BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Feb 28, 2025; 31(8): 100227
Published online Feb 28, 2025. doi: 10.3748/wjg.v31.i8.100227
Mechanism of Wuling powder modulating proBDNF/p75NTR/sortilin and BDNF/TrkB pathways in the treatment of ulcerative colitis complicated with depression
Jing-Jing Wang, Yi-Hong Fan, Department of Gastroenterology, The First Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou 310003, Zhejiang Province, China
Wan-Ting Cao, Department of Gastroenterology, Beilun District Hospital of Traditional Chinese Medicine, Ningbo 315800, Zhejiang Province, China
Rong Huang, Department of Gastroenterology, Jiaxing Hospital of Traditional Chinese Medicine, Jiaxing 314000, Zhejiang Province, China
Xin-Yi Yao, Department of Gastroenterology, Deqing County People’s Hospital, Huzhou 313200, Zhejiang Province, China
Meng-Lin Li, Department of Gastroenterology, Jinhua Fifth Hospital, Jinhua 321000, Zhejiang Province, China
ORCID number: Jing-Jing Wang (0000-0002-1702-7942); Yi-Hong Fan (0000-0001-8217-9793); Rong Huang (0000-0002-8360-7777); Meng-Lin Li (0009-0008-6801-8705).
Author contributions: Wang JJ and Cao WT performed the experiments, analyzed the data and wrote the paper; Fan YH designed the research, revised the paper and contributed equally to this study; Huang R and Yao XY performed parts of the experiments and provided valuable suggestions for this study; Li ML contributed new analytic tools. All authors have read and approved the final manuscript.
Supported by Zhejiang Provincial Administration of Traditional Chinese Medicine, No. 2021ZA057.
Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Institutional Animal Care and Use Committee of Zhejiang Chinese Medical University (IACUC protocol number: Protocol No. 20200914-10).
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE Guidelines, and the manuscript was prepared and revised according to the ARRIVE Guidelines.
Data sharing statement: No additional data are available.
Corresponding author: Yi-Hong Fan, Department of Gastroenterology, The First Affiliated Hospital of Zhejiang Chinese Medical University, No. 54 Youdian Road, Shangcheng District, Hangzhou 310003, Zhejiang Province, China. yhfansjr@163.com
Received: August 10, 2024
Revised: November 22, 2024
Accepted: January 8, 2025
Published online: February 28, 2025
Processing time: 165 Days and 21.8 Hours

Abstract
BACKGROUND

Ulcerative colitis (UC) is a chronic inflammatory disease affecting the colon. The most common psychological issue in UC patients is varying degrees of depression, which affects the condition and quality of life of UC patients and may lead to deterioration of the patient’s condition. UC drugs combined with antianxiety and antidepression drugs can alleviate symptoms of both depression and UC. Brain-derived neurotrophic factor (BDNF) precursor (proBDNF)/p75 neurotrophin receptor (p75NTR)/sortilin and BDNF/tropomyosin receptor kinase B (TrkB) signalling balance is essential for maintaining brain homeostasis and preventing the development of depressive behaviours.

AIM

To explore the mechanism by which Wuling powder regulates the proBDNF/p75NTR/sortilin and BDNF/TrkB pathways in the treatment of UC with depression.

METHODS

Depression was established in C57BL/6J mice via chronic restraint stress, and the UC model was induced with dextran sodium sulfate (DSS). In the treatment stage, mesalazine (MS) was the basic treatment, Wuling powder was the experimental treatment, and fluoxetine was the positive control drug for treating depression. Changes in intestinal mucosal inflammation, behaviour, and the proBDNFp75NTR/sortilin and BDNF/TrkB pathways were evaluated.

RESULTS

In the depression groups, Wuling powder decreased the immobility time, increased the distance travelled in the central zone and the total distance travelled, and restored balance in the proBDNF/p75NTR/sortilin and BDNF/TrkB signalling pathways. In the DSS and chronic restraint stress + DSS groups, immobility time increased, distance travelled in the central zone and total distance travelled decreased, activity of the proBDNF/p75NTR/sortilin pathway was upregulated, and activity of the BDNF/TrkB pathway was downregulated, indicating that mice with UC often have comorbid depression. Compared with those of MS alone, Wuling powder combined with MS further decreased the colon histopathological scores and the expression levels of tumor necrosis factor-alpha and interleukin-6 mRNAs.

CONCLUSION

This study confirmed that Wuling powder may play an antidepressant role by regulating the balance of the proBDNF/p75NTR/sortilin and BDNF/TrkB signalling pathways and further relieve intestinal inflammation in UC.

Key Words: Wuling powder; Ulcerative colitis; Depression; Brain-derived neurotrophic factor; Brain-derived neurotrophic factor precursor

Core Tip: A common psychological problem in patients with ulcerative colitis is varying degrees of depression, which can cause the patient’s condition to worsen. Wuling powder is widely used to treat anxiety, depression, insomnia and headache. Previous studies have found that the balance between brain-derived neurotrophic factor (BDNF) precursor/p75 neurotrophin receptor/sortilin and BDNF/tropomyosin receptor kinase B signalling is essential for maintaining brain homeostasis and preventing the development of depressive behaviours. Our study suggests that Wuling powder may play an antidepressant role by regulating the balance of the BDNF precursor/p75 neurotrophin receptor/sortilin and BDNF/tropomyosin receptor kinase B signalling pathways. Moreover, Wuling powder combined with mesalazine can further relieve intestinal inflammation in mice with ulcerative colitis and depression.



INTRODUCTION

Ulcerative colitis (UC) is a chronic intestinal inflammation of the colon. In the long course of UC, treatment effects develop slowly, and UC is difficult to cure. Although the cause of UC is still not completely clear, in modern medicine, it is believed that UC is caused mainly by infection and immunity issues and that psychological factors are involved[1-3]. Under the many pressures of work and life in modern society, psychological problems such as depression often occur[4]. UC patients often experience anxiety, depression and other adverse emotional psychological factors, and UC has a bidirectional relationship with these conditions[5-7]. Intestinal inflammation can have a negative impact on patient mental health, and psychological factors can aggravate intestinal inflammation, leading to disease recurrence. The clinical symptoms of UC are characterized by chronic recurrence; therefore, patients with UC require long-term treatment. UC patients are faced with greater societal and psychological pressures and economic burdens and are prone to various adverse emotions or worsening symptoms. Compared with healthy people, UC patients are more prone to various negative emotions and psychological problems, such as anxiety, depression, pessimism and sensitivity, among which anxiety and depression are the most prominent[8-11]. Psychotherapy may become important in optimizing the treatment of UC.

Brain-derived neurotrophic factor (BDNF) is a major neurotrophic factor that plays an important role in the survival, differentiation and growth of peripheral and central neurons during development and adulthood[12-14]. BDNF can bind to the neuronal cell membrane receptor tropomyosin receptor kinase B (TrkB) through target-derived, secreted and paracrine pathways and then activate downstream signals to promote the survival, migration, differentiation, neurite growth and synaptic plasticity of neurons. By enhancing the activities of these neurons, BDNF is involved in emotion regulation[15,16]. As a precursor form of BDNF, BDNF precursor (proBDNF) plays the opposite role in regulating neuronal activity[17,18]. The combination of proBDNF and p75 neurotrophin receptor (p75NTR) induces long-term inhibition and triggers some intracellular signal cascades, leading to cell apoptosis, axon degradation and a reduction in dendritic complexity[19]. The activation of TrkB receptors by mature BDNF plays neurotrophic and antiapoptotic roles in processes such as neuronal survival, axon growth, dendritic differentiation and long-term enhancement[20,21]. Studies have shown that the balance of BDNF and proBDNF is critical for maintaining homeostasis in the brain and preventing the development of depressive behaviours[14,22-24].

