BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Gastroenterol. Sep 21, 2026; 32(35): 121494
Published online Sep 21, 2026. doi: 10.3748/wjg.121494
Tn antigen-driven downregulation of podoplanin promotes colorectal cancer invasion
Li-Wen Fan, Qi Lin, Jia-Xin Du, School of Clinical Medicine, The Hebei University of Engineering, Handan 056000, Hebei Province, China
Xin-Zhe Wu, Zi-Wei Liu, Xi-Chen Dong, Medical Research Center, Beijing Chao-Yang Hospital, Capital Medical University, Beijing 100021, China
Yan-Tao Tian, Department of Pancreatic and Gastric Surgery, National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100021, China
Dong-Kui Xu, Department of Very Important Person, National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100021, China
ORCID number: Li-Wen Fan (0009-0004-2483-6045); Xin-Zhe Wu (0009-0002-6829-4845); Zi-Wei Liu (0009-0005-9503-0548); Qi Lin (0009-0004-7774-3408); Jia-Xin Du (0009-0005-4047-9516); Yan-Tao Tian (0000-0002-7189-3999); Xi-Chen Dong (0000-0003-3282-7929); Dong-Kui Xu (0000-0003-0605-8273).
Co-corresponding authors: Xi-Chen Dong and Dong-Kui Xu.
Author contributions: Fan LW performed the experiments and wrote the original manuscript; Wu XZ performed the analysis of single-cell RNA sequencing data; Liu ZW conducted parts of the experimental work; Lin Q and Du JX contributed to data analysis; Dong XC was responsible for overall study design and supervision; Tian YT was primarily responsible for data collection; Xu KD as the principal investigator of the project, was responsible for the overall design and strategic direction of the study, providing framing the key scientific questions, participated in the design of validation of critical methodologies, and the construction of the analytical framework for the results, offered crucial feedback on the scientific logic, data interpretation, and conclusion development of the manuscript, and performed comprehensive review, revision, and final approval of the submitted work.
AI contribution statement: AI tools (specifically ChatGPT) were used solely for linguistic refinement and formatting assistance. No AI tool was involved in the generation of research data, interpretation of results, or formulation of conclusions. All AI-generated outputs were critically reviewed and revised by the authors.
Supported by the National High Level Hospital Clinical Research Funding; and National Natural Science Foundation of China, No. 82372989.
Institutional review board statement: This study does not involve any human experiments.
Institutional animal care and use committee statement: All animal experiments were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences (approval No. NCC2023A165).
Conflict-of-interest statement: The authors declare that they have no conflict of interest.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: All data generated or analyzed during this study are included in this article. Further inquiries can be directed to the corresponding author. The public dataset used in this study is available in the Gene Expression Omnibus repository under accession number GSE132465.
Corresponding author: Dong-Kui Xu, MD, Professor, Department of Very Important Person, National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, No. 17 Panjiayuan Nanli, Chaoyang District, Beijing 100021, China. 13691583382@163.com
Received: March 27, 2026
Revised: May 9, 2026
Accepted: June 18, 2026
Published online: September 21, 2026
Processing time: 148 Days and 18.4 Hours

Abstract
BACKGROUND

Colorectal cancer (CRC) is the third most common malignant tumor and the second leading cause of cancer-related death worldwide. Abnormal O-glycosylation of proteins are a significant molecular feature of CRC, with high Tn antigen expression closely associated with tumor invasion and metastasis. Podoplanin (PDPN) is a highly O-glycosylated transmembrane mucin that is aberrantly expressed in various tumors, but its specific function in CRC remains incompletely understood.

AIM

To investigate the functional role of abnormally O-glycosylated PDPN (marked by Tn antigen expression) in CRC.

METHODS

In this study, clustered regularly interspaced short palindromic repeats associated protein 9 technology was used to knock out the C1GALT1 gene in CRC cells. Wild-type-PDPN and O-glycosylation-mutated (mu-PDPN) overexpression vectors were constructed. Cell counting kit-8 and Transwell assays were used to evaluate cell proliferation and migration capabilities, while western blotting was performed to detect the expression of epithelial-mesenchymal transition (EMT)-related markers. A nude mouse subcutaneous xenograft model was established to evaluate tumor growth in vivo, and immunohistochemistry was used to detect Ki67 expression. Furthermore, single-cell RNA sequencing data were obtained from the Gene Expression Omnibus database (GSE132465).

RESULTS

High expression of the Tn antigen was detected in CRC tissue samples. Compared with that in the control group, high Tn antigen expression induced by C1GALT1 knockout significantly increased the proliferation and migration capabilities of cancer cells, accompanied by a decrease in PDPN protein levels. Functionally, the overexpression of PDPN effectively inhibited cell proliferation and migration, whereas the overexpression of mu-PDPN lost this tumor-suppressive effect. Furthermore, mu-PDPN induced the upregulation of vimentin and Snail expression and the downregulation of E-cadherin and zonula occludens-1 expression during EMT. In vivo experiments further confirmed that mu-PDPN promoted the growth of mouse xenograft tumors and increased the percentage of Ki67-positive tumor cells. Bioinformatic analysis revealed a significant positive correlation between C1GALT1 and PDPN messenger RNA expression in CRC patients.

CONCLUSION

The tumor-suppressive function of PDPN depends strictly on its intact O-glycosylation. When abnormal O-glycan synthesis leads to Tn antigen exposure, PDPN loses its ability to inhibit tumor cell proliferation and migration and may promote CRC progression by activating the EMT pathway.

Key Words: Colorectal cancer; O-glycosylation; Podoplanin; T-synthase; C1GALT1

Core Tip: This study is the first to report that the tumor-suppressive function of the key glycoprotein podoplanin (PDPN) depends strictly on its intact O-glycosylation. When T-synthase deficiency leads to Tn antigen exposure, abnormal PDPN O-glycosylation occurs, resulting in decreased protein stability and functional loss, thereby abolishing the inhibitory effects of PDPN on cell proliferation and migration. These findings provide a new theoretical foundation for the use of glycosylation-dependent PDPN as a prognostic biomarker and targeted therapeutic strategy.



INTRODUCTION

Colorectal cancer (CRC) is among the most prevalent malignancies of the gastrointestinal tract worldwide and is among the leading causes of cancer-related mortality. According to the Global Cancer Statistics 2024 report, CRC accounts for more than 1.9 million new cases and approximately 935000 deaths, representing 10.0% of all new cancer cases and 9.4% of cancer-related deaths worldwide[1,2]. With economic development and the adoption of Westernized lifestyles, the incidence of CRC has shown a marked upward trend. Although advances in early diagnosis and multimodal treatment have been made in recent years, the 5-year survival rate for patients with advanced CRC remains below 15%, in stark contrast to the greater than 90% survival rate observed in early-stage patients[3,4]. These findings underscore the pressing need to elucidate the molecular mechanisms underlying colorectal carcinogenesis and progression and to identify novel therapeutic targets for effective intervention.

