BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Gastroenterol. Jul 7, 2026; 32(25): 118140
Published online Jul 7, 2026. doi: 10.3748/wjg.118140
Curcumin nanoparticles mitigate early inflammation in severe acute pancreatitis by modulating peritoneal macrophage polarization via Nrf2/HO-1 pathway activation
Lin Yang, Dong-Xu Liao, Xiao-Yu Wang, Yi Wen, College of Medicine, Southwest Jiaotong University, Chengdu 610031, Sichuan Province, China
Yong-Hong Fan, Department of Basic Medical Laboratory, The General Hospital of Western Theater Command, Chengdu 610083, Sichuan Province, China
Zhu-Lin Luo, Yi Wen, Department of General Surgery & Tissue Stress Injury and Functional Repair Key Laboratory of Sichuan Province, The General Hospital of Western Theater Command, Chengdu 610083, Sichuan Province, China
ORCID number: Lin Yang (0009-0003-0728-5942); Dong-Xu Liao (0009-0003-5057-9495); Xiao-Yu Wang (0009-0001-5118-0289); Yong-Hong Fan (0000-0002-5132-0499); Zhu-Lin Luo (0000-0001-5613-492X); Yi Wen (0000-0001-9801-0853).
Co-corresponding authors: Zhu-Lin Luo and Yi Wen.
Author contributions: Yang L and Liao DX contributed to conceptualization, methodology, and software; Yang L, Liao DX and Wen Y designed the research; Yang L, Wang XY and Liao DX performed the research; Yang L and Fan YH conducted data curation, and original draft preparation; Wang XY contributed to visualization and investigation; Luo ZL and Wen Y supervised the research; Fan YH is responsible for validation; Yang L contributed to writing, reviewing, and editing of the article. Wen Y and Luo ZL revised the manuscript, and they are designated as co-corresponding authors. All authors have read and approved the final version to be published.
AI contribution statement: We did not use any AI tools. All the core parts of this manuscript - including the abstract, introduction, materials and methods, results, discussion, and conclusion - were independently written by the author team without using any AI tools. We did not use AI tools for language polishing, translation, data analysis, or writing assistance. The design of the study, data interpretation, and conclusion formation did not use any AI tools. All the images in this manuscript were drawn manually, not generated by AI.
Supported by National Natural Science Foundation of China, No. 32471419; National Key Clinical Specialty Project, No. 41732113; and Independent Innovation Project of General Hospital of Western Theater Command, No. 2024-YGLC-B03.
Institutional animal care and use committee statement: All animal experimental protocols were reviewed and approved by the Animal Ethics Committee of the General Hospital of the Western Theater Command (Approval No. 2025EC10-ky038), and were strictly conducted in accordance with international guidelines for the care and use of laboratory animals.
Conflict-of-interest statement: The authors declare that there is no conflict of interest related to this study.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: No additional data are available.
Corresponding author: Yi Wen, MD, Department of General Surgery & Tissue Stress Injury and Functional Repair Key Laboratory of Sichuan Province, The General Hospital of Western Theater Command, No. 270 Rongdu Road, Jinniu District, Chengdu 610083, Sichuan Province, China. 13980881194@163.com
Received: December 25, 2025
Revised: February 3, 2026
Accepted: March 17, 2026
Published online: July 7, 2026
Processing time: 188 Days and 9.7 Hours

Abstract
BACKGROUND

Severe acute pancreatitis (SAP) is a life-threatening inflammatory disease whose inflammatory response is closely associated with dysregulated polarization of peritoneal macrophages (PMs). Curcumin possesses potent anti-inflammatory and antioxidant properties, but its low solubility and bioavailability limit clinical application. Nanotechnology offers an effective strategy to enhance its therapeutic efficacy; however, the mechanism by which curcumin nanoparticles (Cur-NPs) modulate PMs polarization in SAP, particularly through nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway, remains unclear.

AIM

To investigate the effect of Cur-NPs on PMs polarization in SAP rats via the Nrf2/HO-1 pathway, thereby alleviating early inflammatory

METHODS

An SAP model was established in Sprague-Dawley rats. In vivo experiments were divided into Sham, SAP, Cur-NPs-50, Cur-NPs-100, Cur-NPs-150, and Cur-NPs-only groups. Pancreatic tissue histopathology, serum inflammatory cytokines, and enzymatic indicators were assessed. Following PMs isolation, M1/M2 markers and Nrf2/HO-1 expression were assessed via flow cytometry (CD86, CD163, CD68, and CD45), western blotting, and reverse transcription quantitative polymerase chain reaction. In vitro experiments involved isolating rat primary PMs and coculturing them with SAP ascites fluid (SAP-AF). Groups included: Control, SAP-AF, SAP-AF + Cur-NPs, SAP-AF + Nrf2 agonist [tert-butylhydroquinone (TBHQ)], SAP-AF + Cur-NPs + Nrf2 inhibitor (SAP + ML385), TBHQ, and Nrf2 inhibitor (ML385). The effects of Cur-NPs on PM polarization and the Nrf2/HO-1 pathway were validated via ELISA, immunofluorescence, and flow cytometry.

RESULTS

We prepared Cur-NPs with excellent stability, sustained-release properties, and biosafety. In the SAP rat model, Cur-NPs mitigated pancreatic tissue damage, reduced serum amylase and lipase activity, and significantly suppressed release of pro-inflammatory cytokines tumor necrosis factor-α and interleukin (IL)-1β. Mechanistically, Cur-NPs induced polarization of PMs from proinflammatory M1 to anti-inflammatory M2 phenotypes both in vivo and in vitro, manifested by downregulation of M1 markers (inducible NO synthase and CD86) and upregulation of M2 markers (CD163 and IL-10). Further studies confirmed that Cur-NPs activated the downstream HO-1 signaling pathway by promoting Nrf2 nuclear translocation. This activation not only suppressed phosphorylation of key proteins in the nuclear factor kappa-B pathway but also significantly alleviated oxidative stress, evidenced by reduced malondialdehyde and restored superoxide dismutase activity. The Nrf2-specific agonist TBHQ was able to mimic the aforementioned effects of Cur-NPs in a similar manner. Conversely, the Nrf2-specific inhibitor ML385 abolished the therapeutic effect of Cur-NPs.

CONCLUSION

Cur-NPs mitigate early inflammation and injury in SAP by activating the Nrf2/HO-1 pathway, which drives polarization of PMs toward the anti-inflammatory M2 phenotype, suggesting a potential therapeutic direction for SAP.

Key Words: Severe acute pancreatitis; Peritoneal macrophages; Cell polarization; Curcumin; Nanoparticles

Core Tip: This study provides the first evidence that curcumin nanoparticles (Cur-NPs) alleviate the early inflammatory response in severe acute pancreatitis by activating nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) signaling pathway to regulate polarization of peritoneal macrophages. Cur-NPs significantly ameliorated pancreatic tissue damage and reduced serum levels of inflammatory factors. Cur-NPs exerted therapeutic effects by inducing a shift in macrophage polarization from the proinflammatory M1 to anti-inflammatory M2 phenotype. Activation of the HO-1 pathway via promoted Nrf2 nuclear translocation mediated the suppressive effect of Cur-NPs on the nuclear factor kappa-B signaling pathway and oxidative stress.



INTRODUCTION

Severe acute pancreatitis (SAP) is a digestive disease characterized by sudden onset and critical condition, featuring high mortality rates and multiple severe complications. This disease frequently complicates with systemic inflammatory response syndrome and multiple organ dysfunction syndrome, posing significant challenges to clinical management[1,2]. The core pathophysiological mechanism of SAP involves excessive activation of the innate immune system, where peritoneal macrophages (PMs) serve as the first line of defense in the local peritoneal immune response, playing a crucial role in initiating and progressing the inflammatory reaction[3]. PMs exhibit significant phenotypic plasticity, capable of polarizing into functionally distinct subtypes based on local microenvironmental signals[4,5]. During the early inflammatory phase, PMs predominantly polarize toward the classically activated M1 phenotype, producing substantial amounts of proinflammatory factors such as tumor necrosis factor (TNF)-α and interleukin (IL)-1β, thereby exacerbating tissue damage. Conversely, during the repair phase, they polarize toward the alternatively activated M2 phenotype, secreting anti-inflammatory mediators like IL-10 to promote tissue repair[6]. In the SAP pathological process, excessive polarization of PMs toward the M1 phenotype is a critical factor driving the inflammatory cascade and disease progression. This polarization imbalance not only exacerbates local pancreatic injury but may also promote the spread of systemic inflammatory responses[7].