Aminosalicylic acid is usually combined with selective serotonin reuptake inhibitors in the treatment of UC patients with depression, but antidepressants are associated with various adverse reactions of differing severity. Attention must be given to the starting dose, onset time of adverse reactions, course of treatment, patient tolerance and compliance[14,25]. Traditional Chinese medicine has the advantages of low cost and high patient acceptance. Wuling capsules have been shown to be safe and effective in the treatment of depression, functional gastrointestinal diseases, irritable bowel syndrome, gastroesophageal reflux disease and other digestive diseases[26]. Wuling powder, the main component of Wuling capsules, is isolated from Wuling ginseng, a rare medicinal fungus in China. The pharmacological effects of Wuling powder mainly include immune regulation, endocrine regulation, and antidepressant and antianxiety effects. Wuling powder is widely used to treat anxiety, depression, insomnia and headache[27,28].

Therefore, in this study, mice with dextran sodium sulfate (DSS)-induced chronic UC were first selected as research subjects, and depression was established in these mice through chronic restraint stress (CUMS). After model establishment, behavioural testing and index testing were performed to validate the model. In the treatment stage, mesalazine (MS) was used as the basic treatment, Wuling powder was used as the experimental treatment, fluoxetine (FLU) was used as the antidepressant positive control drug, and another blank group was established. The degree of intestinal mucosal inflammation and behavioural changes were evaluated. The mRNA and protein expression levels of BDNF, p75NTR, TrkB and sortilin in the hippocampus were measured. Changes in the BDNF/TrkB/sortilin and proBDNF/p75NTR pathways and the conversion of proBDNF to BDNF were evaluated. Thus, the mechanism of Wuling powder in the treatment of UC with depression was elucidated at the global and molecular levels.

MATERIALS AND METHODS
Animals and ethical statements

One hundred twenty-six healthy, specific pathogen-free C57BL/6J male mice, aged 6 to 8 weeks and with a body weight of 26-28 g, were used in this study. The mice were housed in cages (5 mice per cage) in a ventilated and clean environment at a temperature ranging from 20-26 °C, a relative humidity ranging from 40%-70%, a 12-hour/12-hour light/dark cycle, and free access to distilled water. The experiment involved adaptive feeding for 7 days prior to initiation.

Establishment of the models

Establishment of a mouse model of depression: A CUMS model was adopted to establish the depression model. Using a transparent plastic tube with a length of approximately 10 cm, an inner diameter of the tube mouth of 3.8 cm and a ventilation hole with a diameter of 1 cm were opened on the bottle mouth cap and the tube bottom, respectively. The mice were restrained by blocking the top and bottom with paper for 6 hours at a time for 28 days.

Establishment of a mouse model of UC: According to a previous study[29], a mouse model of UC was established via the DSS method. Briefly, 100 mL of distilled water was added to 2.5 g DSS to generate the DSS solution for the model. The acute UC mouse model was established by providing 2.5% DSS solution in the drinking water for 7 consecutive days and drugs or normal saline (NS) for the remainder of the time.

Experimental design and drug treatment

The mice were randomly divided into 13 groups: The control group (n = 10), depression group (n = 46), DSS group (n = 10) and compound model group (n = 60). The mice in the depression group were further divided into a depression model group (CUMS group) (n = 6), a FLU group (n = 10), a low-dose Wuling powder group (LD group) (n = 10), a medium-dose Wuling powder group (MD group) (n = 10) and a high-dose Wuling powder group (HD group) (n = 10). The mice in the compound model group were further divided into six groups: The compound model group (CUMS + DSS group) (n = 10), the MS group (n = 10), the MS + FLU group (n = 10), the MS + LD group (n = 10), the MS + MD group (n = 10), and the MS + HD group (n = 10).

Intervention and outcome evaluation

Modelling stage 1 (was from day 0 to day 21): The depression group and the compound model group were subjected to CUMS to establish the depression model, and the control group and the DSS group were fed normally. After the completion of this stage, the behaviour of the mice was tested (forced swimming test and open field test).

Modelling stage 2 (was from the day 22 to day 28): Mice in the DSS group and the compound model group were given 2.5% DSS solution in the drinking water ad libitum for 7 consecutive days to establish the acute UC mouse model, and the other mice were given distilled water ad libitum. At the same time, the control group, DSS group, CUMS group and CUMS + DSS group were treated with NS (10 mL/kg/day) via gavage. In the depression group, the LD, MD, and HD groups were given 0.5, 1.0, and 2.0 g/kg/day Wuling powder by gavage, respectively, and the FLU group was given 10 mg/kg/day FLU by gavage. In the compound model group, except for the CUMS + DSS group, MS was administered at 0.25 g/kg/day by gavage, whereas in the MS group, MS was administered at 0.25 g/kg/day, and NS at 10 mL/kg/day by gavage. The MS + LD, MS + MD and MS + HD groups were given 0.25 g/kg/day MS and 0.5, 1.0, and 2.0 g/kg/day Wuling powder by gavage, respectively. The MS + FLU group was given 0.25 g/kg/day MS and 10 mg/kg/day FLU by gavage for 7 days.

On the 29th day: All the mice were subjected to behavioural tests and disease activity index (DAI) gross score measurements. Finally, the mice were subsequently euthanized by cervical dislocation. The brains were immediately removed and placed on ice, and the hippocampal tissues were isolated for western blot evaluation of BDNF, proBDNF, p75NTR, TrkB and sortilin. BDNF, p75NTR, TrkB and sortilin mRNA levels were measured by reverse transcription-polymerase chain reaction. Colon tissues were collected for histological scoring, and tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6) mRNA levels were measured by reverse transcription-polymerase chain reaction (Figure 1).

Figure 1
Figure 1 Flowchart of intervention and outcome evaluation. A: Molding flow chart; B: Group administration and index detection. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; NS: Normal saline; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine; PCR: Polymerase chain reaction; proBDNF: Brain-derived neurotrophic factor precursor; p75NTR: P75 neurotrophin receptor; TrkB: Tropomyosin receptor kinase B; TNF: Tumor necrosis factor; IL: Interleukin.
Forced swimming experiment

The mice were deprived of food for 16 hours before the experiment. The plexiglass tube was 30 cm high, 18 cm in diameter, and 10 cm in depth, and the water temperature was 23 ± 2 °C. The mice were allowed to swim in the water for 6 minutes, and a stopwatch was used to record the accumulated immobility time within 4 minutes[30].

Open field test

The apparatus and testing procedures were similar to those used in a previously reported study. Briefly, motor activity was quantified in a 50 cm × 50 cm × 50 cm white square cage. The arena floor of the apparatus was divided into 5 cm × 5 cm squares. Each experimental animal was placed in the centre of the cage; the number of crossings (with four paws), the number of rearings (posture sustained with hind paws on the floor), and the immobility time were recorded manually for 5 minutes. All behaviours were recorded with a video camera 100-120 cm above the arena. After each test, the arena was cleaned with a 75% alcohol solution[31,32].