In recent years, the role of aberrant protein posttranslational modifications in tumorigenesis and progression have attracted increasing attention. Among these modifications, glycosylation, one of the most common posttranslational modifications, plays a key role in physiological processes such as intercellular recognition, signal transduction, and immune regulation[5,6]. O-glycosylation is an important form of glycosylation that primarily occurs on serine or threonine residues. N-acetylgalactosamine (GalNAc)-type O-glycosylation (hereinafter referred to as O-glycosylation) is the most common and structurally diverse class of O-glycosylation and plays a crucial role in tissue development and homeostasis. This modification is widely involved in various biological processes, including signal transduction, gene transcription, cell migration, immune cell regulation, and metabolic regulation. Abnormal O-glycosylation can subsequently lead to alterations in cellular behavior and is closely associated with the progression and metastasis of multiple cancers, such as CRC, breast cancer, lung cancer, prostate cancer, and pancreatic cancer[7,8].

Typically, O-glycosylation begins with the attachment of GalNAc to serine or threonine residues, followed by the addition of other sugar moieties to form complex O-glycans[9,10]. This complete synthesis process is specifically catalyzed by the key enzyme T-synthase (core 1, β,1,3-galactosyltransferase) in the Golgi apparatus. Inactivation of T-synthase leads to aberrant glycan elongation, resulting in the expression of a truncated O-glycan, also known as the Tn antigen (GalNAcα1-O-Ser/Thr)[9,11,12]. The Tn antigen is widely recognized as a marker of abnormal O-glycosylation and has been detected in tissues cells from various epithelial-derived tumors and inflammation-related diseases (such as colitis, immunoglobulin A nephropathy, systemic lupus erythematosus, and rheumatoid arthritis) but is not found in normal tissue cells from healthy individuals[13-15]. Notably, while the Tn antigen is undetectable in the colorectal epithelia of healthy individuals, it is highly expressed in the epithelia of approximately 80% of CRC patients[6,16]. However, whether the expression of this antigen is a pathogenic driver of CRC development and metastasis remains unclear.

In this study, we knocked out T-synthase in human CRC cells (HCT116 and SW480), thereby inducing the expression of the Tn antigen in the cells. Both in vitro and in vivo experiments demonstrated that the Tn antigen significantly increased the migration and invasion capabilities of CRC cells. We propose that the most critical aspect of the role of the Tn antigen in promoting tumor development lies in its regulation of the function of modified glycoproteins. Preliminary investigations in our previous work revealed that Tn antigen modification on various membrane proteins. Among these proteins, podoplanin (PDPN) is a highly O-glycosylated transmembrane glycoprotein. Its extracellular domain, which is rich in serine/threonine residues, provides multiple potential sites for O-glycosylation.

However, during the occurrence and progression of CRC, abnormal O-glycosylation mediated by the Tn antigen can significantly disrupt the stability of PDPN. In this study, we revealed that the Tn antigen, by modifying PDPN, impaired its tumor-suppressive function. This mechanism may provide a novel explanation for the development and progression of CRC and offer a theoretical basis for therapeutic strategies targeting glycosylation.

MATERIALS AND METHODS
Cell lines and cell culture

The human CRC cell lines HCT116 and SW480 were purchased from National Cancer Center/Cancer Hospital. The HCT116 cells were maintained in McCoy’s 5A medium (Gibco, Carlsbad, CA, United States). SW480 cells were maintained in Dulbecco’s Modified Eagle Medium (Sigma, Santa Clara, CA, United States). All media contained 10% fetal bovine serum (Ausbian, Sydney, Australia) and 1% penicillin-streptomycin solution (Gibco). All the cell lines were incubated at 37 °C in a humidified atmosphere with 5% carbon dioxide.

Clustered regularly interspaced short palindromic repeats associated protein 9-mediated knockout of the T-synthase chaperone

To knockout T-synthase in HCT116 and SW480 cells, we designed pairs of single-guide RNA (sgRNA) sequences targeting T-synthase. The sequences of the sgRNAs targeting T-synthase were as follows: Forward sequence, 5’-CACCGATCCTATTGCTGATCCACAG-3’; Reverse sequence, 5’-AAACCTGTGGATCAGCAATAGGATC-3’. In previous studies, the laboratory researchers have successfully constructed T-synthase (C1GALT1) knockouts in HCT116 and SW480 cell lines using clustered regularly interspaced short palindromic repeats associated protein 9 gene editing technology[17-20].

Immunohistochemical staining of the Tn antigen

The formalin-fixed, paraffin-embedded tissues were cut into 5 μm-thick sections. The sections were first stained with hematoxylin and eosin using a standard protocol. For immunohistochemistry of the Tn antigen, deparaffinized sections were boiled for 20 minutes in ethylene diamine tetraacetic acid buffer at potential of hydrogen 9.0 for epitope retrieval. Afterward, the sections were incubated overnight at 4 °C with a specific anti-Tn immunoglobulin M (IgM) monoclonal antibody (using the laboratory’s existing antibody stock[20,21]), followed by incubation with a horseradish peroxidase-conjugated anti-mouse IgM antibody (Abcam, ab97230) for 1 hour at room temperature. Finally, the sections were developed with diaminobenzidine reagent (ZSGB-BIO, China) and counterstained with hematoxylin.

Western blot analysis

The CRC cells were washed with cold phosphate-buffered saline (PBS), scraped from the cell plate using radio immunoprecipitation assay lysis buffer, and lysed for 15 minutes with constant agitation. Protein concentrations were determined using a bicinchoninic acid assay kit (Thermo Fisher Scientific). Equal amounts of denatured protein were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA, United States). The membranes were blocked with 5% defatted milk and then probed with primary antibodies overnight at 4 °C. After the membranes were incubated with specific horseradish peroxidase-conjugated secondary antibodies, the signals were visualized with an enhanced chemiluminescence kit (Millipore) according to the manufacturer’s instructions. The antibodies used were as follows: Anti-T-synthase (1:500; sc-100745; Santa Cruz Biotechnology), anti-PDPN (1:1000; 11629-1-AP; Proteintech), anti-zonula occludens-1 (ZO-1) (1:1000; Cell Signaling Technology), anti-E-cadherin (1:1000; Cell Signaling Technology; Danvers, MA, United States), anti-vimentin (1:1000; 5741; Cell Signaling Technology), and anti-Snail (1:1000; 3879; Cell Signaling Technology).

Flow cytometric analysis

Cultured CRC cells were washed, collected, and suspended in cold PBS (1 × 106/mL). The cells were subsequently incubated with mouse anti-Tn IgM monoclonal antibody (10 μg/mL) or mouse IgM isotype-antibody as a control (10 μg/mL; Santa Cruz Biotechnology) for 1 hour at 4 °C, followed by incubation with phycoerythrin-labeled goat anti-mouse IgM secondary antibody (10 μg/mL; BD Biosciences) for 1 hour at 4 °C. The cells were subsequently washed with PBS three times and analyzed by flow cytometry (Canto II; BD Bioscience).

Cell proliferation

Cell proliferation was measured by the cell counting kit-8 (CCK-8) assay. A total of 1 × 104 cells were seeded into 96-well plates and incubated at 37 °C. Before the assay was performed, the medium was removed, and 10 μL of CCK-8 solution was added to each well of the plate and incubated at 37 °C for 2 hours. The optical density was determined at 450 nm by a spectrophotometer.