Current clinical treatment strategies for SAP remain primarily focused on organ function support and symptomatic management, lacking specific regulatory approaches targeting immune dysregulation[8]. Therefore, exploring immunomodulatory interventions capable of precisely regulating PMs polarization holds significant therapeutic implications for SAP. Curcumin, a natural polyphenolic compound extracted from turmeric rhizomes, demonstrates promising therapeutic potential in various inflammatory disease models due to its potent anti-inflammatory and antioxidant activities[9]. Curcumin can inhibit activation of proinflammatory signaling pathways such as nuclear factor kappa-B (NF-κB), reduce the production of proinflammatory factors, and simultaneously enhance cellular antioxidant defense capabilities[10]. However, its poor water solubility, low bioavailability, and rapid metabolism in vivo - pharmacokinetic limitations - have constrained its clinical application[11]. In recent years, the rapid advancement of nanomedicine delivery systems has provided novel approaches to enhance in vivo delivery efficiency of curcumin. Curcumin nanoparticles (Cur-NPs) engineered through nanotechnology improve drug stability, enhance targeted accumulation at inflammatory sites, and significantly boost bioavailability, demonstrating promising prospects for clinical applications[12].

The nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway serves as a core defense mechanism for cellular responses to oxidative stress. Recent studies have revealed that this pathway also plays a pivotal role in regulating inflammatory responses and immune cell functions[13,14]. Activation of the Nrf2 pathway not only induces the expression of multiple antioxidant enzymes to mitigate oxidative damage but also influences macrophage polarization through crosstalk with other signaling pathways, particularly by suppressing the NF-κB pathway - a key proinflammatory pathway[15,16]. While existing studies indicate the significant role of the Nrf2/HO-1 pathway in inflammation regulation, the specific mechanism by which Cur-NPs modulate M1/M2 polarization of PMs through this pathway to alleviate SAP remains to be thoroughly investigated[17].

Based on this, this study proposed the hypothesis that Cur-NPs may promote polarization of PMs from the M1 to M2 phenotype by activating the Nrf2/HO-1 signaling pathway, thereby alleviating the early inflammatory response and pancreatic tissue damage in SAP. This study established in vivo and in vitro SAP models to systematically validate the effects of Cur-NPs on PM polarization. It further investigated the pivotal role of the Nrf2/HO-1 pathway in this process to elucidate the underlying mechanism. These findings will provide experimental evidence and theoretical support for developing novel immunotargeted therapeutic strategies for SAP.

MATERIALS AND METHODS
Preparation, characterization, and safety validation of Cur-NPs

Cur-NPs were primarily synthesized using the thin-film hydration method[18,19]. It is a classic approach for constructing lipid nanocarriers, which has high encapsulation efficiency, process controllability, and excellent stability. In brief, curcumin is dissolved with amphiphilic phospholipid materials in the organic solvent chloroform. After forming a uniform lipid film via rotary evaporation, the film underwent hydration with phosphate-buffered saline (PBS) at an appropriate temperature. This process induced spontaneous curling of the lipid membrane, encapsulating the hydrophobic curcumin molecules to form nanoscale lipid particles.

A sample droplet was adsorbed onto a copper grid, stained, and then imaged. Liposome morphology was analyzed by transmission electron microscopy (TEM) with negative staining using 2% phosphotungstic acid.

One mL aliquot of the liposome suspension was taken, and the hydrodynamic diameter and polydispersity index were measured by dynamic light scattering (DLS) at 25 °C. One mL aliquot of the suspension was placed in a folded capillary cell to determine the surface charge via electrophoretic light scattering.

The drug-loaded liposomes were placed in PBS release medium containing 1% Tween-80 at different pH values (5.0, 6.5 and 7.4) and incubated under continuous agitation at 37 °C for 48 hours. At predetermined time points, 2 mL aliquots were withdrawn and replaced with an equal volume of fresh medium at the same pH values. The cumulative release rate of curcumin was calculated by determining its concentration in the external medium.

Rhodamine B-loaded liposomes (Lipo-RhoB) were prepared, dialyzed to remove free dye, and dissolved in methanol for fluorescence quantification using a microplate reader. Aqueous Rhodamine B solution of matched fluorescence intensity served as the free dye control. For cellular uptake, PMs were incubated with either Lipo-RhoB or the control for 2 hours, followed by collection and analysis of intracellular fluorescence via flow cytometry.

The drug loading capacity (LC) and loading efficiency (LE) were determined to assess the formulation’s performance. The lyophilized liposomes (100 mg) were dissolved in DMSO (Dimethyl sulfoxide), and the curcumin content was quantified spectrophotometrically at 425 nm: LC (%) = (mass of encapsulated curcumin/mass of curcumin-loaded liposomes) × 100%; LE (%) = (mass of encapsulated curcumin/initial feeding mass of curcumin) × 100%.

A pharmacokinetic study was conducted by intraperitoneal injection of nanoparticles, free curcumin, and curcumin-loaded nanoparticles into healthy Sprague Dawley rats. Blood samples were collected at 6 hours, 12 hours, and 24 hours after administration, anticoagulated with heparin, and centrifuged to obtain plasma. Plasma samples were pretreated using an acetonitrile protein precipitation method. Briefly, 100 µL of plasma was mixed with 400 µL of acetonitrile. The mixture was vortexed and then centrifuged (4 °C, 15000 rpm, 15 minutes). The resulting supernatant was filtered through a 0.22 µm membrane filter for subsequent analysis. The concentration of curcumin in plasma was determined using ultra performance liquid chromatography - mass spectrometry: Separation was performed on a C18 column, and detection was carried out in negative ion selected reaction monitoring mode. Finally, based on the blood drug concentration data at each time point, the main pharmacokinetic parameters were calculated using the non-compartmental model in the DAS 3.0 software, with data expressed as mean ± SD.

Cytotoxicity was evaluated using the CCK-8 assay. Cells were seeded in 96-well plates. Upon reaching adherence, the culture medium was replaced with media containing different formulations (Blank Nanoparticles, Free Curcumin, and Cur-NPs) at a concentration gradient (10 μM, 20 μM, 40 μM, 60 μM, 80 μM, and 100 μM). After incubation for 6 hours, 12 hours, and 24 hours, CCK-8 reagent was added to each well. Following a further incubation, the absorbance at 450 nm was measured. The cell survival rate was calculated using the standard formula: Survival rate (%) = [(OD experimental - OD blank)/(OD control - OD blank)] × 100%.

Hemocompatibility and in vivo biocompatibility of the nanoparticles were evaluated. For hemolysis testing, 2% red blood cell suspension was incubated with nanoparticle solutions at various concentrations, along with PBS (negative control) and deionized water (positive control), at 37 °C for 1 hours. After centrifugation, the absorbance of the supernatant was measured at 540 nm to calculate the hemolysis rate. The clotting assay was performed using platelet-rich plasma. Following incubation with nanoparticle solutions at 37 °C for 2 minutes, pre-warmed calcium chloride was added to initiate coagulation, and the clotting time was recorded. For in vivo biocompatibility assessment, rats treated with Cur-NPs for 24 hours and 7 days were euthanized. Key organs (heart, liver, spleen, lungs, and kidneys) were harvested and fixed, followed by sectioning and staining with hematoxylin and eosin (H&E) for histopathological examination.

Experimental animals and study design

All animal experimental protocols were reviewed and approved by the Animal Ethics Committee of the General Hospital of the Western Theater Command (Approval No. 2025EC10-ky038), and were strictly conducted in accordance with international guidelines for the care and use of laboratory animals. Healthy adult male Sprague Dawley rats (200-220 g), purchased from Beijing SPF Biotechnology Co., Ltd. (License No: SCXK 2024-0001), were acclimatized for one week under standard laboratory conditions. The rats were then randomly assigned to four groups (n = 6).

Sham group: Rats underwent a laparotomy during which the pancreatic tissue was gently manipulated, after which the abdomen was closed without any drug injection. SAP model group: The SAP model was established via the classic retrograde infusion into the biliopancreatic duct[20,21]. Following anesthesia and laparotomy, the common bile duct was occluded at the hepatic portal. A catheter was then inserted retrogradely towards the duodenal papilla to infuse 5% sodium taurocholate (1.0 mL/kg) at a constant rate of 0.1 mL/minutes. SAP + Cur-NPs group treated at different doses (Cur-NPs-50, Cur-NPs-100, and Cur-NPs-150 groups): Upon successful model induction, rats received an intraperitoneal injection of Cur-NPs (at curcumin-equivalent doses of 50 mg/kg, 100 mg/kg, and 150 mg/kg). Cur-NPs control group (Cur-NPs-only): Rats received only an intraperitoneal injection of an equivalent dose of Cur-NPs (150 mg/kg) without prior SAP model induction.