DAI and histological observation

The DAI of each mouse was recorded, and the histomorphology of those mice was evaluated according to the DAI and tissue score criteria. The general condition, body weight change, faecal characteristics and presence of faecal occult were observed daily and recorded. The DAI includes body mass loss (%), faecal characteristics, and the presence of faecal occult blood/gross-blood in the stool. The specific scoring criteria for body mass loss (%) were as follows: 0, 0 points; 1-5, 1 point; 6-10, 2 points; 11-15, 3 points; and > 15, 4 points. The specific scoring criteria for faecal characteristics were as follows: Normal (formed stools), 0 points; loose (mushy, semiformed stools that do not adhere to the anus), 2 points; and dilute stools (watery stools that cling to the anus), 4 points. The specific scoring criteria for faecal occult blood/gross blood in stool were as follows: Normal, 0 points; occult blood positive, 2 points; and gross blood stool, 4 points. DAI = (body mass loss score + faecal characteristics score + faecal occult blood score)/3. Histological evaluation was performed in a double-blind manner. After the mice were subjected to behavioural evaluation, they were euthanized by cervical dislocation to determine the DAI. The colon was rapidly removed, and the length of the colon was measured. The colon was then cut along the mesenteric longitudinal axis, and the lumen was flushed with ice-cold saline to remove faeces. Hyperaemia and ulcers were observed with the naked eye. Approximately 1 cm of colon tissue surrounding the lesions was dissected and fixed in a 10% formalin solution. Routine haematoxylin and eosin (HE) staining was performed to observe the morphological changes in the colonic mucosa, and the colon histopathological score was determined. The colon histopathological score encompasses inflammation, the depth of injury, crypt injury, and the range of inflammation (%). The specific scoring criteria for inflammation were as follows: None, 0 points; mild, 1 point; moderate, 2 points; and severe, 3 points. The specific scoring criteria for depth of injury were as follows: Mucosal layer, 2 points; mucosa and submucosa, 3 points; and full floor, 4 points. The specific scoring criteria for crypt injury were as follows: None, 0 points; destruction of the bottom one-third of the crypt, 1 point; destruction of the bottom two-thirds of the crypt, 2 points; only the surface epithelium was intact, 3 points; and total crypt and epithelial destruction, 4 points. The specific scoring criteria for inflammation range (%) were as follows: 1%-25%, 1 point; 26%-50%, 2 points; 51%-75%, 3 points; and 76%-100%, 4 points. The colon histopathological score = inflammation score + injury depth score + crypt injury score + inflammation range (%) score.

Western blot

Western blotting was performed as described in a previous paper[33]. Briefly, the animals were sacrificed by rapid cervical dislocation following ether overdose. The whole brain of each mouse was collected and rinsed with cold phosphate buffered saline. The cortex and hippocampus were subsequently isolated on a cold plate. The tissue samples were frozen in liquid nitrogen and then stored at -80 °C for protein extraction, followed by incubation with primary antibodies (sheep anti-human proBDNF 1:200, from the laboratory of Professor Xin-Fu Zhou; mouse p75NTR 1:200, cat. 14–9400-82, Invitrogen, United States; rabbit sortilin 1:1000, cat. #ab16640, Abcam, United States; rabbit TrkB 1:1000, cat. #07-225, Millipore, United States; mouse β-actin 1:1000, cat. #CW0097, CoWin Biosciences, China) at 4 °C overnight. After washing with Tris-buffered saline with Tween, the membranes were incubated at room temperature for 1 hour with horseradish peroxidase-conjugated anti-rabbit/mouse/sheep/goat species-specific secondary antibodies (cat. #sc-2020, Santa Cruz, United States; cat. #CW0103, Cwbiotech, China). After washing again in Tris-buffered saline with Tween, enhanced chemiluminescent (ECL) substrate (cat. #cw0049, Cwbiotech, China) was applied to the membrane before imaging using a ChemiDoc™ XRS+ System (Bio-Rad, United States). To quantify the protein level in the brain, β-actin was blotted as a loading control. The blots were analysed using ImageJ software (NIH, United States).

Quantitative real-time polymerase chain reaction

Total RNA was extracted from the entire cortex and hippocampus of the animals with TRIzol® reagent (Sigma) following the manufacturer’s instructions. The RNA samples were dissolved in 30 μL of DEPC-H2O and subsequently stored at -80 °C. The quantity and purity of the RNA were measured using a NanoDrop 2000 Spectrophotometer (Thermo-Fisher Scientific, CA, United States). The quality of the RNA was assessed by the absorbance at 260 and 280 nm, and an A260/A280 ratio ranging from 1.9 to 2.1 was considered acceptable. Total RNA was transcribed with a high-capacity cDNA reverse transcription kit (DRR037A; TaKaRa, Japan) according to the manufacturer’s protocol. The gene expression levels of BDNF, TrkB, p75NTR, and sortilin were measured via quantitative real-time polymerase chain reaction on the ABI 7300 platform (Applied Biosystems, Life Technologies, United States) using FastStart Universal SYBR Green Master Mix (ROX) (Roche). The gene expression level of β-actin was measured as an internal control. The following primers were used: BDNF forward primer: TCATACTTCGGTTGCATGAAGG, reverse primer: ACACCTGGGTAGGCCAAGTT; TrkB forward primer: CCGCTAGGATTTGGTGTACTG, reverse primer: CCGGGTCAACGCTGTTAGG; p75NTR forward primer: CTAGGGGTGTCCTTTGGAGGT, reverse primer: CAGGGTTCACACACGGTCT; sortilin forward primer: CCCGGACTTCATCGCCAAG, reverse primer: AGGACGAGAATAACCCCAGTG; TNF-α forward primer: CAGGCGGTGCCTATGTCTC, reverse primer: CGATCACCCCGAAGTTCAGTAG; IL-6 forward primer: CTGCAAGAGACTTCCATCCAG, reverse primer: AGTGGTATAGACAGGTCTGTTGG; β-actin forward primer: GCAGGAGTACGATGAGTCCG, reverse primer: ACGCAGCTCAGTAACAGTCC.

Statistical analysis

SPSS 25.0 statistical software was used for data analysis, and the measurement data are expressed as the mean ± SD. A one-way ANOVA was used for comparisons of means among multiple groups, the least significant difference test was used for comparisons between groups with homogeneous variance, and Dunnett’s T3 test was used for comparisons of means among groups with uneven variance. P < 0.05 was considered to indicate statistical significance.

RESULTS
Behavioural testing (forced swimming experiment and open field experiment)

In the forced swimming test, the immobility time was significantly greater in the CUMS group than in the control group (P < 0.01). Compared with that of the CUMS group, the immobility time of the Wuling powder group was significantly decreased (P < 0.05), and the immobility time of the FLU group was decreased, but the difference was not statistically significant. Compared with that of the control group, the immobility times of the DSS and CUMS + DSS groups were significantly greater, but there was no significant difference in the immobility time between the DSS group and the CUMS + DSS group. Compared with that of the CUMS group, the immobility time of the CUMS + DSS group was not significantly different. Compared with that of the CUMS + DSS group, the immobility time of the MS group was greater (P < 0.01). Compared with that of the CUMS + DSS group, the immobility times of the MS + MD, MS + LD and MS + FLU groups were lower, but the difference was not statistically significant. Compared with that of the MS group, the immobility time of the MS + LD group was decreased (P < 0.05), and the immobility times of the MS + MD, MS + LD and MS + FLU groups were significantly decreased (P < 0.01, P < 0.01, P < 0.01, respectively) (Figure 2).

Figure 2
Figure 2 Immobility time in the forced swimming experiment after treatment. A: Immobility time in depression groups; B: Immobility time in chronic restraint stress, dextran sodium sulfate and compound model groups. aP < 0.01 vs control group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group; dP < 0.01 vs mesalazine group; fP < 0.05 vs control group; gP < 0.05 vs chronic restraint stress group; iP < 0.05 vs mesalazine group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine.