Cell migration and invasion assays

After being starved for 24 hours, cells (2 × 105) with serum-free medium were seeded into the upper chamber of a Transwell plate (BD Bioscience, 8 μm pore size) precoated with or without Matrigel (BD Bioscience). A total of 500 μL of 10% serum-containing medium was added to the lower chamber. After being cultured for 24 hours or 48 hours, the migrated or invaded cells were counted under a microscope after fixation with 4% paraformaldehyde and staining with 0.1% crystal violet.

Reconstitution of PDPN in cells

The coding sequence (CDS) of PDPN is as follows: ATGTGGAAGGTGTCAGCTCTGCTCTTCGTTTTGGGAAGCGCGTCGCTCTGGGTCCTGGCAGAAGGAGCCAGCGCCGGCCAGCCAGAAGATGACGCAGAGGCTGCCGGTTTGGAAGGCGGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGGCTCCAGGAGCCAGCGAAGACCGCTATAAGTCTGGCTTGGCTGCCCTGGTGGCAACAAGTGTCAACAGTGTAGCTGGCATTCGCATCGAGGATCTGCCAGCAGCCGAAGCTGCCGTCCACGCGCAAGAACAAGCCCCAGCTGCCGCAGCCGCTAACGTGGCCGCTGCCCACGCTGCCGAGAAAGTGGATGGAGACGCTCAGGCCGCAGTTGAGAAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATCGGCTTCATTGGTGCAATCATCGTTGTGGTTATGCGAAAAATGTCGGGAAGGTACTCGCCCTAA.

Stable cell lines were generated from two human colorectal carcinoma cell lines, HCT116 and SW480. Cells transfected with an empty vector (HCT116-vector or SW480-vector) served as the control. Overexpression wild-type PDPN (WT-PDPN) cells were generated using a lentiviral vector containing the full-length PDPN CDS. An O-glycosylation-deficient PDPN mutant (mu-PDPN) was created by site-directed mutagenesis, in which all 24 serine/threonine residues within the O-glycosylation-rich domain were replaced with alanine to abrogate glycosylation. Both the WT-PDPN and the mu-PDPN plasmids were stably transfected into the respective cell lines. Following transfection, stable polyclonal cell populations were selected and maintained under G418 (Geneticin) antibiotic pressure to ensure the persistence of the integrated constructs[22].

Nude mouse xenograft experiments

The animal experiments were conducted in accordance with the guidelines and approved by the Institutional Animal Care and Use Committee at Capital Medical University (Beijing, China). Six-week-old female BALB/c nude mice were obtained from Charles River Laboratories (Beijing, China). To assess tumor growth, 2 × 106 cells were subcutaneously injected into the nude mice on day 0. Tumor size measurement began on day 6 post-injection and was performed every 3 days thereafter. The tumor volume was calculated using the formula V = L (length) × W2 (width)/2. After 21 days, all the mice were euthanized, and the weights and final volumes of the excised tumors were measured.

CRC dataset analysis

To elucidate the association between the expression of the T-synthase-encoding gene C1GALT1 and the PDPN gene in patients with CRC, public single-cell RNA sequencing data were analyzed in this study. The raw sequencing data were sourced from the Gene Expression Omnibus (GEO) database under the accession number GSE132465. Single-cell RNA sequencing data from the GEO dataset (GSE132465) were obtained. The Seurat package was employed for data quality control, normalization, dimensionality reduction, clustering, and cell type annotation. Cell-cell communication analysis was performed using the CellChat package to investigate the correlation between C1GALT1 expression and PDPN expression in the tumor microenvironment and to explore the potential regulatory networks involved.

Statistical analysis

All the data were analyzed with SPSS 26.0 statistical software (SPSS, Chicago, IL, United States) and GraphPad Prism 9.0 (GraphPad software, La Jolla, CA, United States). Continuous data are presented as the mean ± SD. For comparisons between two groups that followed a normal distribution, the independent-samples t test was used. For comparisons among multiple groups, one-way analysis of variance was applied. A P value of less than 0.05 (P < 0.05) was considered to indicate statistical significance.

RESULTS
Tn antigen expression is upregulated in CRC tissues

CRC is a common malignant tumor worldwide, and its pathogenesis involves complex molecular alterations[1,3]. Abnormal O-glycosylation, a notable feature of CRC, plays a significant role in tumorigenesis and progression. Tn antigen is a common tumor-associated carbohydrate antigen, and its expression is typically closely associated with aberrant O-glycosylation processes[5,6,23]. To further investigate the clinical relevance and underlying mechanisms of abnormal O-glycosylation in CRC, the expression status of the Tn antigen in archived paraffin-embedded human CRC tissue samples was examined in this study. Immunohistochemical staining analysis was performed on CRC tissue samples from 25 CRC patients. The expression of the Tn antigen was positive in all 25 CRC tissues, resulting in a positive expression rate of 100%. In contrast, all paired nontumor tissue samples tested negative for Tn antigen expression (Figure 1). These significant differences suggest that Tn antigen expression may be closely associated with the occurrence and development of CRC.

Figure 1
Figure 1 Immunohistochemical detection of Tn antigen expression in colorectal cancer tissues. HE: Hematoxylin-eosin.
Tn antigen expression significantly increases the proliferation and invasion capabilities of CRC cells

T-synthase (β,1,3-N-acetylgalactosaminyltransferase, C1GALT1) is a key glycosyltransferase responsible for catalyzing the transfer of galactose to the Tn antigen to form the T antigen (core 1 structure, GalNAc-O-Ser/Thr)[24,25]. In preliminary experiments, cell models with high Tn antigen expression were successfully constructed. The previous establishment of these cell models has enabled subsequent studies on the functional mechanisms of the Tn antigen in CRC metastasis[17-20].

The knockout efficiency of T-synthase was validated using western blotting. The results revealed a significant reduction or even complete absence of T-synthase protein expression in both the HCT116 and SW480 cell lines, confirming the effective knockout of T-synthase (Figure 2A and B). To further evaluate the expression level of the Tn antigen, flow cytometry was used for quantitative detection of the cell surface Tn antigen (Figure 2C). The results demonstrated a significant upregulation of Tn antigen expression in the T-synthase knockout cells, whereas no Tn antigen expression was detected in the control cells transfected with the empty vector. This provides a reliable experimental model for in-depth investigations of the biological role of abnormal O-glycosylation in CRC.

Figure 2
Figure 2 High expression of the Tn antigen increases the proliferation, invasion, and migration capabilities of colorectal cancer cells. A and B: Western blot analysis of Tn antigen expression; C: Flow cytometry detection of Tn antigen expression; D: Analysis by a cell counting kit-8 proliferation assay revealed a significant increase in the proliferation rate of T-synthase-knockout cells; E and F: Analysis by Transwell assay indicates increased invasion ability of Tn (+) colorectal cancer cells. OD: Optical density.