Specimen collection and handling

Serum collection and analysis: At 24 hours post-model induction, rats were anesthetized via an intraperitoneal injection of an overdose of sodium pentobarbital. Blood samples were collected from the abdominal aorta, allowed to clot at room temperature for 2 hours, and then centrifuged at 3000 rpm for 15 minutes. The resulting supernatant (serum) was aliquoted and stored at -80 °C for subsequent biochemical analysis. The frozen serum was used to determine the levels of serum amylase (AMY), lipase (LIP), and inflammatory cytokines (TNF-α, IL-1β, and IL-10).

Pancreatic tissue harvesting and processing: The entire pancreas was carefully dissected and harvested. After rinsing with ice-cold PBS, a portion of the pancreatic tissue was fixed in 4% paraformaldehyde for subsequent paraffin embedding, sectioning, and H&E staining.

Isolation and culture of primary PMs: At 24 hours post Cur-NPs intervention, peritoneal lavage was performed using ice-cold DMEM medium supplemented with 2% antibiotics and 0.4 mg/mL heparin sodium. The collected lavage fluid was centrifuged at 1000 rpm for 10 minutes to obtain the cell pellet. If the pellet appeared red, indicating erythrocyte contamination, 3 mL of ACK lysis buffer was added and incubated at room temperature for 3 minutes to lyse red blood cells. The cells were then washed twice with PBS and subsequently resuspended in DMEM medium supplemented with 10% fetal bovine serum. The cell suspension was seeded into culture dishes and incubated for 2 hours at 37 °C in a 5% CO2 atmosphere. After the incubation, non-adherent cells were removed by discarding the supernatant. The resulting adherent cells were defined as and used as primary PMs.

In vitro experimental design

To investigate the therapeutic effect and underlying mechanism of Cur-NPs at the cellular level, primary PMs were assigned to seven experimental groups. Control group: Cells were maintained in standard culture medium. SAP-AF group: Cells were stimulated with culture medium containing 10% ascitic fluid collected from SAP model rats. SAP-AF + Cur-NPs group: Following stimulation with 10% SAP ascitic fluid, cells were co-treated with Cur-NPs (at a curcumin-equivalent concentration of 10 μmol/L). SAP-AF + Nrf2 agonist group: Following stimulation with 10% SAP ascitic fluid, cells were co-treated with the specific Nrf2 agonist tert-butylhydroquinone (TBHQ) (10 μmol/L). SAP-AF + ML385 group: Following stimulation with 10% SAP ascitic fluid, cells were co-treated with Cur-NPs (10 μmol/L) and the Nrf2-specific inhibitor ML385 (10 μmol/L). Nrf2 agonist group: Cells were treated solely with 10 μmol/L TBHQ without SAP ascitic fluid stimulation. Nrf2 inhibitor group: Cells were treated solely with 10 μmol/L ML385 without SAP ascitic fluid stimulation. After 24 hours of intervention, cells from each group were collected for subsequent analysis.

Histopathological analysis

Following fixation, pancreatic tissue specimens were embedded in paraffin, sectioned at a thickness of 4 µm, and stained with H&E. All tissue sections were randomly coded and independently evaluated by two experienced pathologists who were blinded to the experimental groups. Blinded pathological scoring was performed according to the criteria under a light microscope, assessing the severity of edema, inflammatory cell infiltration, acinar cell necrosis, and hemorrhage, the specific scoring rules are shown in Table 1. To ensure scoring consistency, 30% of the sections were randomly selected and re-scored by both pathologists; agreement between their assessments was analyzed using the weighted kappa statistic.

Table 1 Histopathological scoring criteria for pancreatic tissue in severe acute pancreatitis model.
Scoring parameter
0
1
2
3
EdemaAbsentFocal widening of interlobular spaces or mild diffuse wideningModerate diffuse widening of interlobular spacesSevere diffuse widening of interlobular spaces with acinar separation
Inflammatory cell infiltrationAbsentMinor, focal infiltration (predominantly neutrophils)Moderate, multifocal infiltrationMarked, diffuse infiltration (may include perivascular cuffing)
Acinar cell necrosisAbsentFocal necrosis (< 5% of acinar cells involved)Multifocal/patchy necrosis (5%-20% of acinar cells involved)Widespread/confluent necrosis (> 20% of acinar cells involved)
HemorrhageAbsent1-2 focal hemorrhagic foci3-5 focal hemorrhagic fociExtensive, diffuse hemorrhage
Biochemical and inflammatory marker analysis

All assays were performed in strict accordance with the manufacturers’ instructions. The levels of AMY, LIP, TNF-α, IL-1β, and IL-10 in serum and cell homogenates were quantified using specific commercial enzyme-linked immunosorbent assay (ELISA) kits. The lipid peroxidation product malondialdehyde (MDA) was measured by the thiobarbituric acid method, while the activity of the antioxidant enzyme superoxide dismutase (SOD) was determined using the xanthine oxidase (NBT) method. ELISA kits for AMY, LIP, TNF-α, IL-1β, and IL-10 were purchased from Beijing Solarbio Science & Technology Co., Ltd (Beijing, China). Kits for MDA and SOD assays were obtained from Beyotime Biotechnology Co., Ltd (Shanghai, China).

Flow cytometry

Cell suspensions were collected and centrifuged at 300 g for 5 minutes. The cell concentration was adjusted to 1 × 107 cells/mL. A 100 μL aliquot of the adjusted cell suspension (containing 1 × 106 cells) was transferred into dedicated flow cytometry tubes. For immunostaining, the following antibodies were used: FITC Mouse Anti-Rat CD86 (Cat# 561961, BD Biosciences), APC Anti-Human CD163 (Cat# RH1630, Nuohe Bio), Anti-Rat CD68 recombinant antibody (Cat# AR2268125, PBM), and PC5.5 Anti-Rat CD45 (Cat# RR04507, Nuohe Bio). Cells were incubated with the antibodies for 30 minutes in the dark. Sample acquisition was performed using a flow cytometer (CytoFLEX, United States), and the percentages of M1 (CD86+) and M2 (CD163+) macrophages were analyzed.

Reverse transcription quantitative polymerase chain reaction

Total RNA was extracted from cells using the Feijie RNA extraction kit and subsequently reverse transcribed into complementary DNA. Gene expression levels of inducible nitric oxide synthase (iNOS), cluster of differentiation 163 (CD163), Nrf2, and HO-1 were quantified using a SYBR Green Premix Ex Taq kit (Takara, Japan) on a C1000 Touch Thermal Cycler equipped with a CFX96 Real-Time System (Bio-Rad). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Accurate Biology) was used as the endogenous reference gene for normalization. The relative mRNA expression levels were calculated using the 2-ΔΔCt method. The primer sequences used are listed in Table 2.

Table 2 Primer sequences for reverse transcription quantitative polymerase chain reaction analysis.
Primer name
Positive sequence (5′→3′)
Reverse sequence (5′→3′)
iNOSCTTGGAGCGAGTTGTGGATTGCCTCTTGTCTTTGACCCAGTAGC
CD163ATGGCACAGGTCATTCAACCCTCTGTCGTCGCTTCAGAGTCC
Nrf2TTAAGCAGCATACAGCAGGACATGGACAGTGGTAGTCTCAGCCT
HO-1GTGACAGAAGAGGCTAAGACGTAGTATCTTGAACCAGGCTAG
GAPDHGGCACAGTCAAGGCTGAGAATGATGGTGGTGAAGACGCCAGTA
Western blotting analysis

Cells from each experimental group were collected and lysed on ice for 30 minutes using pre-cooled RIPA lysis buffer supplemented with protease and phosphatase inhibitors. The lysates were centrifuged at 12000 rpm for 15 minutes at 4 °C. The resulting supernatant was collected, and the protein concentration was determined using a bicinchoninic acid assay kit. Protein samples were diluted with 5 × loading buffer and denatured by heating at 100 °C for 8 minutes. Equal amounts of total protein (15 μg per lane) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred onto polyvinylidene fluoride membranes using a wet transfer system. The membranes were blocked with rapid blocking buffer for 30 minutes at room temperature and then incubated overnight at 4 °C with the following specific primary antibodies (all diluted at 1:1000): Rabbit anti-CD163 (abs124249, absin), rabbit anti-CD86 (abs115477, absin), rabbit anti-iNOS (abs173586, absin), rabbit anti-HO-1 (2D4H5, Proteintech), rabbit anti-Nrf2 (HA723302, HUABIO), rabbit anti-pp65 (AWA47474, Abiowell), rabbit anti-pIκBα (82349, Proteintech), and mouse anti-β-actin (2D4H5, Proteintech). Following primary antibody incubation, the membranes were incubated with corresponding horseradish peroxidase (HRP)-conjugated secondary antibodies (diluted at 1:10000) for 1 hour at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) substrate and imaged with an Azure Biosystems a300 imaging system. Densitometric analysis of the bands was performed using ImageJ software.