In the open field experiment, compared with those in the control group, the central zone movement distance and total movement distance in the CUMS group were significantly lower (P < 0.01, P < 0.05, respectively). Compared with that in the CUMS group, the central zone movement distance in the MD and HD groups was greater (although not significantly different), whereas the central zone movement distance in the FLU group was significantly greater (P < 0.01). Compared with that of the CUMS group, the total movement distance of the Wuling powder group was greater, but the total movement distance of the FLU group was greater (P < 0.05). Compared with those in the control group, the central area movement distances in the DSS group and the CUMS + DSS group were significantly reduced (P < 0.01, P < 0.01, respectively), and the total movement distances in the DSS group and CUMS + DSS group were decreased (P < 0.05, P < 0.05, respectively). There was no significant difference in the central area movement distance or the total movement distance between the DSS group and the CUMS + DSS group. Compared with that of the CUMS group, the central area movement distance of the CUMS + DSS group was shorter (but not significantly different). There was no significant difference in the total movement distance between the CUMS group and the CUMS + DSS group. Compared with those of the CUMS + DSS group, the central zone movement distance and total movement distance of the MS, MS + LD and MS + MD groups were not significantly different. Compared with that of the CUMS + DSS group, the MS + HD group exhibited an increased central zone movement distance (P < 0.05), and the MS + FLU group exhibited a significantly increased central zone movement distance (P < 0.01). Compared with that of the CUMS + DSS group, the total travel distances of the MS + HD and MS + FLU groups were greater, but the difference was not statistically significant. Compared with that of the MS group, the MS + HD group had a significantly greater central zone movement distance (P < 0.05), and the MS + FLU group had a significantly greater central zone movement distance (P < 0.01). Compared with that of the MS group, the total travel distances of the MS + LD, MS + MD, MS + HD and MD + FLU groups were not significantly increased (Figure 3).

Figure 3
Figure 3 Central area movement distance and total movement distance of open-field test mice after treatment. A: Moving distance of central area in depression groups; B: Moving distance of central area in chronic restraint stress, dextran sodium sulfate and compound model groups; C: Total moving distance in depression groups; D: Total moving distance in chronic restraint stress, dextran sodium sulfate and compound model groups. aP < 0.01 vs control group; bP < 0.01 vs chronic restraint stress group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group; dP < 0.01 vs mesalazine group; fP < 0.05 vs control group; gP < 0.05 vs chronic restraint stress group; hP < 0.05 vs chronic restraint stress + dextran sodium sulfate group; iP < 0.05 vs mesalazine group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine.
DAI

Compared with that of the control group, the DAI of the CUMS group was slightly greater, but the difference was not statistically significant. Compared with that of the CUMS group, the DAI scores of the Wuling powder group and the FLU group were lower, but the differences were not statistically significant. Compared with that of the control group, the DAI scores of the DSS group and the CUMS + DSS group were significantly greater (P < 0.01, P < 0.01, respectively), but there was no difference in DAI scores between the DSS group and the CUMS + DSS group. The DAI score of the CUMS + DSS group was greater than that of the CUMS group (P < 0.01). Compared with that of the CUMS + DSS group, the DAI score of the MS + LD group was significantly lower (P < 0.05), and the DAI scores of the MS, MS + MD, MS + HD and MS + FLU groups were significantly lower (P < 0.01). Compared with that in the MS group, the DAI scores in the MS + HD and MS + FLU groups were lower, but the difference was not significant (Figure 4).

Figure 4
Figure 4 Disease activity index score after treatment. A: Disease activity index score in depression groups; B: Disease activity index score in chronic restraint stress, dextran sodium sulfate and compound model groups. aP < 0.01 vs control group; bP < 0.01 vs chronic restraint stress group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group; hP < 0.05 vs chronic restraint stress + dextran sodium sulfate group. DAI: Disease activity index; CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine.
Colonic length comparison

There was no significant change in colon length in the CUMS group compared with that in the control group. There was no significant difference in colon length between the CUMS group and the Wuling powder group or the FLU group. Compared with that of the control group, the colon lengths of the DSS group and the CUMS + DSS group were significantly shorter (P < 0.01, P < 0.01, respectively). Compared with that of the CUMS group, the colon length of the CUMS + DSS group was decreased (P < 0.01). Compared with that of the CUMS + DSS group, the colon lengths of the MS, MS + HD and MS + FLU groups were greater (P < 0.05). Compared with that of the MS group, the colon lengths in the MS + LD, MS + MD, MS + HD and MS + FLU groups were not increased (Figure 5).

Figure 5
Figure 5 Length of the colon after treatment. A: Length of the colon in depression groups; B: Length of the colon in chronic restraint stress, dextran sodium sulfate and compound model groups. aP < 0.01 vs control group; bP < 0.01 vs chronic restraint stress group; hP < 0.05 vs chronic restraint stress + dextran sodium sulfate group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine.
HE histological observation

According to HE histological observations, compared with that of the control group, the colonic histopathological scores in the DSS group and CUMS + DSS group were significantly greater (P < 0.01), and local crypt changes were observed via HE staining. Compared with that of the CUMS + DSS group, the colonic histopathological scores of all the treatment groups were significantly lower (P < 0.01). The histopathological score of the colon decreased with increasing dosages of Wuling powder, but the differences were not significant (Figure 6).

Figure 6
Figure 6 Histopathological examination by hematoxylin-eosin staining (100 ×) and colon histopathological scores. A: Hematoxylin-eosin staining images; B: Colon histopathological scores of each group. aP < 0.01 vs control group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine.
Expression of TNF-α mRNA and IL-6 mRNA in colon tissue

In colon tissue, TNF-α and IL-6 mRNA levels were significantly greater in the CUMS group than in the control group (P < 0.01). Compared with those in the CUMS group, the TNF-α mRNA levels in mice in the MD, HD, and FLU groups were significantly lower (P < 0.01), and the mRNA levels of IL-6 in the HD and FLU groups were significantly lower (P < 0.05, P < 0.01, respectively). Compared with that in the control group, the TNF-α mRNA levels in the DSS group and the CUMS + DSS group were significantly greater (P < 0.01), but there was no difference between the DSS group and the CUMS + DSS group. Compared with that in the control group, the mRNA levels of IL-6 in the DSS group and CUMS + DSS group were significantly greater (P < 0.05, P < 0.01, respectively). Compared with those in the CUMS group, the mRNA level of IL-6 in the CUMS + DSS group was greater (P < 0.05), and the TNF-α mRNA level in the CUMS + DSS group was greater. Compared with that in the DSS group, the mRNA level of IL-6 in the CUMS + DSS group was greater (P < 0.05). Compared with those in the CUMS + DSS group, the mRNA levels of TNF-α and IL-6 in the MS, MS + MD, MS + HD and MS + FLU groups were significantly lower (P < 0.01), and the mRNA levels of TNF-α and IL-6 in the MS + LD group were lower (P < 0.05). Compared with those in the MS group, TNF-α and IL-6 mRNA levels were lower in the MS + MD, MS + HD, and MS + FLU groups, but the differences were not significant (Figure 7).