Previous studies have shown that Tn antigen-mediated abnormal O-glycosylation significantly increases the migration and invasion capacities of tumor cells in various malignancies (such as breast cancer, pancreatic cancer, and lung cancer), thereby accelerating the process of cancer metastasis[20,26,27]. However, the specific mechanisms of the Tn antigen in CRC have not been fully elucidated. To investigate whether the Tn antigen has a similar cancer-promoting effect on CRC cells, a CCK-8 assay was first used to evaluate changes in the proliferation capacity of cells with high Tn antigen expression (Figure 2D). Compared with Tn (-) control cells, both HCT116 Tn (+) and SW480 Tn (+) cells induced by T-synthase knockout exhibited significantly increased proliferation capacity.

To further assess the impact of the Tn antigen on the metastatic characteristics of cancer cells, we performed Transwell migration assays to evaluate the migratory capacity of the cells (Figure 2E and F). Compared with those of their respective Tn (-) control cells, the numbers of HCT116 Tn (+) and SW480 Tn (+) cells with high Tn antigen expression that migrated through the microporous membrane of the Transwell chamber were significantly increased. These findings indicate that the Tn antigen can significantly increase the migratory ability of CRC cells. These findings are consistent with previously reported results in other malignancies, such as breast cancer and pancreatic cancer, further supporting the universal and critical role of Tn antigen expression mediated by abnormal O-glycosylation in promoting tumor metastasis.

In summary, our experimental results confirm a direct functional link between Tn antigen expression and malignant behavior in CRC cells. We demonstrated that the Tn antigen promotes both cell proliferation and migration, which are key processes in tumor growth and metastasis. These findings support the core hypothesis that the Tn antigen may promote the progression of CRC by modulating downstream signaling cascades or affecting cellular interactions with the tumor microenvironment.

Tn antigen exposure leads to a decrease in PDPN expression

These results indicate that the Tn antigen significantly increases the invasive and metastatic capabilities of cancer cells, but its specific molecular mechanisms remain unclear. Therefore, dimensionality reduction and cluster analysis were performed on the single-cell transcriptome data of CRC. The interaction between T-synthase and PDPN was strongest in the consensus molecular subtype (CMS) CMS1, CMS2, and CMS3 subtypes (Figure 3A). The expression patterns of the T-synthase-encoding gene C1GALT1 and the cancer-associated glycoprotein PDPN across different cell subsets were further analyzed. The distributions of C1GALT1 expression (Figure 3B) and PDPN expression (Figure 3C) in the uniform manifold approximation and projection space are shown separately. Cells were annotated as different CRC molecular subtypes (CMS1-CMS4) and normal intestinal epithelial cell types on the basis of their molecular characteristics. C1GALT1 expression (represented in purple) was moderate in some mature enterocytes; relatively low in malignant cell clusters of the CMS2 and CMS3 subtypes, and moderate in stem-like/transit-amplifying cells and some goblet cells. PDPN expression (represented in orange) displayed a highly restricted distribution pattern and was upregulated in specific cell subpopulations. The results revealed a certain correlation between the expression of C1GALT1 (T-synthase) and PDPN within the CRC ecosystem. The expression levels of C1GALT1 and PDPN were positively correlated (Figure 3D).

Figure 3
Figure 3 Relationships between Tn antigen and podoplanin expression. A: Expression characteristics of C1GALT1 and podoplanin (PDPN) in major cellular subsets; B and C: Spatial expression localization of C1GALT1 and PDPN in the single-cell landscape; D: Scatter plot of C1GALT1 vs PDPN expression; E: Mechanistic role of PDPN; F and G: Western blot analysis confirming reduced PDPN expression in Tn antigen-expressing. CMS: Consensus molecular subtype; PDPN: Podoplanin.

Previous studies have shown that PDPN is a highly glycosylated type I transmembrane mucin-like glycoprotein that is widely expressed on the surfaces of various tumor cells. Its extracellular domain is rich in multiple O-glycosylation sites, particularly a heavily glycosylated region of approximately 130 amino acids at the amino terminus, which regulates cell migration and invasion[28-30]. Although numerous reports in the literature have documented the role of PDPN in tumor progression, few studies have investigated it in depth from the perspective of glycosylation. Currently, no research has elucidated whether the Tn antigen promotes CRC progression by regulating the expression or function of PDPN. On this basis, we hypothesize that when T-synthase is dysfunctional, the aberrant O-glycosylation of PDPN leads to Tn antigen exposure, thereby affecting the role of PDPN in the occurrence and development of CRC (Figure 3E).

Western blot analysis was subsequently performed to compare the expression levels of PDPN in Tn antigen-high-expressing HCT116 Tn (+) and SW480 Tn (+) cell lines with those in normally O-glycosylated HCT116 Tn (-) and SW480 Tn (-) cells. Compared with those in normal O-glycosylated cells, PDPN protein expression levels were significantly lower in Tn antigen-high-expressing cells (Figure 3F and G). These findings suggest that abnormal O-glycosylation may impair the normal biological function of PDPN in CRC, potentially by reducing PDPN protein stability or affecting its synthesis.

PDPN significantly reduces the proliferation and migration capabilities of CRC cells

To further investigate the function of PDPN in CRC, a lentiviral expression vector containing the full-length CDS of human PDPN was first constructed using molecular cloning techniques. Western blotting and flow cytometry were used to validate the protein expression levels of PDPN in the cells. Compared with control cells, cells in the experimental groups (designated HCT116-PDPN and SW480-PDPN) exhibited stable and significant upregulation of PDPN protein expression, indicating the successful establishment of PDPN overexpression cell models (Figure 4A-C).

Figure 4
Figure 4 Overexpression of podoplanin decreases the proliferation and metastatic capabilities of colorectal cancer cells. A and B: Western blot detection of podoplanin (PDPN) overexpression; C: Flow cytometry detection of PDPN overexpression; D: The cell counting kit-8 proliferation assay revealed a significant decrease in the proliferation rate of colorectal cancer (CRC) cells overexpressing PDPN; E and F: The Transwell assay revealed a reduction in the invasion ability of CRC cells overexpressing PDPN. OE: Overexpression; PDPN: Podoplanin.

To clarify the direct effect of PDPN overexpression on the malignant phenotype of CRC cells, we systematically evaluated the effects of PDPN overexpression using CCK-8 cell proliferation assays and Transwell migration assays. The results showed that, compared to control cells transfected with the empty vector (HCT116-vector, SW480-vector), HCT116 and SW480 cells overexpressing PDPN exhibited significantly reduced proliferation activity (Figure 4D). Additionally, compared to those of the control cells, the numbers of PDPN-overexpressing HCT116 and SW480 cells that migrated through the microporous membrane of the Transwell chamber were decreased (Figure 4E and F). These findings indicate that PDPN can effectively inhibit the proliferation and migration of CRC cells.

Abnormal O-glycosylation decreases the stability of PDPN

To further investigate whether the biological function of PDPN is regulated by its O-glycosylation status, we constructed mu-PDPN and WT-PDPN overexpression vectors. By replacing 24 potential O-glycosylation sites (located in the serine/threonine-rich region) in the extracellular domain of the PDPN protein with alanine residues, the molecular conformation of PDPN exposed to the Tn antigen was simulated (Figure 5A). WT-PDPN and mu-PDPN plasmids were subsequently stably transfected into HCT116 and SW480 CRC cell lines, respectively, with cells transfected with the empty vector (HCT116-vector or SW480-vector) serving as controls. Western blotting was used to validate the protein expression levels of PDPN in the transfected cells. Compared with that in the respective empty vector control groups, PDPN protein expression was increased in HCT116 and SW480 cells transfected with WT-PDPN, while the expression level of the mu-PDPN protein was comparable to that in the empty vector control groups (Figure 5B and C). These results indicated that the established PDPN overexpression cell models were suitable for subsequent functional studies. The pro-proliferative and pro-metastatic effects of PDPN overexpression in HCT116 and SW480 cells were subsequently evaluated using CCK-8 cell proliferation and Transwell migration/invasion assays.