Statistical analysis

SPSS 26.0 (SPSS Inc., United States) was used for statistical analysis. Shapiro-Wilk normality test and Levene homogeneity of variance test were performed on the measurement data. Data with normal distribution and homogeneity of variance were compared by One-way ANOVA among multiple groups, and Tukey’s post hoc test was used for pairwise comparison between groups. Non-parametric tests (such as Kruskal-Wallis H test or Mann-Whitney U test) were used for data that did not meet normality or homogeneity of variance conditions. P < 0.05 was considered statistically significant.

RESULTS
Characterization and safety validation of Cur-NPs

DLS analysis revealed that Cur-NPs exhibited a narrow and homogeneous size distribution, with a mean polydispersity index of 0.2007. This was consistent with TEM observations, showing a monomodal distribution pattern (Figure 1A-C), indicating favorable size uniformity and dispersion stability. The Zeta potential was measured at (-15.3 ± 1.8) mV, suggesting strong electrostatic repulsion between particles, which effectively prevented aggregation (Figure 1D). In vitro release studies demonstrated that Cur-NPs displayed a slow and sustained release profile. As the pH decreased, the release curve became steeper, and the time to reach the plateau phase was shortened (Figure 1E). Flow cytometry results indicated a significant increase in fluorescence intensity in the Lipo@RhoB group compared to the control group, strongly supporting that liposomal encapsulation enhances bioavailability (Figure 1F). Ultraviolet spectrophotometry determined that the drug LC and LE of Cur-NPs were 6.02% and 66.24%, respectively (Figure 1G). Pharmacokinetic studies showed that the plasma concentration of curcumin in the Cur-NPs group was significantly higher than that in the free curcumin group (Figure 1H). The CCK-8 assay indicated that cell viability in the blank liposome group remained close to 100% across all tested concentrations. At equivalent concentrations, cell viability was higher in the Cur-NPs group than in the free curcumin group. At low concentrations (10 μM and 20 μM), cell viability was largely unaffected. A significant decrease in viability was observed at higher concentrations (≥ 40 μM). Consequently, a concentration of 10 μM Cur-NPs was selected for subsequent experiments. At this concentration, optimal cell viability was achieved after 24 hours of treatment with Cur-NPs; therefore, a 24 hours intervention period was adopted for further studies (Figure 1I). Hemolysis assay results showed that the hemolysis rates were all below 5%. Clotting index assays revealed no significant differences between the experimental groups and the negative control group, indicating that the nanoparticles exhibited no anticoagulant or procoagulant tendency. H&E staining showed no significant pathological alterations in the major organs (heart, liver, spleen, lungs, and kidneys) during either the acute or subacute progression stages of SAP modeling (Figure 1J-L), confirming the in vivo safety profile of Cur-NPs.

Figure 1
Figure 1 Characterization and safety verification of curcumin nanoparticles. A: Morphological characteristics of curcumin nanoparticles (Cur-NPs); B: Particle size distribution of Cur-NPs; C: Polydispersion index of Cur-NPs; D: Zeta potential of curcumin nanoparticles; E: Cumulative drug release rate of Cur-NPs under different pH (5, 6.5, 7.4) conditions; F: Representative images of rhodamine B fluorescence signal in peritoneal macrophages of each group (Blank, Rhod, Lipo@Rhod); the mean fluorescence intensity in each group was quantitatively analyzed by flow cytometry; G: Encapsulation efficiency and drug loading capacity of Cur-NPs; H: Plasma concentrations of curcumin (Lipo, free curcumin, Cur-NPs) after 6 hours, 12 hours and 24 hours of treatment; I: Cell viability after 6 hours, 12 hours, and 24 hours of treatment in each group; J: Hemolysis rate (%) of Cur-NPs at each concentration; K: Coagulation index (%) of Cur-NPs at each concentration; L: Representative hematoxylin and eosin stained sections of five major organs: Heart, liver, spleen, lung, and kidney after 24 hours and 7 days of Cur-NPs treatment. Cur-NPs: Curcumin nanoparticles.
Cur-NPs alleviates SAP in vivo

To investigate the therapeutic potential of Cur-NPs for SAP, we established a rat model of SAP via retrograde biliopancreatic duct injection of sodium taurocholate. The histopathological scoring was performed by two independent pathologists blinded to the groups, who evaluated a randomly selected 30% of all sections. An excellent inter-observer agreement was achieved, with a weighted kappa statistic of 0.85 (95%CI: 0.78-0.92). Pancreatic tissues from the Sham group exhibited normal histological architecture with intact acini and absence of inflammatory cell infiltration. In stark contrast, the SAP group displayed significant pancreatic damage characterized by severe edema, extensive leukocyte infiltration, acinar cell necrosis, and hemorrhage, accompanied by a markedly increased pathological score. Intervention with Cur-NPs substantially preserved pancreatic architecture and significantly reduced the pathological score. Notably, at a concentration of 150 mg/mL, the pathological score in the Cur-NPs-treated group was closest to that of the Sham group; therefore, this concentration was selected for subsequent in vivo experiments (P < 0.05; Figure 2A and B). Biochemical analysis revealed that, compared with the Sham group, the SAP group showed significantly elevated serum levels of AMY and LIP activities, as well as the pro-inflammatory cytokines TNF-α and IL-1β. Relative to the SAP group, the Cur-NPs intervention group demonstrated a significant decrease in pancreatic enzyme activities and the levels of inflammatory mediators (P < 0.05; Figure 2C-F).

Figure 2
Figure 2 The therapeutic effect of curcumin nanoparticles in a rat model of severe acute pancreatitis. A: Representative photomicrographs of pancreatic tissue sections (hematoxylin and eosin staining); B: Histopathological scoring of pancreatic tissues for evaluating the severity of edema, inflammation, and necrosis. Orange arrows indicate areas of necrosis, inflammatory cell infiltration, and hemorrhage; C: The expression level of serum amylase; D: The expression level of serum lipase; E: The expression level of serum pro-inflammatory cytokine tumor necrosis factor-α; F: The expression level of serum interleukin-1β. The data were expressed as mean ± SD (n = 6 rats in each group). aP < 0.05 vs sham, bP < 0.05 vs severe acute pancreatitis. Cur-NPs: Curcumin nanoparticles; SAP: Severe acute pancreatitis.

Collectively, these results indicate that Cur-NPs intervention effectively mitigates pancreatic tissue damage and inflammatory response in SAP-induced rats.

Cur-NPs drive the polarization of PMs toward the M2 phenotype in vivo

To investigate the immunomodulatory effect of Cur-NPs on macrophage polarization during SAP progression, we examined the polarization status of PMs. Flow cytometric analysis revealed that compared with the Sham group, the SAP group exhibited a significantly increased ratio of CD86+/CD163+ cells (3.599 ± 0.081 vs 2.149 ± 0.1045) (Figure 3). In contrast, Cur-NPs markedly decreased the CD86+/CD163+ cell ratio (2.293 ± 0.023, P < 0.05; Figure 3A and B). At the molecular level, results from reverse transcription quantitative polymerase chain reaction (RT-qPCR), western blotting, and biochemical analyses demonstrated that expression of classical M1 markers (iNOS and IL-1) were significantly upregulated in the SAP group compared to the Sham group (the iNOS protein increased by 25 times, the mRNA increased by 3.77 times, and IL-1 increased by 5.65 times, P < 0.05; Figure 3C, D and F). Cur-NPs significantly suppressed expression of iNOS and IL-1. Conversely, expression of M2 markers (CD163 and IL-10) showed opposite trends (P < 0.05; Figure 3C, E and F). These findings collectively indicate that Cur-NPs can inhibit the M1 phenotype while promoting M2 differentiation, effectively reprogramming macrophage polarization in the context of SAP.