Figure 7
Figure 7 Expression of tumor necrosis factor-alpha and interleukin-6 mRNA in colonic tissue after treatment. A: Expression of tumor necrosis factor-alpha mRNA in depression groups; B: Expression of tumor necrosis factor-alpha mRNA in chronic restraint stress, dextran sodium sulfate and compound model groups; C: Expression of interleukin-6 mRNA in depression groups; D: Expression of interleukin-6 mRNA in chronic restraint stress, dextran sodium sulfate and compound model groups. aP < 0.01 vs control group; bP < 0.01 vs chronic restraint stress group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group; fP < 0.05 vs control group; gP < 0.05 vs chronic restraint stress group; hP < 0.05 vs chronic restraint stress + dextran sodium sulfate group; jP < 0.05 vs dextran sodium sulfate group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine; TNF: Tumor necrosis factor; IL: Interleukin.
Expression of BDNF and TrkB mRNA in the hippocampus

Compared with those in the control group, the hippocampal BDNF and TrkB mRNA levels were significantly lower in the CUMS group (P < 0.01). Compared with that in the CUMS group, the expression level of BDNF mRNA in the HD and FLU groups was significantly greater (P < 0.01). Compared with that in the CUMS group, the expression level of TrkB mRNA in the LD and HD groups was greater, but the difference was not significant, and the TrkB mRNA expression level was significantly greater in the FLU group (P < 0.01). Compared with those in the control group, the mRNA expression levels of BDNF and TrkB in the DSS group and CUMS + DSS group were significantly lower (P < 0.01). The expression levels of BDNF mRNA and TrkB mRNA in the CUMS + DSS group were not significantly different from those in the CUMS group but were significantly different from those in the DSS group. Compared with that in the CUMS + DSS group, the expression levels of BDNF mRNA in the MS + LD and MS + MD groups were increased, but the difference was not significant, and the mRNA expression levels of BDNF in the MS, MS + HD, and MS + FLU groups were significantly greater (P < 0.01). Compared with that in the CUMS + DSS group, the expression levels of TrKB mRNA in the MS + LD, MS + MD, and MS + HD groups were greater, but the difference was not statistically significant, and the expression levels of TrKB mRNA in the MS and MS + FLU groups were significantly greater (P = 0.05, P < 0.01, respectively) (Figure 8).

Figure 8
Figure 8 Expression of brain-derived neurotrophic factor and tropomyosin receptor kinase B mRNA in the hippocampus. A: Expression of brain-derived neurotrophic factor mRNA in depression groups; B: Expression of brain-derived neurotrophic factor mRNA in chronic restraint stress, dextran sodium sulfate and compound model groups; C: Expression of tropomyosin receptor kinase B mRNA in depression groups; D: Expression of tropomyosin receptor kinase B mRNA in chronic restraint stress, dextran sodium sulfate and compound model groups. aP < 0.01 vs control group; bP < 0.01 vs chronic restraint stress group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine; BDNF: Brain-derived neurotrophic factor; TrkB: Tropomyosin receptor kinase B.
Expression of p75NTR and sortilin mRNA in the hippocampus

Compared with those in the control group, the p75NTR and sortilin mRNA levels were significantly increased in the CUMS group (P < 0.01). Compared with that in the CUMS group, the expression level of p75NTR mRNA in the LD group was lower, but the difference was not significant. The mRNA expression level of p75NTR was significantly decreased in the MD, HD, and FLU groups (P < 0.05, P < 0.05, P < 0.01, respectively). Compared with that in the CUMS group, the expression levels of sortilin mRNA in the LD and MD groups were lower, but the difference was not significant. The expression levels of sortilin mRNA in the HD and FLU groups were significantly decreased (P < 0.01). Compared with those in the control group, the p75NTR and sortilin mRNA levels in the CUMS, DSS, and CUMS + DSS groups were significantly greater (P < 0.01). There was no significant difference in the level of sortilin mRNA among the CUMS, DSS, and CUMS + DSS groups. Compared with those in the CUMS group, the p75NTR mRNA level was significantly increased in the CUMS + DSS group (P < 0.01), whereas the sortilin mRNA level was not significantly different. Compared with that in the DSS group, the expression level of p75NTR mRNA in the CUMS + DSS group was significantly greater (P < 0.01). Compared with those in the CUMS + DSS group, the mRNA expression levels of p75NTR in the MS, MS + LD, MS + MD, MS + HD, and MS + FLU groups were significantly lower (P < 0.01), and the expression levels of sortilin mRNA in the MS, MS + MD, MS + HD, and MS + FLU groups were significantly lower (P < 0.01, P < 0.05, P < 0.01, P < 0.01, respectively). Compared with those in the MS group, the p75NTR and sortilin mRNA levels in the MS + HD and MS + FLU groups were lower, but the differences were not significant (Figure 9).

Figure 9
Figure 9 Expression of p75 neurotrophin receptor and sortilin mRNA in the hippocampus. A: Expression of p75 neurotrophin receptor mRNA in depression groups; B: Expression of p75 neurotrophin receptor mRNA in chronic restraint stress, dextran sodium sulfate and compound model groups; C: Expression of sortilin mRNA in depression groups; D: Expression of sortilin mRNA in chronic restraint stress, dextran sodium sulfate and compound model groups. aP < 0.01 vs control group; bP < 0.01 vs chronic restraint stress group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group; eP< 0.01 vs dextran sodium sulfate group; gP < 0.05 vs chronic restraint stress group; hP< 0.05 vs chronic restraint stress + dextran sodium sulfate group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine; p75NTR: P75 neurotrophin receptor.
Expression of proBDNF, BDNF, TrkB, p75NTR, and sortilin proteins in the hippocampus

Compared with those in the control group, the protein expression levels of BDNF and TrkB in the CUMS group were significantly lower (P < 0.01). Compared with those in the CUMS group, the protein expression levels of BDNF and TrkB were increased in the LD, MD, and FLU groups, but the differences were not significant. Compared with those in the CUMS group, the protein expression levels of BDNF and TrkB in the HD group were significantly greater (P < 0.01, P < 0.05, respectively). Compared with those in the control group, the protein expression levels of BDNF and TrkB in the DSS and CUMS + DSS groups were significantly lower (P < 0.01). Compared with those in the CUMS group, the BDNF and TrkB protein levels were lower in the CUMS + DSS group, but the differences were not significant. Compared with those in the CUMS + DSS group, the BDNF protein level in the MS + LD group was greater (P < 0.05), but the difference in the protein expression level of TrkB was not significant. The BDNF protein expression level was significantly greater in the MS, MS + MD, MS + HD, and MS + FLU groups than that in the CUMS + DSS group (P < 0.01). The protein expression levels of TrKB in the MS, MS + HD and MS + FLU groups were significantly increased (P < 0.01, P < 0.05, P < 0.01, respectively) (Figure 10).

Figure 10
Figure 10  Expression of brain-derived neurotrophic factor and tropomyosin receptor kinase B proteins in the hippocampus. A: Expression of brain-derived neurotrophic factor (BDNF) protein in depression groups; B: Expression of tropomyosin receptor kinase B (TrkB) protein in depression groups; C: Density analysis of BDNF and TrkB protein expressions in depression groups; D: Expression of BDNF protein in chronic restraint stress (CUMS), dextran sodium sulfate (DSS) and compound model groups; E: Expression of TrkB protein in CUMS, DSS and compound model groups; F: Density analysis of BDNF and TrkB protein expressions in CUMS, DSS and compound model groups. aP < 0.01 vs control group; bP < 0.01 vs chronic restraint stress group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group; gP < 0.05 vs chronic restraint stress group; hP < 0.05 vs chronic restraint stress + dextran sodium sulfate group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine; BDNF: Brain-derived neurotrophic factor; TrkB: Tropomyosin receptor kinase B.