Figure 5
Figure 5 O-glycosylation is crucial for the function of podoplanin. A: Schematic diagram of O-glycosylation sites on podoplanin (PDPN); B and C: Western blot validation of the expression of control, wild-type (WT), and O-glycosylation-mutated (mu) PDPN; D: The cell counting kit-8 proliferation assay; E-H: Transwell assay analysis of the migration and invasion capabilities of colorectal cancer cells overexpressing PDPN; I and J: Western blot results indicate that WT-PDPN-expressing cells can inhibit the epithelial-mesenchymal transition (EMT) process, while mu-PDPN-expressing cells promote the EMT process similarly to the control cells. Ala: Alanine; PDPN: Podoplanin; WT: Wild-type; mu: O-glycosylation-mutated; ZO-1: Zonula occludens-1.

The results of the cell proliferation assay revealed that compared with that of the control groups transfected with the empty vector (HCT116-vector, SW480-vector), the proliferative activity of cells overexpressing WT-PDPN was significantly inhibited. In contrast, the proliferative capacity of cells overexpressing mu-PDPN was not significantly different from that of the empty vector control cells (Figure 5D). The results of the Transwell migration assay demonstrated a significant reduction in the migratory ability of cells overexpressing WT-PDPN, with the number of cells migrating through the microporous membrane being significantly lower than that of the control cells. In contrast, the migratory ability of cells overexpressing mu-PDPN was not significantly inhibited, and the number of migrating cells was essentially the same as that in the control groups (Figure 5E-H). Further analysis of the molecular mechanisms via western blotting revealed that, compared with WT-PDPN, O-glycosylation-deficient mu-PDPN could induce changes in the expression of typical epithelial-mesenchymal transition (EMT) molecular markers. It upregulated the expression of the key markers of the mesenchymal phenotype, vimentin and the transcription factor Snail, while downregulating the expression of the key proteins for maintaining epithelial polarity and junctions, ZO-1 and E-cadherin (Figure 5I and J). These findings indicate that mu-PDPN effectively activates the EMT process by disrupting the EMT.

These results collectively indicate that the tumor-suppressive function of PDPN is strictly dependent on its intact O-glycosylation. When O-glycan synthesis is abnormal (Tn antigen exposure), leading to the disruption of glycosylation, PDPN loses its biological ability to inhibit tumor cell proliferation and migration. At the molecular level, these findings also explain the potential mechanism by which mu-PDPN promotes tumor cell migration and invasion through activation of the EMT pathway.

Abnormal O-glycosylation of PDPN drives tumor progression in a nude mouse model of CRC

To validate whether the tumor-suppressive function of PDPN is regulated by O-glycosylation in vivo, this a nude mouse subcutaneous xenograft model was established in this study. Three experimental groups were designed: The HCT116 control group (transfected with empty vector), the WT-PDPN group (overexpressing WT-PDPN), and the mu-PDPN group (overexpressing O-glycosylation site-mutated PDPN). The tumor volume was measured every 3 days starting from day 6 post-inoculation. The results revealed that the tumor growth curve of the mu-PDPN group strongly overlapped with that of the HCT116 control group, indicating a similar growth rate (Figure 6). In contrast, the tumor volume in the WT-PDPN group was significantly smaller than that in the other two groups throughout the observation period (Figure 6C). On day 21 post-inoculation, the tumors were harvested and weighed. The average tumor weight in the WT-PDPN group was significantly lower than that in both the HCT116 control group and the mu-PDPN group, while the difference in tumor weight between the latter two groups was not statistically significant (Figure 6A and B). These results are entirely consistent with the tumor volume measurements. Immunohistochemical staining was performed to detect Ki67 expression in the tumor tissues. The results revealed a significant reduction in the proportion of Ki67-positive cells in tumor tissue sections from the WT-PDPN group. In contrast, the percentage of Ki67-positive cells in the mu-PDPN group returned to a high level, similar to that in the HCT116 control group (Figure 6D).

Figure 6
Figure 6 O-glycosylation-deficient podoplanin promotes tumor growth. A: Effect of abnormal O-glycosylation of podoplanin on tumor growth and proliferation in a BALB/c nude mouse model; B: Tumor volume comparison; C: Tumor growth curve; D: Cell proliferation in tumors was assessed by immunohistochemical staining for Ki67, and representative images are displayed. PDPN: Podoplanin; WT: Wild-type; mu: O-glycosylation-mutated.

The in vivo experimental data in this section corroborate the findings of previous in vitro studies, collectively demonstrating that intact O-glycosylation is crucial for the tumor-suppressive function of PDPN. When the O-glycosylation sites of PDPN are mu-PDPN, PDPN loses its ability to inhibit tumor growth and proliferation, resulting in tumors exhibiting malignant growth characteristics similar to those of the blank control group. These findings clarify, at the whole-organism level, the molecular mechanism by which abnormal O-glycosylation promotes CRC progression through the functional inactivation of PDPN.

DISCUSSION

Previous studies have confirmed that abnormal O-glycosylation (characterized by high Tn antigen expression) is closely associated with malignant tumor phenotypes[7,8]. C1GALT1 (T-synthase) is a key enzyme that catalyzes the elongation of O-glycan chains, and its downregulation or functional loss can lead to Tn antigen accumulation[31]. This study revealed that mu-PDPN, which mimics the Tn antigen-exposed state, can induce EMT, which is consistent with prior reports on the ability of the Tn antigen to promote tumor metastasis[20]. For the first time, this study directly links the glycosylation status of PDPN to its biological function through functional experiments, revealing its specific mechanism as a potential tumor suppressor in CRC.

Importantly, we observed that Tn antigen exposure led to reduced stability of the PDPN protein, although the precise degradation pathway (e.g., proteasomal vs lysosomal) requires further investigation and represents a key direction for our follow-up research.

PDPN, as a transmembrane glycoprotein, is aberrantly expressed in various tumors, but its function demonstrates significant tissue-specific heterogeneity. For instance, in tumors such as lung cancer and melanoma, PDPN is widely reported as an oncogenic factor that can promote tumor invasion and metastasis by activating signaling pathways such as the phosphatidylinositol 3-kinase/protein kinase B pathway[30,32,33]. In contrast, this study revealed a tumor-suppressive effect of PDPN in a CRC model. Our findings indicate that when PDPN undergoes abnormal O-glycosylation (leading to Tn antigen exposure), it loses its tumor-suppressive function and instead exhibits properties that promote tumor cell proliferation and invasion. This functional heterogeneity may be associated with specific tumor microenvironments, cell type specificity, and other unknown posttranslational regulatory modifications. While the mutation strategy employed for mu-PDPN involves the replacement of multiple Ser/Thr residues, this approach is a well-established paradigm in glycolbiology for dissecting the specific contribution of glycan moieties vs the amino acid backbone[26,34-36]. Our prior successful application of an identical strategy in studying CASC4, along with literature on PDPN[26], supports the interpretation that the functional loss observed in mu-PDPN is attributable primarily to the absence of O-glycans rather than to nonspecific structural disruption caused by the mutations themselves.

