adhesion to BGC823 cells. A and B: Representative fluorescence images and quantification of Helicobacter pylori 26695 adhesion to BGC823 cells in the presence of exogenous urease; C and D: Representative fluorescence images and quantitative analysis of Helicobacter pylori 26695Δcfa adhesion to BGC823 cells in the presence of exogenous urease; E and F: Representative fluorescence images and quantitative analysis of the adhesion of the Newman strain to BGC823 cells in the presence of exogenous urease. BGC823 cells are shown in rhodamine red, bacteria are labelled with SYTO9 green, and merged images show bacterial attachment to host cells. aP < 0.05 vs phosphate-buffered saline, bP < 0.01 vs phosphate-buffered saline, cP < 0.001 vs phosphate-buffered saline, eP < 0.05 vs 0.25 μg/mL urease, fP < 0.01 vs 0.25 μg/mL urease, gP < 0.001 vs 0.25 μg/mL urease, iP < 0.05 vs 1 μg/mL urease. PBS: Phosphate-buffered saline.
DISCUSSION

Although many natural products have been reported to exhibit anti-H. pylori activity, defining their specific molecular targets remains challenging. In this study, we provide evidence that deoxyshikonin may inhibit bacterial adhesion partly through interaction with urease, particularly UreB. Our previous study demonstrated that deoxyshikonin exhibits potent inhibitory activity against H. pylori, with a minimum inhibitory concentration (MIC) of 0.5-1 μg/mL[22]. Evaluation of bacterial morphology and phenotypic changes can provide a direct approach for preliminary target identification[25,26]. Adhesion is a critical initial step in H. pylori pathogenesis. Our previous work showed that deoxyshikonin inhibits H. pylori adhesion to gastric epithelial cells, prompting us to investigate adhesion-associated proteins as potential drug targets. Adhesion and colonisation by H. pylori are required for disease initiation[27,28], and multiple factors contribute to adhesion, including the adhesins SabA and BabA, flagella, pili, biofilm, and urease.

Through DARTS-based screening, we identified UreA and UreB as the primary deoxyshikonin-binding proteins. Subsequent molecular docking, RT-qPCR, western blotting, and SPR analyses collectively support urease as a key target of deoxyshikonin. UreB emerges as the most robustly validated binding partner, while UreA remains a candidate interacting subunit. Experiments using the H. pylori 26695Δcfa low-urease-expression mutant provided supportive, though not definitive, genetic evidence; the generation of a direct ureB-deletion mutant will be necessary for conclusive proof. Molecular docking identified key binding residues, including Gln59, Thr63, Leu64, Pro99, and Ile100 for UreA and Asn168, Gly280, His248, His274, and His322 for UreB. Urease is a major virulence factor of H. pylori, playing essential roles in acid neutralisation, adhesion, colonisation, and metabolism. It facilitates the hydrolysis of urea, producing ammonia and carbamate, which subsequently decomposes into an additional molecule of ammonia and carbonate. Carbonic acid then dissociates into carbon dioxide and water, while ammonia neutralises gastric acid, maintaining the peribacterial pH at approximately 6.1 and ensuring the survival of H. pylori in the stomach[29]. By binding to and functionally inhibiting the UreA and UreB subunits, deoxyshikonin disrupts acid neutralisation, thereby reducing bacterial adhesion and colonisation.

BabA and SabA are key outer-membrane adhesins of H. pylori that recognise host glycan receptors in the gastroduodenal tract. Adhesins and urease act synergistically during H. pylori colonisation: Adhesins mediate direct attachment to gastric epithelial cells, while urease-generated ammonia creates a locally buffered microenvironment that supports persistent colonisation. In our DARTS experiments, SabA and BabA were not detected as direct deoxyshikonin-binding proteins. However, RT-qPCR analysis revealed significant downregulation of SabA and BabA transcripts following deoxyshikonin treatment. This finding suggests that the changes in SabA and BabA expression are likely secondary or indirect effects of urease inhibition rather than a result of direct targeting by deoxyshikonin. Notably, the ArsRS two-component regulatory system of H. pylori has been reported to co-regulate urease and outer-membrane adhesin gene expression, providing a possible signalling framework by which perturbation of urease could secondarily alter SabA and BabA transcription. Exploratory IntaRNA-based RNA-RNA interaction analysis also predicted potential transcript-level interactions between ureA/ureB and SabA/BabA mRNAs (Supplementary Figure 1), suggesting that perturbation of urease gene expression may influence adhesin transcript stability or regulation. However, this computational prediction remains experimentally unvalidated and should be interpreted with caution. Whether deoxyshikonin affects the ArsRS signalling cascade as a mechanism linking urease inhibition to adhesin downregulation is an important question for future investigation.