Compared with those in the control group, the protein expression levels of proBDNF in the CUMS group were significantly greater (P < 0.05), and the protein expression levels of p75NTR and sortilin were significantly greater (P < 0.01). Compared with that in the CUMS group, the protein expression levels of proBDNF in the LD and MD groups were lower, but the difference was not significant, and the protein expression levels of proBDNF in the HD and FLU groups were significantly lower (P < 0.05, P < 0.01, respectively). Compared with those in the CUMS group, the protein expression level of p75NTR in the LD group was significantly lower (P < 0.05), but the protein expression level of sortilin was not significantly different. The protein expression levels of p75NTR and sortilin in the MD, HD, and FLU groups were significantly decreased (P < 0.01). Compared with that in the control group, the protein expression level of proBDNF in the DSS group was increased, but the difference was not significant. The protein expression level of proBDNF in the CUMS + DSS group was significantly increased (P < 0.05). Compared with those in the control group, the protein expression levels of p75NTR and sortilin in the DSS group and CUMS + DSS group were significantly greater (P < 0.01). Compared with those in the CUMS group, the protein expression levels of proBDNF, p75NTR, and sortilin in the CUMS + DSS group were not significantly different. Compared with that in the CUMS + DSS group, there was no significant change in proBDNF protein in the MS and MS + LD groups. Compared with that in the CUMS + DSS group, the protein expression levels of proBDNF in the MS + MD, MS + HD and MS + FLU groups were significantly lower (P < 0.05, P < 0.01, P < 0.01, respectively). Compared with that in the CUMS + DSS group, the protein expression levels of p75NTR in the MS, MS + LD, MS + MD, MS + HD and MS + FLU groups were significantly lower (P < 0.01). Compared with that in the MS group, the protein expression levels of p75NTR in the MS + HD and MS + FLU groups were significantly lower (P < 0.05, P < 0.01, respectively). Compared with that in the CUMS + DSS group, the protein expression levels of sortilin in the MS, MS + MD, MS + HD, and MS + FLU groups were significantly lower (P < 0.01, P < 0.05, P < 0.01, P < 0.01, respectively) (Figure 11).

Figure 11
Figure 11  Expression of the brain-derived neurotrophic factor precursor, p75 neurotrophin receptor and sortilin proteins in the hippocampus. A: Expression of brain-derived neurotrophic factor precursor (proBDNF) protein in depression groups; B: Expression of p75 neurotrophin receptor (p75NTR) protein in depression groups; C: Expression of sortilin protein in depression groups; D: Density analysis of proBDNF, p75NTR, and sortilin protein expressions in depression groups; E: Expression of proBDNF protein in chronic restraint stress (CUMS), dextran sodium sulfate (DSS) and compound model groups; F: Expression of p75NTR protein in CUMS, DSS, and compound model groups; G: Expression of sortilin protein in CUMS, DSS, and compound model groups; H: Density analysis of proBDNF, p75NTR, and sortilin protein expressions. aP < 0.01 vs control group; bP < 0.01 vs chronic restraint stress group; cP < 0.01 vs chronic restraint stress + dextran sodium sulfate group; dP < 0.01 vs mesalazine group; fP < 0.05 vs control group; gP < 0.05 vs chronic restraint stress group; hP < 0.05 vs chronic restraint stress + dextran sodium sulfate group; iP < 0.05 vs mesalazine group. CUMS: Chronic restraint stress; DSS: Dextran sodium sulfate; LD: Low-dose Wuling powder; MD: Medium-dose Wuling powder; HD: High-dose Wuling powder; FLU: Fluoxetine; MS: Mesalazine; proBDNF: Brain-derived neurotrophic factor precursor; p75NTR: P75 neurotrophin receptor.
DISCUSSION

In this study, we successfully established a model of chronic stress-induced depression in mice, which manifested as prolonged immobility in a forced swimming experiment and reduced central and total movement distances in an open field experiment. The changes in the expression levels of all biomarkers in the hippocampal region were reversed by Wuling powder and FLU, which was consistent with the observed changes in protein levels, and the effects were more significant at medium and high doses of Wuling powder. Our study suggested that Wuling powder may exert its antidepressant effects by correcting abnormal proBDNF/BDNF signalling. In addition, this study revealed that in the context of a chronic stress-induced depression model, DSS can be used to successfully induce UC combined with depression. Furthermore, this study revealed that Wuling powder in combination with MS can have an antidepressant effect and subsequently help reduce intestinal inflammation. These observations also suggest that intervention in the balance of the proBDNF/p75NTR/sortilin and BDNF/TrkB signalling pathways may be a treatment for UC with depression.

Chronic stress leads to an imbalance in proBDNF/p75NTR/sortilin and BDNF/TrkB signalling, and this imbalance is aggravated by UC

In our study, we confirmed that after mild chronic stress was induced, mice in the CUMS group exhibited significantly increased immobility time, significantly decreased central zone movement distance and total movement distance, significantly increased p75NTR and sortilin mRNA expression levels and significantly decreased BDNF and TrKB mRNA expression levels in the hippocampus. P75NTR and sortilin protein levels were increased, but BDNF and TrkB protein levels were decreased. These results suggest that chronic stress not only causes a depression phenotype but can also lead to abnormal proBDNF signalling, which is consistent with the findings of previous studies. A recent study revealed that in chronic mild stress mice, proBDNF protein levels increase in the cortex and hippocampus, and this increase not only aggravates depression but also produces the opposite effect induced by chronic mild stress[20]. ProBDNF preferentially binds to the p75NTR. After binding, proBDNF and p75NTR induce long-term inhibition and trigger intracellular signalling cascades, leading to a reduction in axonal degradation and dendritic complexity[34,35]. Mature BDNF shows greater affinity for the TrkB receptor. After the TrkB receptor is activated, mature BDNF plays neurotrophic and antiapoptotic roles contributing to neuronal survival, axonal growth, dendritic differentiation and long-term growth. Chronic stress inhibits the BDNF-TrkB signalling pathway, increases hippocampal astrocyte apoptosis, increases neuronal activity, reduces vertebral neuronal plasticity, and mediates depression[12,20,36,37]. These results indicate that under CUMS conditions, the proBDNF/BDNF balance is disrupted or that chronic stress leads to an imbalance in proBDNF/p75NTR/sortilin and BDNF/TrkB signalling.

Compared with those of the control group, the immobility times of the DSS group and CUMS + DSS group were significantly greater, the movement distances in the central region were significantly shorter, and the total movement distances were significantly shorter. The expression levels of BDNF and TrkB were significantly decreased, whereas the expression levels of p75NTR and sortilin were significantly increased. The protein expression level of proBDNF in the DSS group was increased, but there was no significant change. The protein expression level of proBDNF in the CUMS + DSS group was significantly increased, indicating that mice with colitis also exhibited depression, that the signalling activity of the proBDNF/p75NTR/sortilin pathway was increased, and that the signalling activity of the BDNF/TrkB pathway was decreased. Studies have shown that in patients with UC, the most common mental disorders are anxiety and depression; intestinal inflammation can have a negative effect on patients, and psychological factors can increase intestinal inflammation, leading to disease recurrence[10,11]. The brain-gut axis is a bidirectional regulatory pathway involving the intestinal microenvironment and its interactions with the central nervous system[38,39]. However, compared with chronically stressed mice, CUMS + DSS model mice showed no significant difference in movement distance, total movement distance, immobility time, or time in the centre; no significant difference in the expression levels of BDNF or TrkB mRNA; no significant increase in p75NTR mRNA levels; and no significant difference in sortilin mRNA levels. The protein level of TrkB was decreased, but the difference was not significant, and the protein expression levels of proBDNF, p75NTR, and sortilin were not significantly different. However, BDNF/TrkB tended to decrease, and proBDNF/p75NTR/sortilin tended to increase. A possible explanation for this result is that the molecular changes in UC combined with depression in mice are not reflected in their behavioural performance. These findings combined with the above results suggest that colitis mice often have comorbid depression, which causes both colitis-related symptoms and an imbalance in proBDNF/p75NTR/sortilin and BDNF/TrkB signalling, leading to depression in these mice.