Figure 3
Figure 3 Curcumin nanoparticles induce polarization of peritoneal macrophages toward the M2 phenotype in vivo. A: Flow cytometric analysis of CD86 and CD163, specific proteins for peritoneal macrophages, showing co-expression of CD68 and CD45 in both M1 and M2 macrophages; B: The ratio of M1/M2 positive cells; C: The expression levels of inducible nitric oxide synthase (iNOS) and CD163 mRNA, with the internal reference gene GAPDH normalized; D: The expression level of pro-inflammatory cytokine IL-1β in cell homogenate; E: The expression level of the anti-inflammatory cytokine IL-10 in the cell homogenate; F: Representative immunoblots of iNOS and CD163 proteins with corresponding quantitative grayscale analysis. The data were expressed as mean ± SD (n = 6 rats in each group). aP < 0.05 vs sham, bP < 0.05 vs severe acute pancreatitis. Cur-NPs: Curcumin nanoparticles; SAP: Severe acute pancreatitis; iNOS: Inducible nitric oxide synthase.
Cur-NPs activate the Nrf2/HO-1 pathway in PMs in vivo

To investigate the activating effect of Cur-NPs on the Nrf2/HO-1 signaling pathway in vivo, we assessed the gene and protein expression of key molecules in this pathway within PMs. RT-qPCR indicated that mRNA expression of Nrf2 and HO-1 in the SAP group showed no significant difference compared to the Sham group. In contrast, the Cur-NPs treatment group exhibited a marked increase in mRNA expression of both Nrf2 and HO-1 compared to that in the SAP group, with increases of 1.88-fold and 1.47-fold, respectively (P < 0.05; Figure 4A). Western blotting demonstrated that Cur-NPs treatment significantly activated the Nrf2/HO-1 antioxidant pathway. Protein expression of Nrf2 and HO-1 were upregulated by 2.01-fold and 2.9-fold, respectively, compared to the SAP group (P < 0.05; Figure 4B). These findings indicate that Cur-NPs effectively activate the Nrf2/HO-1 signaling pathway, with this activation observed at the transcriptional and translational levels.

Figure 4
Figure 4 Curcumin nanoparticles activate nuclear factor erythroid 2-related factor 2/heme oxygenase-1 signaling pathway in peritoneal macrophages in vivo. A: The expression levels of t nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) mRNA, with the internal reference gene GAPDH normalized; B: Representative immunoblots of Nrf2 and HO-1 proteins with corresponding quantitative grayscale analysis. The data were expressed as mean ± SD (n = 6 rats in each group). aP < 0.05 vs sham, bP < 0.05 vs severe acute pancreatitis. Cur-NPs: Curcumin nanoparticles; SAP: Severe acute pancreatitis; iNOS: Inducible nitric oxide synthase; HO-1: Heme oxygenase-1; Nrf2: Nuclear factor erythroid 2-related factor 2.
Cur-NPs suppress NF-κB signaling activation by regulating Nrf2 subcellular localization in vitro

To further investigate the specific regulatory mechanism of Cur-NPs on the Nrf2/HO-1 axis and their effect on the NF-κB signaling pathway, an in vitro cell model was established. RT-qPCR and western blotting revealed that, compared to the control group, expression of Nrf2 and its downstream target gene HO-1 showed no significant difference in the SAP-AF group (Figure 5). In contrast, the Cur-NPs intervention group exhibited significant upregulation in expression of Nrf2 and HO-1 compared to that in the SAP-AF group (protein levels increased by 1.45-fold and 2.63-fold, and mRNA levels increased by 2.46-fold and 2.98-fold, respectively, P < 0.05; Figure 5A and C). Immunofluorescence revealed dynamic changes in the subcellular localization of Nrf2 protein. In the control group, fluorescent signals in the nuclei and cytoplasm were weak, with a nucleus-to-cytoplasm (N/C) fluorescence intensity ratio close to baseline levels. The SAP-AF group showed a mild increase in nuclear fluorescence signal and a decrease in cytoplasmic signal, resulting in an N/C ratio higher than that of the control group, although this difference was not significant. Compared to the SAP-AF group, the SAP-AF + Cur-NPs group exhibited strong positive fluorescence signals in the nuclei, significantly attenuated signals in the cytoplasm, and a markedly elevated N/C ratio (1.7 ± 0.038 vs 0.27 ± 0.016, P < 0.05; Figure 5B and D). Administration of the specific Nrf2 agonist TBHQ simulated effects similar to those of Cur-NPs intervention. Conversely, when Cur-NPs were administered in combination with the specific Nrf2 inhibitor ML385, the pattern of Nrf2 fluorescence resembled that of the SAP-AF group.

Figure 5
Figure 5 Curcumin nanoparticles mediate the suppression of nuclear factor kappa-B activation through a nuclear factor erythroid 2-related factor 2-dependent mechanism in vitro. A: The expression levels of nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) mRNA, with the internal reference gene GAPDH normalized; B: Quantitative Nrf2 nuclear translocation based on the ratio of nuclear/cytoplasmic fluorescence intensity; C: Representative immunoblots of Nrf2 and HO-1 proteins with corresponding quantitative grayscale analysis; D: Subcellular localization of Nrf2 (red), nuclei stained by DAPI (blue), with arrows highlighting nuclear translocation; E: Representative immunoblots of pp65 and pIκBα proteins with corresponding quantitative grayscale analysis. The data were expressed as mean ± SD (n = 6 rats in each group). aP < 0.05 vs sham, bP < 0.05 vs severe acute pancreatitis. Cur-NPs: Curcumin nanoparticles; SAP: Severe acute pancreatitis; iNOS: Inducible nitric oxide synthase; HO-1: Heme oxygenase-1; Nrf2: Nuclear factor erythroid 2-related factor 2.

We examined the phosphorylation of key proteins in the NF-κB signaling pathway. Compared to the control group, the SAP-AF group exhibited significantly elevated phosphorylation levels of p65 and IκBα proteins by approximately 1.9-fold and 2.9-fold, respectively (2.519 ± 0.042 vs 1.323 ± 0.037, 2.579 ± 0.02 vs 0.88 ± 0.01, P < 0.05).Treatment with Cur-NPs (SAP-AF + Cur-NPs group) significantly reduced phosphorylation of these proteins compared to that in the SAP-AF group (1.812 ± 0.019, 1.822 ± 0.02, respectively, P < 0.05; Figure 5E). Cotreatment with Cur-NPs and ML385 abolished this reduction and increased protein phosphorylation (2.592 ± 0.038, 2.461 ± 0.06). Similarly, phosphorylation of these proteins was significantly inhibited in the TBHQ group (P < 0.05). These results indicate that Cur-NPs can alter the subcellular distribution of Nrf2 and suppress activation of the NF-κB signaling pathway.

Cur-NPs attenuate inflammation and oxidative stress by modulating PM polarization via activation of the Nrf2/HO-1 pathway in vitro

In the in vitro model, we investigated whether Cur-NPs regulated polarization of PMs by activating the Nrf2/HO-1 pathway. Flow cytometric analysis revealed that compared to the control group, the proportion of M1-type PMs (CD86+) was significantly increased (0.21 ± 0.01 vs 0.098 ± 0.003), while the proportion of M2-type macrophages (CD163+) was decreased in the SAP-AF group (0.051 ± 0.001 vs 0.09 ± 0.002, P < 0.05) (Figure 6). Cur-NPs markedly reversed this trend, reducing the CD86+ proportion and increasing the CD163+ proportion (0.162 ± 0.003, 0.084 ± 0.003, P < 0.05; Figure 6A). The M1/M2 ratio was significantly elevated in the SAP-AF, whereas it was substantially restored upon Cur-NPs intervention. The TBHQ group demonstrated a stronger promotion of M2 polarization (P < 0.05; Figure 6B), and ML385 significantly inhibited the therapeutic effect of Cur-NPs (P < 0.05; Figure 6B). Consistent results from RT-qPCR and western blotting showed that SAP ascitic fluid stimulation upregulated expression of M1 markers (iNOS and CD86), which was significantly downregulated by Cur-NPs (P < 0.05). Expression of the M2 marker CD163 was suppressed after SAP-AF stimulation but returned toward normal levels following Cur-NPs intervention (P < 0.05; Figure 6D and G). Cur-NPs treatment Immunofluorescence analysis confirmed that following Cur-NPs treatment, the fluorescence intensity of CD86 was diminished while that of CD163 was enhanced. Consequently, the CD86+/CD163+ fluorescence intensity ratio decreased to 39.76% of that observed in the SAP-AF group (P < 0.05; Figure 6E and F).