Overall, the data support a model in which urease represents a principal, though likely not the sole, molecular target of deoxyshikonin, particularly UreB, resulting in reduced urease activity, impaired local acid acclimation, a diminished capacity of H. pylori to maintain a favourable peribacterial microenvironment, and consequently decreased bacterial adhesion and colonisation. The downregulation of SabA and BabA may reflect an indirect consequence of urease inhibition, potentially mediated through regulatory networks such as ArsRS, rather than a direct pharmacological effect. The current data do not exclude the possibility that deoxyshikonin interacts with additional molecular targets beyond urease.

Several limitations should be considered. First, the mechanistic findings were obtained in vitro and require validation in animal or in vivo colonisation studies. Second, the H. pylori 26695Δcfa strain was used as a low-urease-expression model rather than as a direct urease knockout, and therefore the genetic evidence remains supportive but not definitive; the construction of a targeted ureB-deletion mutant is needed for conclusive genetic verification. Third, the RNA interaction analysis was exploratory and computational and did not experimentally prove a regulatory mechanism. Fourth, the adhesion assays in this study quantified cell-associated bacteria after washing and host-cell lysis and did not specifically differentiate surface-adherent from intracellular bacteria. Fifth, certain experiments employed deoxyshikonin at concentrations substantially exceeding the IC50 (4 μg/mL) and MIC (0.5-1 μg/mL); at such doses, contributions from non-specific cytotoxicity or growth inhibition cannot be fully excluded. Sixth, the exogenous urease supplementation assay showed that urease also augmented adhesion of the urease-negative S. aureus strain, suggesting that urease may promote bacterial-cell interactions through non-species-specific mechanisms in addition to any H. pylori-specific effects. Future studies should further validate the direct binding interface between deoxyshikonin and urease using a targeted ureB-deletion mutant; conduct dose-response mechanistic experiments within a concentration range encompassing the IC50/MIC; determine whether UreB serves as the dominant functional target in vivo; and elucidate how urease inhibition secondarily affects adhesin-related pathways during colonisation.

CONCLUSION

Deoxyshikonin inhibits H. pylori adhesion and colonisation-related phenotypes in vitro. The available evidence supports urease, particularly UreA and UreB, as the primary molecular targets of deoxyshikonin, accompanied by coordinated changes in adhesin gene expression. Further studies are needed to determine whether additional targets contribute to the overall pharmacological effect. These findings provide mechanistic support for further development of deoxyshikonin as a nontraditional anti-H. pylori lead compound.

ACKNOWLEDGEMENTS

The authors thank Professor Bi Hong-Kai of Nanjing Medical University for providing the Helicobacter pylori strains used in this study.