The imbalance in proBDNF/p75NTR/sortilin and BDNF/TrkB signalling can be restored by Wuling powder

In chronically stressed mice, Wuling powder and FLU were used, both of which were effective. FLU, one of the most commonly used selective serotonin reuptake inhibitor antidepressants, is considered effective for patients with depression[40,41]. Wuling powder is also effective in the treatment of depression[28,42]. Adjunctive Wuling powder may augment the effects of antidepressants and may be associated with fewer adverse drug reactions[42], but its mechanism of action is not clear. Treatment with Wuling capsule can alleviate chronic social defeat stress-induced depressive and anxiety-like behaviour, hyperactivity of the hypothalamic-pituitary-adrenal axis, and activation of the Nesfatin-1/nuclear factor-kappaB pathway in the hypothalamus[43]. Wuling powder prevents depression-like behaviour in learned helplessness model mice by improving mitochondrial autophagy mediated by translocator protein[44]. We found that Wuling powder and FLU alleviated symptoms of chronic stress-induced depression, as indicated by lower immobility times in the forced swimming test and increased distance travelled in the centre zone and total movement distance in the field test, and that Wuling powder alleviated symptoms of depression in mice. In this study, we also found that treatment with Wuling powder and FLU restored the imbalance in proBDNF/p75NTR/sortilin and BDNF/TrkB signalling, and we demonstrated that treatment with Wuling powder or FLU altered proBDNF/BDNF levels in the hippocampus. Treatment with Wuling powder significantly downregulated the protein expression of proBDNF and upregulated the mRNA expression of BDNF in the hippocampus. As the precursor form of BDNF, proBDNF plays the opposite role to BDNF in regulating neuronal activity[12,20,45]. Treatment with Wuling powder reversed the changes in BDNF mRNA and proBDNF protein expression in the hippocampus. The increase in proBDNF expression levels may be related to the pathophysiology of depression, and the decrease in proBDNF expression levels may be related to the mechanism of action of antidepressant drugs. Central or peripheral infusion of BDNF has been shown to produce antidepressant effects in animal models[20,24]. In CUMS rats, intraventricular or intraperitoneal injection of an anti-proBDNF antibody was shown to significantly attenuate depressive behaviour[20]. We observed that treatment with Wuling powder reversed CUMS-induced changes in the mRNA and protein levels of p75NTR and TrkB in the hippocampus. These findings suggest that Wuling powder may exert its antidepressant effects by restoring the imbalance in proBDNF/p75NTR/sortilin and BDNF/TrkB signalling.

Wuling powder can alleviate symptoms of depression, which in turn reduces intestinal inflammation

Psychological factors interact with intestinal factors and are closely related to the occurrence and development of UC[46,47]. There is a two-way relationship between psychological factors and UC. Intestinal inflammation can have a negative impact on patient mental health, and psychological factors can aggravate intestinal inflammation, leading to disease recurrence[9,48,49]. The chronic recurrence of UC clinical symptoms and the adverse effects of long-term treatment cause patients to fear the disease, physical discomfort and pain. Most patients are also faced with societal and psychological pressures and economic burdens, which often lead to the emergence or aggravation of various adverse emotions. Studies have shown that compared with healthy people, UC patients are more likely to suffer from various adverse emotions and psychological problems, including anxiety, depression, pessimism and sensitivity, among which anxiety and depression are the most prominent[50,51]. In addition, depression may influence disease progression and recurrence in patients with inflammatory bowel disease. Studies have shown that, through the brain-gut axis, psychological factors can increase intestinal permeability, change the intestinal flora, exacerbate the immune response, etc., thus aggravating the condition of UC patients[38,52,53]. These findings suggest that psychotherapy or antidepressants should be considered in the clinical treatment of UC. Our study revealed that in the compound model group, MS alone and in combination with Wuling powder reduced the immobility time, increased the distance travelled in the central zone, reduced the expression levels of p75NTR mRNA and sortilin mRNA, and alleviated symptoms of depression. In addition, MS led to a decrease in the colonic DAI score, an increase in the colonic length, and decreases in the colonic TNF-α and IL-6 mRNA expression levels. Although there was no significant difference in this study, the combination of Wuling powder and MS further decreased the colon histopathological score and alleviated intestinal inflammation. These results suggest that in mice with UC and depression, conventional MS treatment with middle to high-dose Wuling powder and FLU can alleviate intestinal inflammation, possibly by restoring the imbalance between proBDNF/p75NTR/sortilin and BDNF/TrkB signalling and exerting antidepressant-like effects.

CONCLUSION

ProBDNF/p75NTR/sortilin and BDNF/TrkB signalling balance was disrupted in mice with chronic stress-induced depression. Our data suggest that Wuling powder may exert its therapeutic effects by reversing aberrant proBDNF/BDNF signalling. In addition, mice with UC often have comorbid depression. Wuling powder in combination with MS can have an antidepressant effect and alleviate intestinal inflammation. Altering the proBDNF/p75NTR/sortilin and BDNF/TrkB signalling balance may be a new therapeutic target for clinical treatment.

ACKNOWLEDGEMENTS

We would like to thank our colleagues at the Institute of Digestive Disease Affiliated with the First Clinical Medical College of Zhejiang Chinese Medical University for their help and support in this research.