Figure 6
Figure 6 Curcumin nanoparticles regulate macrophage polarization via nuclear factor erythroid 2-related factor 2 and heme oxygenase-1 signaling pathway in vitro, thereby alleviating inflammation and oxidative stress. A: Flow cytometric analysis of cluster of differentiation 86 (CD86) and CD163, specific proteins for peritoneal macrophages, showing co-expression of CD68 and CD45 in both M1 and M2 macrophages; B: Quantitative results of CD86 and CD163 positive cell counts; C: The ratio of M1/M2 positive cells; D: Representative immunoblots of CD86 and CD163 proteins with corresponding quantitative grayscale analysis; E: Expression and immunofluorescence localization of CD86 (green) and CD163 (red) proteins, with nuclei stained by DAPI (blue); F: Quantitative fluorescence ratio analysis of CD86 and CD163; G: The expression levels of inducible nitric oxide synthase and CD163 mRNA, with the internal reference gene GAPDH normalized; H: Levels of pro-inflammatory cytokines tumor necrosis factor-α and interleukin-1β; I: Oxidative stress indicators: Malondialdehyde and superoxide dismutase levels. The data were expressed as mean ± SD (n = 6 rats in each group). aP < 0.05 vs sham, bP < 0.05 vs severe acute pancreatitis. Cur-NPs: Curcumin nanoparticles; SAP: Severe acute pancreatitis; iNOS: Inducible nitric oxide synthase; HO-1: Heme oxygenase-1; Nrf2: Nuclear factor erythroid 2-related factor 2; TBHQ: Tert-butylhydroquinone; SAP-AF: Severe acute pancreatitis ascitic.

ELISA demonstrated that, compared to the control group, stimulation with SAP ascitic fluid significantly elevated inflammatory cytokines TNF-α and IL-1β by 7.32-fold and 11.14-fold, respectively (P < 0.05). Concurrently, MDA content increased by 7-fold, while SOD activity decreased by 65%. Cur-NPs treatment markedly reversed these alterations, significantly reducing the levels of inflammatory cytokines and MDA content (compared to the SAP-AF group: TNF-α decreased by 35.68%, IL-1β decreased by 55.89%, and MDA decreased by 45.3%) and increasing SOD activity by 1.66-fold (P < 0.05; Figure 6H and I). In the SAP ascitic-fluid-simulated environment, TBHQ demonstrated a protective effect similar to that of Cur-NPs on the above indicators. Conversely, the expression trends in the ML385 and Cur-NPs co-treatment group were comparable to those in the SAP-AF group.

These findings suggest that Cur-NPs alleviate inflammatory response and oxidative stress by activating the Nrf2/HO-1 pathway and balancing PM polarization.

DISCUSSION

This study successfully constructed Cur-NPs with favorable stability, sustained-release properties, and good biosafety. Through systematic in vitro and in vivo experiments, it was confirmed that in a SAP model, Cur-NPs could effectively alleviate pancreatic tissue damage, significantly improve pancreatic function, and suppress systemic inflammatory responses at a relatively low concentration (10 μM). The core mechanism lies in the specific activation of the Nrf2/HO-1 signaling pathway in PMs, thereby driving the polarization of PMs from the pro-inflammatory M1 phenotype towards the anti-inflammatory M2 phenotype. Existing studies have shown that, compared to free curcumin and other Nrf2 activators, Cur-NPs exhibit higher cytocompatibility and more sustained polarization-regulating capacity[22,23]. This study is the first to systematically elucidate the mechanism by which Cur-NPs regulate PM polarization via this specific signaling axis in a SAP model. It not only provides a new perspective for a deeper understanding of the pharmacological effects of Cur-NPs but also offers important experimental evidence and a theoretical foundation for developing targeted therapeutic strategies against immune imbalance in SAP.

The peritoneal cavity, as the primary site where the pathological process of pancreatitis initiates, serves as a critical hub for the production and dissemination of inflammatory factors, where PMs, being the most abundant immune cells in this cavity and key components of the innate immune system, play a pivotal role in the pathogenesis of SAP through their imbalanced phenotypic polarization[5,6,20]. During early pancreatitis, PMs directly interact with damaged pancreatic tissue within a unique pathological microenvironment rich in inflammatory mediators and activated pancreatic enzymes, which promotes their polarization toward the proinflammatory M1 phenotype and subsequent release of cytokines including TNF-α, IL-1β, and IL-6, thereby triggering inflammatory cascades and exacerbating tissue injury, while the concurrent reduction in M2 macrophages impairs anti-inflammatory and reparative functions, leading to disrupted immune homeostasis[24]. Our results demonstrate that in the SAP rat model and the in vitro ascitic-fluid-stimulated environment, PMs exhibited significant M1 polarization, characterized by an increased proportion of CD86+ cells, upregulation of iNOS expression, and substantial release of TNF-α and IL-1β, alongside downregulated CD163 expression and reduced IL-10 secretion. This disrupted M1/M2 balance directly contributes to an uncontrolled inflammatory microenvironment that aggravates pancreatic tissue damage and systemic inflammation, aligning with our previous findings. Although earlier studies using selective depletion of PMs through gadolinium chloride or clodronate liposomes demonstrated attenuated early-stage inflammation and pancreatic injury, they overlooked the essential role of macrophages in tissue repair[25]. Therefore, modulating PM polarization to maintain functional balance, rather than simply eliminating them, may represent a more effective strategy for controlling early inflammation and promoting subsequent tissue repair in SAP.

Curcumin, a natural polyphenolic compound with remarkable anti-inflammatory and antioxidant activities, has demonstrated significant therapeutic potential in various inflammatory disease models[26,27]. However, its clinical application has been substantially limited by poor aqueous solubility and bioavailability[28]. The development of nano-drug delivery systems has provided a promising technical pathway to address this challenge[29]. In this study, we successfully prepared Cur-NPs with favorable drug LE (66.24%) and sustained-release characteristics. TEM and DLS analyses revealed a uniform spherical morphology with an average particle size of 205.24 nm and a zeta potential of (-15.3 ± 1.8) mV. These suitable physicochemical properties, including particle size distribution and surface charge characteristics, enable Cur-NPs to accumulate in inflammatory regions through the enhanced permeability and retention effect while facilitating active uptake by macrophages, thereby improving local drug concentration. Pharmacokinetic studies further demonstrated that compared to free curcumin, Cur-NPs exhibited a significantly extended half-life and prolonged tissue retention time with minimal impact on cell viability, highlighting their dual advantages of targeted delivery and high stability. Importantly, both in vitro and in vivo safety evaluations confirmed the favorable biocompatibility of Cur-NPs. Within the effective dose range, no significant toxic or side effects on major organs were observed during either the acute or subacute phases of SAP. Pharmacodynamic assessments demonstrated that, in the mildly acidic microenvironment of SAP, Cur-NPs significantly ameliorated pancreatic pathological damage, reduced serum AMY and LIP activities, and suppressed systemic levels of inflammatory cytokines in rats. More importantly, the findings indicate that Cur-NPs reverse the SAP-induced polarization imbalance of PMs. This reversal was consistently demonstrated at both the gene and protein levels, characterized by downregulation of M1 phenotypic markers and upregulation of M2 phenotypic markers. These results provide a cellular basis for explaining the anti-inflammatory effects of Cur-NPs.

To elucidate the molecular mechanisms through which Cur-NPs modulate macrophage polarization, we focused on the Nrf2/HO-1 pathway; a central antioxidant signaling axis[30]. Beyond its well-established role as a key cellular defense system against oxidative stress, emerging evidence highlights its critical function in regulating inflammatory responses and immune cell activity[31,32]. Upon activation, Nrf2 translocates into the nuclei and initiates transcription of downstream antioxidant genes, including HO-1. HO-1 catalyzes heme degradation to generate bioactive molecules such as carbon monoxide, biliverdin, and bilirubin, which not only exert direct antioxidant effects but also mediate anti-inflammatory responses through modulation of multiple signaling pathways[30]. Of particular importance is the crosstalk between the Nrf2/HO-1 and NF-κB pathways. While NF-κB serves as the classical proinflammatory signaling pathway central to inflammation initiation in SAP, Nrf2/HO-1 activation can suppress NF-κB signaling through various molecular mechanisms, including regulation of cellular redox balance, interference with IKK complex activation, prevention of IκBα degradation, and inhibition of p65 nuclear translocation[33] (Figure 7). Our experimental results revealed that under SAP conditions, the gene and protein expression of key molecules in the Nrf2/HO-1 pathway were moderately upregulated, suggesting stress-induced activation that may represent an endogenous protective response. However, this self-activated response proved insufficient to effectively curb inflammatory progression. In contrast, Cur-NPs significantly enhanced Nrf2 and HO-1 expression and, more importantly, markedly promoted Nrf2 nuclear translocation, indicating effective activation of the transcriptional activity of the pathway and full functional regulation. We observed that Cur-NPs treatment substantially suppressed NF-κB pathway activation, as demonstrated by reduced phosphorylation levels of pp65 and pIκBα. These findings collectively suggest that Cur-NPs mediate NF-κB signaling inhibition through effective activation of the Nrf2/HO-1 pathway, providing crucial molecular insights into their anti-inflammatory mechanisms.