While most previous studies have focused primarily on changes in the expression levels of the PDPN protein, the functional significance of its glycosylation status has been relatively underexplored. In this study, by precisely constructing an O-glycosylation site mutant PDPN protein (mu-PDPN), we clearly demonstrated for the first time in a CRC model that intact O-glycosylation is a prerequisite for the tumor-suppressive function of PDPN. These findings reveal a “switch-like” regulatory role of this modification on PDPN activity. Additionally, these findings provide a novel molecular perspective for understanding the functional regulation of PDPN in different tumor contexts.

PDPN glycosylation is likely regulated within a broader signaling network. Upstream, inflammatory cytokines such as tumor necrosis factor-α and interleukin-6, together with metabolic reprogramming in the tumor microenvironment, may repress C1GALT1/Cosmc expression, thereby connecting oncogenic signaling to Tn antigen-PDPN. Downstream, properly glycosylated PDPN acts to maintain epithelial integrity and inhibit EMT, which is consistent with our observation of elevated E-cadherin and ZO-1 levels and reduced expression of vimentin and Snail. The specific receptors and adaptor proteins that transduce PDPN-mediated signals to EMT-regulating pathways remain to be fully defined and represent important direction for future research.

Clinical significance and perspective

The glycosylation status of PDPN may serve as a prognostic biomarker for CRC, with fully glycosylated PDPN potentially indicating a favorable prognosis, whereas Tn antigen-expressing PDPN may suggest a higher risk of invasion and metastasis. Second, interventions targeting the PDPN glycosylation pathway (such as restoring C1GALT1 function or targeting abnormal glycosylation) could emerge as novel therapeutic strategies for CRC. The “glycosylation status-protein function-tumor phenotype” research paradigm established in this study may provide a reference for functional studies of other glycoproteins. Evaluating the co-expression of Tn antigen and PDPN in clinical biopsies could help stratify patients into subgroups with differing risks of invasion and metastasis, potentially guiding more personalized surveillance or adjuvant therapy.

Targeting the Tn antigen-PDPN represents a highly promising therapeutic strategy. This approach could be translated clinically in several ways: For instance, by developing small-molecule activators of C1GALT1/Cosmc or using gene-editing tools to restore normal O-glycosylation, thereby reactivating the tumorsuppressive functions of PDPN and other glycoproteins. Alternatively, antibody-drug conjugates or chimeric antigen receptor T/natural killer cells directed against the Tn-PDPN complex may allow specific eradication of tumor cells displaying this abnormal glycol-signature[37,38]. We also anticipate that combining such targeted strategies with standard therapies including immune checkpoint inhibitors, cytotoxic chemotherapy, and molecularly targeted drugs may help overcome treatment resistance and improve clinical responses[39,40]. Future prospective studies incorporating detailed clinicopathological information will be needed to validate the clinical significance of PDPN glycosylation status and evaluate its potential as a prognostic and predictive biomarker.

Study limitations

The presence of Tn antigen in CRC tissues was experimentally confirmed in this study; however, an in-depth analysis of the association between Tn antigen expression levels in clinical samples and patient tumor stage, pathological grade, or prognosis was not conducted. Therefore, the clinical translational significance of these findings requires further validation. At the mechanistic level, although functional differences based on the glycosylation status of PDPN were clarified through in vitro functional assays and animal models, its downstream signaling pathways were not fully elucidated. Specifically, the precise mechanisms through which PDPN regulates key molecules such as EMT-related transcription factors through glycosylation’s require further exploration. The number of cell lines and animal models used in this study was limited. Subsequent validation in a broader range of clinical samples and in vitro/in vivo models is needed to enhance the generalizability and reliability of the conclusions.

Future research directions

On the basis of the findings and limitations of this study, the downstream signaling networks regulated by PDPN glycosylation should be explored further in future studies. The glycosylation status of PDPN could be detected in clinical samples to analyze its correlation with patient prognosis. This study could be extended to other tumor types to validate the general applicability of PDPN glycosylation functional regulation.

There are three key directions for future work: Mechanistic characterization, clinical validation, and therapeutic translation. Mechanistically, we plan to use co-immunoprecipitation coupled with mass spectrometry to identify glycosylation-dependent binding partners of PDPN, and employ pathway-specific inhibitors and pulse-chase assays to further define its regulatory mechanisms. Clinically, we will perform a large-scale, multicenter immunohistochemistry study to systematically link different PDPN glycoforms with clinicopathological features and patient survival in CRC. Therapeutically, we will collaborate with experts in medicinal chemistry and immunology to develop targeted approaches, which will then be rigorously tested in immunocompetent mouse models to advance their translational potential.

Of course, translation of these concepts into clinical reality still faces numerous challenges, including in vivo target validation, drug delivery efficiency, potential off-target effects, and possible effects on normal physiological glycosylation processes. However, the clear mechanisms elucidated in this study establish a solid theoretical foundation for subsequent translational research. In the future, validation of these strategies in more complex preclinical models and biomarker-guided patient stratification will be critical steps in advancing the field.

In summary, this study revealed that PDPN exerts a tumor-suppressive effect in CRC and that this function is strictly dependent on its O-glycosylation. Loss of glycosylation leads to functional impairment of PDPN and promotes tumor progression through EMT. These findings not only deepen the understanding of the regulatory mechanisms governing PDPN function but also provide new insights for the prognosis assessment and targeted therapy of CRC.

CONCLUSION

In summary, when the function of T-synthase (C1GALT1), which is responsible for synthesizing core 1 O-glycans (Tn antigen), is impaired, O-glycan synthesis on PDPN molecules is blocked at the initial stage, leading to exposure to the Tn antigen. This truncated glycan structure deprives PDPN of the protective effect of complete glycans, ultimately resulting in a significant reduction in the levels of functional PDPN protein on the cell surface. The results of the experiments in this study confirmed that PDPN may act as a tumor suppressor in CRC cells and that its downregulation weakens of its inhibitory effects on cell proliferation and migration. Furthermore, Tn antigen exposure and the functional inactivation of PDPN further trigger the EMT program, characterized by downregulation of E-cadherin expression and upregulation of mesenchymal markers such as E-cadherin and vimentin, thereby significantly increasing the invasive and metastatic capabilities of cancer cells. Therefore, abnormal O-glycosylation is not merely a static phenomenon; through Tn antigen exposure, it reduces PDPN expression levels and abolishes its tumor-suppressive function, subsequently activating EMT and thus actively driving the proliferation and invasion of CRC cells. This study not only reveals the critical mechanism by which abnormal O-glycosylation (Tn antigen exposure) promotes CRC progression by destabilizing the key glycoprotein PDPN and activating EMT but also provides a theoretical foundation for targeting the Tn antigen and PDPN as potential diagnostic biomarkers and therapeutic targets (Figure 7).