References
1.  Moss SF, Shah SC, Tan MC, El-Serag HB. Evolving Concepts in Helicobacter pylori Management. Gastroenterology. 2024;166:267-283.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 91]  [Cited by in RCA: 88]  [Article Influence: 44.0]  [Reference Citation Analysis (12)]
2.  Li Y, Choi H, Leung K, Jiang F, Graham DY, Leung WK. Global prevalence of Helicobacter pylori infection between 1980 and 2022: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol. 2023;8:553-564.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 392]  [Cited by in RCA: 389]  [Article Influence: 129.7]  [Reference Citation Analysis (17)]
3.  Katelaris P, Hunt R, Bazzoli F, Cohen H, Fock KM, Gemilyan M, Malfertheiner P, Mégraud F, Piscoya A, Quach D, Vakil N, Vaz Coelho LG, LeMair A, Melberg J. Helicobacter pylori World Gastroenterology Organization Global Guideline. J Clin Gastroenterol. 2023;57:111-126.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 161]  [Cited by in RCA: 141]  [Article Influence: 47.0]  [Reference Citation Analysis (0)]
4.  Chey WD, Howden CW, Moss SF, Morgan DR, Greer KB, Grover S, Shah SC. ACG Clinical Guideline: Treatment of Helicobacter pylori Infection. Am J Gastroenterol. 2024;119:1730-1753.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 255]  [Cited by in RCA: 267]  [Article Influence: 133.5]  [Reference Citation Analysis (2)]
5.  Andújar I, Ríos JL, Giner RM, Recio MC. Pharmacological properties of shikonin - a review of literature since 2002. Planta Med. 2013;79:1685-1697.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 184]  [Cited by in RCA: 211]  [Article Influence: 16.2]  [Reference Citation Analysis (0)]
6.  Yadav S, Sharma A, Nayik GA, Cooper R, Bhardwaj G, Sohal HS, Mutreja V, Kaur R, Areche FO, AlOudat M, Shaikh AM, Kovács B, Mohamed Ahmed AE. Review of Shikonin and Derivatives: Isolation, Chemistry, Biosynthesis, Pharmacology and Toxicology. Front Pharmacol. 2022;13:905755.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 113]  [Cited by in RCA: 78]  [Article Influence: 19.5]  [Reference Citation Analysis (2)]
7.  Xu JY, Dong HH, Liao LJ, Yang SX, Wang LY, Chen H, Luo P, Huang L, Guan AX, Huang YQ. Erratum for Xu et al., "Deoxyshikonin: a promising lead drug grass against drug resistance or sensitivity to Helicobacter pylori in an acidic environment". Antimicrob Agents Chemother. 2025;69:e0184024.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
8.  Kuo HM, Hsia TC, Chuang YC, Lu HF, Lin SY, Chung JG. Shikonin inhibits the growth and N-acetylation of 2-aminofluorene in Helicobacter pylori from ulcer patients. Anticancer Res. 2004;24:1587-1592.  [PubMed]  [DOI]
9.  Li Y, Xu C, Zhang Q, Liu JY, Tan RX. In vitro anti-Helicobacter pylori action of 30 Chinese herbal medicines used to treat ulcer diseases. J Ethnopharmacol. 2005;98:329-333.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 146]  [Cited by in RCA: 125]  [Article Influence: 6.0]  [Reference Citation Analysis (1)]
10.  Ma F, Chen Y, Li J, Qing HP, Wang JD, Zhang YL, Long BG, Bai Y. Screening test for anti-Helicobacter pylori activity of traditional Chinese herbal medicines. World J Gastroenterol. 2010;16:5629-5634.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 45]  [Cited by in RCA: 44]  [Article Influence: 2.8]  [Reference Citation Analysis (1)]
11.  Wu H, Song Q, Wang Y, Manzoor R, Yang X, Li X, Ye X, Ma H. Compounds of Plant Origin: The Blue Ocean of Anti-Helicobacter pylori Medicines. Phytother Res. 2025;39:4282-4307.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
12.  Wang YC. Medicinal plant activity on Helicobacter pylori related diseases. World J Gastroenterol. 2014;20:10368-10382.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 139]  [Cited by in RCA: 118]  [Article Influence: 9.8]  [Reference Citation Analysis (0)]
13.  Ottemann KM, Lowenthal AC. Helicobacter pylori uses motility for initial colonization and to attain robust infection. Infect Immun. 2002;70:1984-1990.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 263]  [Cited by in RCA: 247]  [Article Influence: 10.3]  [Reference Citation Analysis (1)]
14.  Ilver D, Arnqvist A, Ogren J, Frick IM, Kersulyte D, Incecik ET, Berg DE, Covacci A, Engstrand L, Borén T. Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science. 1998;279:373-377.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 960]  [Cited by in RCA: 831]  [Article Influence: 29.7]  [Reference Citation Analysis (3)]
15.  Kusters JG, van Vliet AH, Kuipers EJ. Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev. 2006;19:449-490.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Reference Citation Analysis (0)]