Figure 7
Figure 7 During the pathogenesis of severe acute pancreatitis, inflammatory signaling activates the IKK complex (composed of IKKα, IKKβ, and IKKγ). This complex phosphorylates IκB proteins, leading to the release of the nuclear factor kappa-B (NF-κB) p50-p65 heterodimer, which rapidly translocates into the nucleus. It binds to specific sequences within the promoter regions of target genes, initiating the transcription of a wide array of pro-inflammatory factors and promoting macrophage polarization toward the M1 phenotype. Concurrently, in the cytoplasm, Keap1 undergoes conformational changes in response to inflammatory signals, facilitating the ubiquitination and subsequent degradation of nuclear factor erythroid 2-related factor 2 (Nrf2). As a result, the nuclear translocation of Nrf2 is suppressed. Following intervention with curcumin nanoparticles, nuclear translocation of Nrf2 is markedly enhanced. Within the nucleus, abundant Nrf2 forms heterodimers with small Maf proteins. These dimers recognize and bind to the antioxidant response element in the promoter regions of target genes, thereby promoting the expression of heme oxygenase-1 (HO-1). HO-1 subsequently inhibits the phosphorylation of IκB, which in turn prevents the nuclear translocation and transcriptional activity of the NF-κB p50-p65 dimer. This cascade ultimately suppresses the expression of pro-inflammatory cytokines and promotes macrophage polarization toward the M2 phenotype. Cur-NPs: Curcumin nanoparticles; SAP: Severe acute pancreatitis; iNOS: Inducible nitric oxide synthase; HO-1: Heme oxygenase-1; Nrf2: Nuclear factor erythroid 2-related factor 2; ARE: Antioxidant response element; NF-κB: Nuclear factor kappa-B; TNF-α: Tumor necrosis factor-α; IL: Interleukin.

To further confirm the central role of the Nrf2/HO-1 pathway in the action of Cur-NPs, this study employed pharmacological interventions for validation. Treatment with the Nrf2-specific agonist TBHQ effectively mimicked all key effects of Cur-NPs[34], including promoting M2 polarization, inhibiting the release of inflammatory factors, alleviating oxidative stress, and suppressing NF-κB pathway activation. Conversely, application of the Nrf2 inhibitor ML385 blocked the therapeutic effects of Cur-NPs and exacerbated the pathological progression of SAP[33], manifested as enhanced M1 polarization, aggravated inflammatory response, and overactivation of the NF-κB signaling pathway. These results provide direct evidence for the central role of the Nrf2/HO-1 pathway in Cur-NPs-mediated regulation of macrophage polarization, indicating that activation of this pathway is indeed the upstream key event through which Cur-NPs exert immunomodulatory functions. Our study found that Cur-NPs significantly improved oxidative stress indicators, reduced lipid peroxide levels, and increased SOD activity. These antioxidant effects could also be simulated by TBHQ, further supporting the crucial role of the Nrf2/HO-1 pathway in mediating the antioxidant effects of Cur-NPs. Given the vicious cycle formed by oxidative stress and inflammatory response during SAP progression, Cur-NPs exert both anti-inflammatory and antioxidant effects by activating the same core pathway. This multi-target synergistic mechanism may be an important reason for the significant efficacy of Cur-NPs in SAP treatment.

Although this study established a relatively complete chain of evidence through a multi-level experimental design, certain limitations remain. First, the animal experiments were based on a single-center, small-sample model. The conclusions necessitate validation through multi-center, large-sample studies and further verification in preclinical large-animal models. Second, the research primarily focused on the short-term efficacy and safety evaluation of Cur-NPs. Based on preliminary pharmacodynamic and safety considerations, intraperitoneal injection was the main administration route at this stage. Subsequent studies will employ intravenous injection and other methods to systematically investigate the long-term toxicity and complete pharmacokinetic profile of Cur-NPs, thereby providing a more substantial basis for the clinical translation of this formulation. Furthermore, the regulatory mechanism of macrophage polarization is complex. Beyond the Nrf2/HO-1 pathway examined in this study, the potential involvement of other signaling pathways, such as STAT and PI3K/Akt, requires consideration. Whether interactions exist between these pathways and Nrf2, and their specific roles in the Cur-NPs-mediated regulation of macrophage polarization, warrant further elucidation. Finally, Cur-NPs face several translational challenges regarding preparation technology, clinical administration strategies, and dosage regimens, which should be addressed systematically in future research.

CONCLUSION

In summary, this study has, for the first time, systematically integrated four critical components - the Cur-NPs delivery system, Nrf2/HO-1 pathway activation, macrophage M1/M2 polarization reprogramming, and anti-inflammatory effects - into a coherent signaling axis within a SAP model. We have clearly demonstrated that Cur-NPs activate the Nrf2/HO-1 pathway, drive the polarization of PMs from the M1 to M2 phenotype, and through crosstalk mechanisms suppress NF-κB signaling, thereby synergistically exerting anti-inflammatory and antioxidant effects that ultimately alleviate early inflammatory responses and pancreatic injury in SAP. This discovery offers a transformative delivery strategy to overcome the pharmacokinetic limitations of curcumin but also provides novel targets and insights for immunomodulatory therapy in SAP.

ACKNOWLEDGEMENTS

We are extremely grateful to the General Surgery Department of the Western Theater General Hospital & Sichuan Key Laboratory of Organ Stress Injury and Functional Repair for providing the platform for the experiments.