Figure 7
Figure 7 Aberrant O-glycosylation characterized by high Tn antigen expression drives colorectal cancer progression through the downregulation of podoplanin expression. PDPN: Podoplanin; CRC: Colorectal cancer; EMT: Epithelial-mesenchymal transition; ZO-1: Zonula occludens-1.
ACKNOWLEDGEMENTS

The authors would like to thank all of the patients and their families for their cooperation and participation. In addition, the authors are thankful to all of the research staff and coinvestigators who were involved in this investigation.

References
1.  Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209-249.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 76817]  [Cited by in RCA: 71357]  [Article Influence: 14271.4]  [Reference Citation Analysis (83)]
2.  Xia C, Dong X, Li H, Cao M, Sun D, He S, Yang F, Yan X, Zhang S, Li N, Chen W. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin Med J (Engl). 2022;135:584-590.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3055]  [Cited by in RCA: 2686]  [Article Influence: 671.5]  [Reference Citation Analysis (10)]
3.  Ju W, Zheng R, Zhang S, Zeng H, Sun K, Wang S, Chen R, Li L, Wei W, He J. Cancer statistics in Chinese older people, 2022: current burden, time trends, and comparisons with the US, Japan, and the Republic of Korea. Sci China Life Sci. 2023;66:1079-1091.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 124]  [Reference Citation Analysis (1)]
4.  Li X, Chang Z, Wang J, Ding K, Pan S, Hu H, Tang Q. Unhealthy lifestyle factors and the risk of colorectal cancer: a Mendelian randomization study. Sci Rep. 2024;14:13825.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 10]  [Reference Citation Analysis (0)]
5.  Wandall HH, Nielsen MAI, King-Smith S, de Haan N, Bagdonaite I. Global functions of O-glycosylation: promises and challenges in O-glycobiology. FEBS J. 2021;288:7183-7212.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 122]  [Article Influence: 24.4]  [Reference Citation Analysis (0)]
6.  Thomas D, Rathinavel AK, Radhakrishnan P. Altered glycosylation in cancer: A promising target for biomarkers and therapeutics. Biochim Biophys Acta Rev Cancer. 2021;1875:188464.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 293]  [Cited by in RCA: 267]  [Article Influence: 53.4]  [Reference Citation Analysis (0)]
7.  Sanz-Martinez I, Pereira S, Merino P, Corzana F, Hurtado-Guerrero R. Molecular Recognition of GalNAc in Mucin-Type O-Glycosylation. Acc Chem Res. 2023;56:548-560.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 42]  [Reference Citation Analysis (0)]
8.  Pradeep P, Kang H, Lee B. Glycosylation and behavioral symptoms in neurological disorders. Transl Psychiatry. 2023;13:154.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 90]  [Reference Citation Analysis (0)]
9.  Li X, Wang X, Tan Z, Chen S, Guan F. Role of Glycans in Cancer Cells Undergoing Epithelial-Mesenchymal Transition. Front Oncol. 2016;6:33.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 46]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
10.  Freitas D, Campos D, Gomes J, Pinto F, Macedo JA, Matos R, Mereiter S, Pinto MT, Polónia A, Gartner F, Magalhães A, Reis CA. O-glycans truncation modulates gastric cancer cell signaling and transcription leading to a more aggressive phenotype. EBioMedicine. 2019;40:349-362.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 39]  [Cited by in RCA: 80]  [Article Influence: 11.4]  [Reference Citation Analysis (0)]
11.  Zhang J, Ten Dijke P, Wuhrer M, Zhang T. Role of glycosylation in TGF-β signaling and epithelial-to-mesenchymal transition in cancer. Protein Cell. 2021;12:89-106.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 34]  [Cited by in RCA: 70]  [Article Influence: 14.0]  [Reference Citation Analysis (0)]
12.  Song K, Herzog BH, Fu J, Sheng M, Bergstrom K, McDaniel JM, Kondo Y, McGee S, Cai X, Li P, Chen H, Xia L. Loss of Core 1-derived O-Glycans Decreases Breast Cancer Development in Mice. J Biol Chem. 2015;290:20159-20166.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 28]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
13.  Stowell SR, Ju T, Cummings RD. Protein glycosylation in cancer. Annu Rev Pathol. 2015;10:473-510.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 751]  [Cited by in RCA: 685]  [Article Influence: 62.3]  [Reference Citation Analysis (1)]
14.  Oliveira-Ferrer L, Legler K, Milde-Langosch K. Role of protein glycosylation in cancer metastasis. Semin Cancer Biol. 2017;44:141-152.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 130]  [Cited by in RCA: 207]  [Article Influence: 23.0]  [Reference Citation Analysis (0)]
15.  Chugh S, Barkeer S, Rachagani S, Nimmakayala RK, Perumal N, Pothuraju R, Atri P, Mahapatra S, Thapa I, Talmon GA, Smith LM, Yu X, Neelamegham S, Fu J, Xia L, Ponnusamy MP, Batra SK. Disruption of C1galt1 Gene Promotes Development and Metastasis of Pancreatic Adenocarcinomas in Mice. Gastroenterology. 2018;155:1608-1624.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 85]  [Article Influence: 10.6]  [Reference Citation Analysis (0)]
16.  Marciel MP, Haldar B, Hwang J, Bhalerao N, Bellis SL. Role of tumor cell sialylation in pancreatic cancer progression. Adv Cancer Res. 2023;157:123-155.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 22]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
17.  Dong X, Jiang Y, Liu J, Liu Z, Gao T, An G, Wen T. T-Synthase Deficiency Enhances Oncogenic Features in Human Colorectal Cancer Cells via Activation of Epithelial-Mesenchymal Transition. Biomed Res Int. 2018;2018:9532389.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 30]  [Cited by in RCA: 29]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
18.  Du T, Jia X, Dong X, Ru X, Li L, Wang Y, Liu J, Feng G, Wen T. Cosmc Disruption-Mediated Aberrant O-glycosylation Suppresses Breast Cancer Cell Growth via Impairment of CD44. Cancer Manag Res. 2020;12:511-522.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 14]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
19.  Gao T, Du T, Hu X, Dong X, Li L, Wang Y, Liu J, Liu L, Gu T, Wen T. Cosmc overexpression enhances malignancies in human colon cancer. J Cell Mol Med. 2020;24:362-370.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 20]  [Cited by in RCA: 18]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
20.  Liu Z, Liu J, Dong X, Hu X, Jiang Y, Li L, Du T, Yang L, Wen T, An G, Feng G. Tn antigen promotes human colorectal cancer metastasis via H-Ras mediated epithelial-mesenchymal transition activation. J Cell Mol Med. 2019;23:2083-2092.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 43]  [Cited by in RCA: 44]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
21.  Jiang Y, Liu Z, Xu F, Dong X, Cheng Y, Hu Y, Gao T, Liu J, Yang L, Jia X, Qian H, Wen T, An G. Aberrant O-glycosylation contributes to tumorigenesis in human colorectal cancer. J Cell Mol Med. 2018;22:4875-4885.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 50]  [Cited by in RCA: 49]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