16.  Mahdavi J, Sondén B, Hurtig M, Olfat FO, Forsberg L, Roche N, Angstrom J, Larsson T, Teneberg S, Karlsson KA, Altraja S, Wadström T, Kersulyte D, Berg DE, Dubois A, Petersson C, Magnusson KE, Norberg T, Lindh F, Lundskog BB, Arnqvist A, Hammarström L, Borén T. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science. 2002;297:573-578.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 744]  [Cited by in RCA: 664]  [Article Influence: 27.7]  [Reference Citation Analysis (3)]
17.  Eaton KA, Brooks CL, Morgan DR, Krakowka S. Essential role of urease in pathogenesis of gastritis induced by Helicobacter pylori in gnotobiotic piglets. Infect Immun. 1991;59:2470-2475.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 497]  [Cited by in RCA: 489]  [Article Influence: 14.0]  [Reference Citation Analysis (0)]
18.  Weeks DL, Eskandari S, Scott DR, Sachs G. A H+-gated urea channel: the link between Helicobacter pylori urease and gastric colonization. Science. 2000;287:482-485.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 417]  [Cited by in RCA: 341]  [Article Influence: 13.1]  [Reference Citation Analysis (1)]
19.  Almarmouri C, El-Gamal MI, Haider M, Hamad M, Qumar S, Sebastian M, Ghemrawi R, Muhammad JS, Burucoa C, Khoder G. Anti-urease therapy: a targeted approach to mitigating antibiotic resistance in Helicobacter pylori while preserving the gut microflora. Gut Pathog. 2025;17:37.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 17]  [Reference Citation Analysis (0)]
20.  Chen X, Gou L, Wang Y, Yang J, Dong Y, Xie B, Zhang D. New Directions in Helicobacter pylori Urease Inhibitors: Focusing on Nickel Ions Transfer and Auxiliary Protein Interactions During Urease Maturation. Infect Drug Resist. 2025;18:3037-3053.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 4]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
21.  Ren YS, Li HL, Piao XH, Yang ZY, Wang SM, Ge YW. Drug affinity responsive target stability (DARTS) accelerated small molecules target discovery: Principles and application. Biochem Pharmacol. 2021;194:114798.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 167]  [Article Influence: 33.4]  [Reference Citation Analysis (0)]
22.  Xu J-y, Dong H-h, Liao L-j, Yang S-x, Wang L-y, Chen H, Luo P, Huang L, Guan A-x, Huang Y-Q. Deoxyshikonin: a promising lead drug grass against drug resistance or sensitivity to Helicobacter pylori in an acidic environment. Antimicrob Agents Chemother. 2024;68:e0095924.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
23.  Lee SM, Park SY, Kim MJ, Cho EA, Jun CH, Park CH, Kim HS, Choi SK, Rew JS. Key lime (Citrus aurantifolia) inhibits the growth of triple drug resistant Helicobacter pylori. Gut Pathog. 2018;10:16.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 8]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
24.  Jiang X, Duan Y, Zhou B, Guo Q, Wang H, Hang X, Zeng L, Jia J, Bi H. The Cyclopropane Fatty Acid Synthase Mediates Antibiotic Resistance and Gastric Colonization of Helicobacter pylori. J Bacteriol. 2019;201:e00374-e00319.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 36]  [Article Influence: 5.1]  [Reference Citation Analysis (1)]
25.  Pinho AS, Seabra CL, Nunes C, Reis S, L Martins MC, Parreira P. Helicobacter pylori biofilms are disrupted by nanostructured lipid carriers: A path to eradication? J Control Release. 2022;348:489-498.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 15]  [Reference Citation Analysis (0)]
26.  Sisto F, Carradori S, D'Alessandro S, Santo N, Lattuada N, Haynes RK, Taramelli D, Grande R. In Vitro Activity of the Arylaminoartemisinin GC012 against Helicobacter pylori and Its Effects on Biofilm. Pathogens. 2022;11:740.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 12]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
27.  Sharndama HC, Mba IE. Helicobacter pylori: an up-to-date overview on the virulence and pathogenesis mechanisms. Braz J Microbiol. 2022;53:33-50.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 203]  [Cited by in RCA: 168]  [Article Influence: 42.0]  [Reference Citation Analysis (1)]
28.  Younson J, O'Mahony R, Liu H, Basset C, Grant S, Campion C, Jennings L, Vaira D, Kelly CG, Roitt IM, Holton J. A human domain antibody and Lewis b glycoconjugate that inhibit binding of Helicobacter pylori to Lewis b receptor and adhesion to human gastric epithelium. J Infect Dis. 2009;200:1574-1582.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 8]  [Cited by in RCA: 9]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
29.  Marcus EA, Moshfegh AP, Sachs G, Scott DR. The periplasmic alpha-carbonic anhydrase activity of Helicobacter pylori is essential for acid acclimation. J Bacteriol. 2005;187:729-738.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 133]  [Cited by in RCA: 141]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B

Novelty: Grade B, Grade C

Creativity or innovation: Grade B, Grade C

Scientific significance: Grade C, Grade C

P-Reviewer: Tastekin D, PhD, United States; Yildirim HC, PhD, Ukraine S-Editor: Wu S L-Editor: A P-Editor: Yang YQ

Write to the Help Desk