References
1.  Swaroop VS, Chari ST, Clain JE. Severe acute pancreatitis. JAMA. 2004;291:2865-2868.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 208]  [Cited by in RCA: 179]  [Article Influence: 8.1]  [Reference Citation Analysis (0)]
2.  Portelli M, Jones CD. Severe acute pancreatitis: pathogenesis, diagnosis and surgical management. Hepatobiliary Pancreat Dis Int. 2017;16:155-159.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 80]  [Cited by in RCA: 106]  [Article Influence: 11.8]  [Reference Citation Analysis (1)]
3.  Chen X, Chen X, Yan D, Zhang N, Fu W, Wu M, Ge F, Wang J, Li X, Geng M, Wang J, Tang D, Liu J. GV-971 prevents severe acute pancreatitis by remodeling the microbiota-metabolic-immune axis. Nat Commun. 2024;15:8278.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 22]  [Reference Citation Analysis (0)]
4.  Duan F, Wang X, Wang H, Wang Y, Zhang Y, Chen J, Zhu X, Chen B. GDF11 ameliorates severe acute pancreatitis through modulating macrophage M1 and M2 polarization by targeting the TGFβR1/SMAD-2 pathway. Int Immunopharmacol. 2022;108:108777.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 32]  [Article Influence: 8.0]  [Reference Citation Analysis (1)]
5.  Landén NX, Li D, Ståhle M. Transition from inflammation to proliferation: a critical step during wound healing. Cell Mol Life Sci. 2016;73:3861-3885.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1652]  [Cited by in RCA: 1269]  [Article Influence: 126.9]  [Reference Citation Analysis (7)]
6.  Toledo B, Zhu Chen L, Paniagua-Sancho M, Marchal JA, Perán M, Giovannetti E. Deciphering the performance of macrophages in tumour microenvironment: a call for precision immunotherapy. J Hematol Oncol. 2024;17:44.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 160]  [Article Influence: 80.0]  [Reference Citation Analysis (0)]
7.  Yunna C, Mengru H, Lei W, Weidong C. Macrophage M1/M2 polarization. Eur J Pharmacol. 2020;877:173090.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2084]  [Cited by in RCA: 1840]  [Article Influence: 306.7]  [Reference Citation Analysis (7)]
8.  Zerem E, Kurtcehajic A, Kunosić S, Zerem Malkočević D, Zerem O. Current trends in acute pancreatitis: Diagnostic and therapeutic challenges. World J Gastroenterol. 2023;29:2747-2763.  [PubMed]  [DOI]  [Full Text]
9.  Laurindo LF, de Carvalho GM, de Oliveira Zanuso B, Figueira ME, Direito R, de Alvares Goulart R, Buglio DS, Barbalho SM. Curcumin-Based Nanomedicines in the Treatment of Inflammatory and Immunomodulated Diseases: An Evidence-Based Comprehensive Review. Pharmaceutics. 2023;15:229.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 56]  [Reference Citation Analysis (0)]
10.  Aggarwal S, Ichikawa H, Takada Y, Sandur SK, Shishodia S, Aggarwal BB. Curcumin (diferuloylmethane) down-regulates expression of cell proliferation and antiapoptotic and metastatic gene products through suppression of IkappaBalpha kinase and Akt activation. Mol Pharmacol. 2006;69:195-206.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 424]  [Cited by in RCA: 397]  [Article Influence: 19.9]  [Reference Citation Analysis (0)]
11.  Zhou Y, Zhang T, Wang X, Wei X, Chen Y, Guo L, Zhang J, Wang C. Curcumin Modulates Macrophage Polarization Through the Inhibition of the Toll-Like Receptor 4 Expression and its Signaling Pathways. Cell Physiol Biochem. 2015;36:631-641.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 106]  [Cited by in RCA: 148]  [Article Influence: 14.8]  [Reference Citation Analysis (0)]
12.  Gulcubuk A, Altunatmaz K, Sonmez K, Haktanir-Yatkin D, Uzun H, Gurel A, Aydin S. Effects of curcumin on tumour necrosis factor-alpha and interleukin-6 in the late phase of experimental acute pancreatitis. J Vet Med A Physiol Pathol Clin Med. 2006;53:49-54.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 60]  [Cited by in RCA: 54]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
13.  Qi W, Liu C, Shi L, Li H, Hou X, Du H, Chen L, Gao X, Cao X, Guo N, Dong Y, Li C, Yuan F, Teng Z, Hu H, Zhu F, Zhou X, Guo L, Zhao M, Xia M. CD169+ Macrophages Mediate the Immune Response of Allergic Rhinitis Through the Keap1/Nrf2/HO-1 Axis. Adv Sci (Weinh). 2024;11:e2309331.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 9]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
14.  Zhao X, Li M, Lu Y, Wang M, Xiao J, Xie Q, He X, Shuai S. Sirt1 inhibits macrophage polarization and inflammation in gouty arthritis by inhibiting the MAPK/NF-κB/AP-1 pathway and activating the Nrf2/HO-1 pathway. Inflamm Res. 2024;73:1173-1184.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 38]  [Reference Citation Analysis (0)]
15.  Xu M, Zhou Y, Xu Y, Shao A, Han H, Ye J. Supramolecular Engineering of Nanoceria for Management and Amelioration of Age-Related Macular Degeneration via the Two-Level Blocking of Oxidative Stress and Inflammation. Adv Sci (Weinh). 2025;12:e2408436.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 9]  [Reference Citation Analysis (0)]
16.  O’Rourke SA, Shanley LC, Dunne A. The Nrf2-HO-1 system and inflammaging. Front Immunol. 2024;15:1457010.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 104]  [Reference Citation Analysis (0)]
17.  Li N, Xu J, Liu B, Elango J, Wu W. Highly Soluble Mussel Foot Protein Enhances Antioxidant Defense and Cytoprotection via PI3K/Akt and Nrf2/HO-1 Pathways. Antioxidants (Basel). 2025;14:644.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
18.  Mundekkad D, Cho WC. Applications of Curcumin and Its Nanoforms in the Treatment of Cancer. Pharmaceutics. 2023;15:2223.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 39]  [Cited by in RCA: 30]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
19.  Chen Y, Lu Y, Lee RJ, Xiang G. Nano Encapsulated Curcumin: And Its Potential for Biomedical Applications. Int J Nanomedicine. 2020;15:3099-3120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 92]  [Cited by in RCA: 124]  [Article Influence: 20.7]  [Reference Citation Analysis (0)]
20.  Laukkarinen JM, Van Acker GJ, Weiss ER, Steer ML, Perides G. A mouse model of acute biliary pancreatitis induced by retrograde pancreatic duct infusion of Na-taurocholate. Gut. 2007;56:1590-1598.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 94]  [Cited by in RCA: 97]  [Article Influence: 5.1]  [Reference Citation Analysis (4)]
21.  Schmidt J, Rattner DW, Lewandrowski K, Compton CC, Mandavilli U, Knoefel WT, Warshaw AL. A better model of acute pancreatitis for evaluating therapy. Ann Surg. 1992;215:44-56.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 686]  [Cited by in RCA: 709]  [Article Influence: 20.9]  [Reference Citation Analysis (0)]
22.  Saha S, Sachivkina N, Karamyan A, Novikova E, Chubenko T. Advances in Nrf2 Signaling Pathway by Targeted Nanostructured-Based Drug Delivery Systems. Biomedicines. 2024;12:403.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 14]  [Reference Citation Analysis (0)]
23.  Zheng S, Xue T, Wang B, Guo H, Liu Q. Chinese Medicine in the Treatment of Ulcerative Colitis: The Mechanisms of Signaling Pathway Regulations. Am J Chin Med. 2022;50:1781-1798.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 120]  [Cited by in RCA: 100]  [Article Influence: 25.0]  [Reference Citation Analysis (1)]
24.  Gea-Sorlí S, Closa D. Role of macrophages in the progression of acute pancreatitis. World J Gastrointest Pharmacol Ther. 2010;1:107-111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 44]  [Cited by in RCA: 62]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
25.  Moreno SG. Depleting Macrophages In Vivo with Clodronate-Liposomes. Methods Mol Biol. 2018;1784:259-262.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 87]  [Article Influence: 10.9]  [Reference Citation Analysis (0)]
26.  Sadeghi M, Dehnavi S, Asadirad A, Xu S, Majeed M, Jamialahmadi T, Johnston TP, Sahebkar A. Curcumin and chemokines: mechanism of action and therapeutic potential in inflammatory diseases. Inflammopharmacology. 2023;31:1069-1093.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 68]  [Cited by in RCA: 108]  [Article Influence: 36.0]  [Reference Citation Analysis (0)]
27.  Kotha RR, Luthria DL. Curcumin: Biological, Pharmaceutical, Nutraceutical, and Analytical Aspects. Molecules. 2019;24:2930.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 767]  [Cited by in RCA: 576]  [Article Influence: 82.3]  [Reference Citation Analysis (6)]
28.  Hao M, Zhang C, Wang T, Hu H. Pharmacological effects, formulations, and clinical research progress of curcumin. Front Pharmacol. 2025;16:1509045.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 17]  [Reference Citation Analysis (0)]
29.  Rahimi HR, Nedaeinia R, Sepehri Shamloo A, Nikdoust S, Kazemi Oskuee R. Novel delivery system for natural products: Nano-curcumin formulations. Avicenna J Phytomed. 2016;6:383-398.  [PubMed]  [DOI]  [Full Text]
30.  Loboda A, Damulewicz M, Pyza E, Jozkowicz A, Dulak J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism. Cell Mol Life Sci. 2016;73:3221-3247.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2294]  [Cited by in RCA: 2120]  [Article Influence: 212.0]  [Reference Citation Analysis (7)]
31.  Zhang DD. Thirty years of NRF2: advances and therapeutic challenges. Nat Rev Drug Discov. 2025;24:421-444.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 120]  [Cited by in RCA: 134]  [Article Influence: 134.0]  [Reference Citation Analysis (3)]
32.  Zhang DD. The Nrf2-Keap1-ARE signaling pathway: The regulation and dual function of Nrf2 in cancer. Antioxid Redox Signal. 2010;13:1623-1626.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 130]  [Cited by in RCA: 144]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
33.  Cheng HL, Yen CC, Huang LW, Hu YC, Huang TC, Hsieh BS, Chang KL. Selenium Lessens Osteoarthritis by Protecting Articular Chondrocytes from Oxidative Damage through Nrf2 and NF-κB Pathways. Int J Mol Sci. 2024;25:2511.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 18]  [Reference Citation Analysis (0)]
34.  Wang LF, Su SW, Wang L, Zhang GQ, Zhang R, Niu YJ, Guo YS, Li CY, Jiang WB, Liu Y, Guo HC. Tert-butylhydroquinone ameliorates doxorubicin-induced cardiotoxicity by activating Nrf2 and inducing the expression of its target genes. Am J Transl Res. 2015;7:1724-1735.  [PubMed]  [DOI]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B, Grade B, Grade C

Novelty: Grade B, Grade B, Grade B, Grade C

Creativity or innovation: Grade B, Grade B, Grade B, Grade C

Scientific significance: Grade A, Grade B, Grade B, Grade C

P-Reviewer: Atrooz OM, PhD, Full Professor, Jordan; Sun XY, MD, PhD, Professor, China; Zou CY, PhD, China S-Editor: Li L L-Editor: A P-Editor: Zheng XM

Write to the Help Desk