22.  Minai-Tehrani A, Chang SH, Park SB, Cho MH. The O-glycosylation mutant osteopontin alters lung cancer cell growth and migration in vitro and in vivo. Int J Mol Med. 2013;32:1137-1149.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 16]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
23.  Magalhães A, Duarte HO, Reis CA. The role of O-glycosylation in human disease. Mol Aspects Med. 2021;79:100964.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 123]  [Article Influence: 24.6]  [Reference Citation Analysis (0)]
24.  Simplicien M, Barre A, Benkerrou Y, Van Damme EJM, Rougé P, Benoist H. The T/Tn-Specific Helix pomatia Lectin Induces Cell Death in Lymphoma Cells Negative for T/Tn Antigens. Cancers (Basel). 2021;13:4356.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 7]  [Reference Citation Analysis (0)]
25.  da Costa V, van Vliet SJ, Carasi P, Frigerio S, García PA, Croci DO, Festari MF, Costa M, Landeira M, Rodríguez-Zraquia SA, Cagnoni AJ, Cutine AM, Rabinovich GA, Osinaga E, Mariño KV, Freire T. The Tn antigen promotes lung tumor growth by fostering immunosuppression and angiogenesis via interaction with Macrophage Galactose-type lectin 2 (MGL2). Cancer Lett. 2021;518:72-81.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 45]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
26.  Li R, Dong X, Chen S, Tan J, Chen X, Liu J, Wen T, Ru X. Tn antigen promotes breast cancer metastasis via impairment of CASC4. Cell Biol Int. 2023;47:1854-1867.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 7]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
27.  Rajesh C, Radhakrishnan P. The (Sialyl) Tn antigen: Contributions to immunosuppression in gastrointestinal cancers. Front Oncol. 2022;12:1093496.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 27]  [Reference Citation Analysis (0)]
28.  Krishnan H, Rayes J, Miyashita T, Ishii G, Retzbach EP, Sheehan SA, Takemoto A, Chang YW, Yoneda K, Asai J, Jensen L, Chalise L, Natsume A, Goldberg GS. Podoplanin: An emerging cancer biomarker and therapeutic target. Cancer Sci. 2018;109:1292-1299.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 121]  [Cited by in RCA: 155]  [Article Influence: 19.4]  [Reference Citation Analysis (0)]
29.  Renart J, Carrasco-Ramírez P, Fernández-Muñoz B, Martín-Villar E, Montero L, Yurrita MM, Quintanilla M. New insights into the role of podoplanin in epithelial-mesenchymal transition. Int Rev Cell Mol Biol. 2015;317:185-239.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 43]  [Cited by in RCA: 57]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
30.  Suzuki H, Onimaru M, Yonemitsu Y, Maehara Y, Nakamura S, Sueishi K. Podoplanin in cancer cells is experimentally able to attenuate prolymphangiogenic and lymphogenous metastatic potentials of lung squamoid cancer cells. Mol Cancer. 2010;9:287.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 29]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
31.  Bergstrom K, Xia L. The barrier and beyond: Roles of intestinal mucus and mucin-type O-glycosylation in resistance and tolerance defense strategies guiding host-microbe symbiosis. Gut Microbes. 2022;14:2052699.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 69]  [Cited by in RCA: 66]  [Article Influence: 16.5]  [Reference Citation Analysis (0)]
32.  Strating E, Verhagen MP, Wensink E, Dünnebach E, Wijler L, Aranguren I, De la Cruz AS, Peters NA, Hageman JH, van der Net MMC, van Schelven S, Laoukili J, Fodde R, Roodhart J, Nierkens S, Snippert H, Gloerich M, Rinkes IB, Elias SG, Kranenburg O. Co-cultures of colon cancer cells and cancer-associated fibroblasts recapitulate the aggressive features of mesenchymal-like colon cancer. Front Immunol. 2023;14:1053920.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 102]  [Reference Citation Analysis (1)]
33.  Quintanilla M, Montero-Montero L, Renart J, Martín-Villar E. Podoplanin in Inflammation and Cancer. Int J Mol Sci. 2019;20:707.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 95]  [Cited by in RCA: 177]  [Article Influence: 25.3]  [Reference Citation Analysis (1)]
34.  Davis-Fleische KM, Brigstock DR, Besner GE. Site-directed mutagenesis of heparin-binding EGF-like growth factor (HB-EGF): analysis of O-glycosylation sites and properties. Growth Factors. 2001;19:127-143.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 8]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
35.  Kaneko MK, Kato Y, Kameyama A, Ito H, Kuno A, Hirabayashi J, Kubota T, Amano K, Chiba Y, Hasegawa Y, Sasagawa I, Mishima K, Narimatsu H. Functional glycosylation of human podoplanin: glycan structure of platelet aggregation-inducing factor. FEBS Lett. 2007;581:331-336.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 84]  [Cited by in RCA: 89]  [Article Influence: 4.7]  [Reference Citation Analysis (0)]
36.  Rampal R, Arboleda-Velasquez JF, Nita-Lazar A, Kosik KS, Haltiwanger RS. Highly conserved O-fucose sites have distinct effects on Notch1 function. J Biol Chem. 2005;280:32133-32140.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 88]  [Cited by in RCA: 80]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
37.  Yoneda H, Mitsuhashi A, Yoshida A, Ogino H, Itakura S, Nguyen NT, Nokihara H, Sato S, Shinohara T, Hanibuchi M, Abe S, Kaneko MK, Kato Y, Nishioka Y. Antipodoplanin antibody enhances the antitumor effects of CTLA-4 blockade against malignant mesothelioma by natural killer cells. Cancer Sci. 2024;115:357-368.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
38.  Tanaka T, Suzuki H, Ohishi T, Kawada M, Kaneko MK, Kato Y. Antitumor Activities by a Humanized Cancer-Specific Anti-Podoplanin Monoclonal Antibody humPMab-117 Against Human Tumors. Cancer Sci. 2025;116:2232-2242.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 2]  [Reference Citation Analysis (0)]
39.  Tsukamoto S, Kodama T, Nishio M, Shigeoka M, Itoh T, Yokozaki H, Koma YI. Podoplanin Expression in Early-Stage Colorectal Cancer-Associated Fibroblasts and Its Utility as a Diagnostic Marker for Colorectal Lesions. Cells. 2024;13:1682.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
40.  Jian M, Yang Z, Tang Y, Jiang F, Cai L, Liu A, Hu J, Wang X, Liu S, Zhao D, Li M, Chen H, Zhang M, Yao Z, Jia R, Chen R, Jiang L, Zhang Y, Song X. PDPN+ cancer-associated fibroblasts correlate with the neoadjuvant immunotherapy response in gastric cancer. APL Bioeng. 2025;9:036115.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 2]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B, Grade B, Grade B

Novelty: Grade B, Grade B, Grade B, Grade C

Creativity or innovation: Grade A, Grade B, Grade B, Grade C

Scientific significance: Grade A, Grade B, Grade B, Grade B

P-Reviewer: Das S, Assistant Professor, MD, India; Han W, PhD, China; Zhao T, Assistant Professor, PhD, China S-Editor: Fan M L-Editor: A P-Editor: Wang WB

Write to the Help Desk