References
1.  Araki M, Shinzaki S, Yamada T, Arimitsu S, Komori M, Shibukawa N, Mukai A, Nakajima S, Kinoshita K, Kitamura S, Murayama Y, Ogawa H, Yasunaga Y, Oshita M, Fukui H, Masuda E, Tsujii M, Kawai S, Hiyama S, Inoue T, Tanimukai H, Iijima H, Takehara T. Psychologic stress and disease activity in patients with inflammatory bowel disease: A multicenter cross-sectional study. PLoS One. 2020;15:e0233365.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 54]  [Cited by in RCA: 45]  [Article Influence: 7.5]  [Reference Citation Analysis (0)]
2.  Mikocka-Walus A, Hanlon I, Dober M, Emerson C, Beswick L, Selinger C, Taylor J, Olive L, Evans S, Hewitt C. Lived experience in people with inflammatory bowel disease and comorbid anxiety and depression in the United Kingdom and Australia. J Health Psychol. 2021;26:2290-2303.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 18]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
3.  Dulai PS, Singh S, Jairath V, Ma C, Narula N, Vande Casteele N, Peyrin-Biroulet L, Vermeire S, D'Haens G, Feagan BG, Sandborn WJ. Prevalence of endoscopic improvement and remission according to patient-reported outcomes in ulcerative colitis. Aliment Pharmacol Ther. 2020;51:435-445.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 31]  [Cited by in RCA: 31]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
4.  Luo J, Xu Z, Noordam R, van Heemst D, Li-Gao R. Depression and Inflammatory Bowel Disease: A Bidirectional Two-sample Mendelian Randomization Study. J Crohns Colitis. 2022;16:633-642.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 133]  [Cited by in RCA: 111]  [Article Influence: 27.8]  [Reference Citation Analysis (1)]
5.  Navabi S, Gorrepati VS, Yadav S, Chintanaboina J, Maher S, Demuth P, Stern B, Stuart A, Tinsley A, Clarke K, Williams ED, Coates MD. Influences and Impact of Anxiety and Depression in the Setting of Inflammatory Bowel Disease. Inflamm Bowel Dis. 2018;24:2303-2308.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 121]  [Cited by in RCA: 108]  [Article Influence: 13.5]  [Reference Citation Analysis (0)]
6.  Wang H, Labus JS, Griffin F, Gupta A, Bhatt RR, Sauk JS, Turkiewicz J, Bernstein CN, Kornelsen J, Mayer EA. Functional brain rewiring and altered cortical stability in ulcerative colitis. Mol Psychiatry. 2022;27:1792-1804.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 30]  [Article Influence: 7.5]  [Reference Citation Analysis (0)]
7.  Lee JW. Anxiety and Depression in Patients with Inflammatory Bowel Diseases: The First Step toward Proper Management. Gut Liver. 2020;14:395-396.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 2]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
8.  Adams SM, Bornemann PH. Ulcerative colitis. Am Fam Physician. 2013;87:699-705.  [PubMed]  [DOI]
9.  Neuendorf R, Harding A, Stello N, Hanes D, Wahbeh H. Depression and anxiety in patients with Inflammatory Bowel Disease: A systematic review. J Psychosom Res. 2016;87:70-80.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 486]  [Cited by in RCA: 424]  [Article Influence: 42.4]  [Reference Citation Analysis (1)]
10.  Luo H, Sun Y, Li Y, Lv H, Sheng L, Wang L, Qian J. Perceived stress and inappropriate coping behaviors associated with poorer quality of life and prognosis in patients with ulcerative colitis. J Psychosom Res. 2018;113:66-71.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 21]  [Cited by in RCA: 18]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
11.  Bisgaard TH, Allin KH, Keefer L, Ananthakrishnan AN, Jess T. Depression and anxiety in inflammatory bowel disease: epidemiology, mechanisms and treatment. Nat Rev Gastroenterol Hepatol. 2022;19:717-726.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 477]  [Cited by in RCA: 383]  [Article Influence: 95.8]  [Reference Citation Analysis (2)]
12.  Zhang JC, Yao W, Hashimoto K. Brain-derived Neurotrophic Factor (BDNF)-TrkB Signaling in Inflammation-related Depression and Potential Therapeutic Targets. Curr Neuropharmacol. 2016;14:721-731.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 479]  [Cited by in RCA: 433]  [Article Influence: 43.3]  [Reference Citation Analysis (0)]
13.  Hashimoto K. Sigma-1 receptor chaperone and brain-derived neurotrophic factor: emerging links between cardiovascular disease and depression. Prog Neurobiol. 2013;100:15-29.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 180]  [Cited by in RCA: 168]  [Article Influence: 12.9]  [Reference Citation Analysis (0)]
14.  Duman RS, Heninger GR, Nestler EJ. A molecular and cellular theory of depression. Arch Gen Psychiatry. 1997;54:597-606.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1688]  [Cited by in RCA: 1440]  [Article Influence: 49.7]  [Reference Citation Analysis (1)]
15.  Hashimoto K. Brain-derived neurotrophic factor-TrkB signaling and the mechanism of antidepressant activity by ketamine in mood disorders. Eur Arch Psychiatry Clin Neurosci. 2020;270:137-138.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 8]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
16.  Malcangio M, Lessmann V. A common thread for pain and memory synapses? Brain-derived neurotrophic factor and trkB receptors. Trends Pharmacol Sci. 2003;24:116-121.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 129]  [Cited by in RCA: 115]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
17.  Barker PA. Whither proBDNF? Nat Neurosci. 2009;12:105-106.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 98]  [Cited by in RCA: 86]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
18.  Leal G, Bramham CR, Duarte CB. BDNF and Hippocampal Synaptic Plasticity. Vitam Horm. 2017;104:153-195.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 360]  [Cited by in RCA: 312]  [Article Influence: 31.2]  [Reference Citation Analysis (0)]
19.  Gelle T, Samey RA, Plansont B, Bessette B, Jauberteau-Marchan MO, Lalloué F, Girard M. BDNF and pro-BDNF in serum and exosomes in major depression: Evolution after antidepressant treatment. Prog Neuropsychopharmacol Biol Psychiatry. 2021;109:110229.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 99]  [Cited by in RCA: 86]  [Article Influence: 17.2]  [Reference Citation Analysis (0)]
20.  Bai YY, Ruan CS, Yang CR, Li JY, Kang ZL, Zhou L, Liu D, Zeng YQ, Wang TH, Tian CF, Liao H, Bobrovskaya L, Zhou XF. ProBDNF Signaling Regulates Depression-Like Behaviors in Rodents under Chronic Stress. Neuropsychopharmacology. 2016;41:2882-2892.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 108]  [Cited by in RCA: 99]  [Article Influence: 9.9]  [Reference Citation Analysis (0)]
21.  Deinhardt K, Chao MV. Shaping neurons: Long and short range effects of mature and proBDNF signalling upon neuronal structure. Neuropharmacology. 2014;76 Pt C:603-609.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 105]  [Cited by in RCA: 97]  [Article Influence: 8.1]  [Reference Citation Analysis (1)]
22.  Wang YX, Kang XN, Cao Y, Zheng DX, Lu YM, Pang CF, Wang Z, Cheng B, Peng Y. Porphyromonas gingivalis induces depression via downregulating p75NTR-mediated BDNF maturation in astrocytes. Brain Behav Immun. 2019;81:523-534.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 41]  [Cited by in RCA: 38]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
23.  Jiang H, Chen S, Li C, Lu N, Yue Y, Yin Y, Zhang Y, Zhi X, Zhang D, Yuan Y. The serum protein levels of the tPA-BDNF pathway are implicated in depression and antidepressant treatment. Transl Psychiatry. 2017;7:e1079.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 134]  [Cited by in RCA: 124]  [Article Influence: 13.8]  [Reference Citation Analysis (1)]
24.  Luo L, Li C, Du X, Shi Q, Huang Q, Xu X, Wang Q. Effect of aerobic exercise on BDNF/proBDNF expression in the ischemic hippocampus and depression recovery of rats after stroke. Behav Brain Res. 2019;362:323-331.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 41]  [Cited by in RCA: 85]  [Article Influence: 12.1]  [Reference Citation Analysis (0)]
25.  Hatamnejad MR, Baradaran Ghavami S, Shirvani M, Asghari Ahmadabad M, Shahrokh S, Farmani M, Sherkat G, Asadzadeh Aghdaei H, Zali MR. Selective serotonin reuptake inhibitors and inflammatory bowel disease; Beneficial or malpractice. Front Immunol. 2022;13:980189.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 24]  [Cited by in RCA: 23]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
26.  Wu XW, Hou Y, Ji HZ, Liang MM, Xu LE, Wang FY. [Treating irritable bowel syndrome by wuling capsule combined pinaverium bromide: a clinical research]. Zhongguo Zhong Xi Yi Jie He Za Zhi. 2015;35:415-418.  [PubMed]  [DOI]
27.  Lin Y, Wang XY, Ye R, Hu WH, Sun SC, Jiao HJ, Song XH, Yuan ZZ, Zheng YY, Zheng GQ, He JC. Efficacy and safety of Wuling capsule, a single herbal formula, in Chinese subjects with insomnia: a multicenter, randomized, double-blind, placebo-controlled trial. J Ethnopharmacol. 2013;145:320-327.  [PubMed]  [DOI]  [Full Text]
28.  Chen X, Tian C, Meng Z, Ran C. The therapeutic effect of Wuling capsule on tinnitus patients with anxiety and depression. Asian J Surg. 2022;45:939-940.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 4]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
29.  Tian Z, Liu J, Liao M, Li W, Zou J, Han X, Kuang M, Shen W, Li H. Beneficial Effects of Fecal Microbiota Transplantation on Ulcerative Colitis in Mice. Dig Dis Sci. 2016;61:2262-2271.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 73]  [Cited by in RCA: 68]  [Article Influence: 6.8]  [Reference Citation Analysis (0)]
30.  Bogdanova OV, Kanekar S, D'Anci KE, Renshaw PF. Factors influencing behavior in the forced swim test. Physiol Behav. 2013;118:227-239.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 395]  [Cited by in RCA: 345]  [Article Influence: 26.5]  [Reference Citation Analysis (0)]
31.  Yan Y, Wang YL, Su Z, Zhang Y, Guo SX, Liu AJ, Wang CH, Sun FJ, Yang J. Effect of oxytocin on the behavioral activity in the behavioral despair depression rat model. Neuropeptides. 2014;48:83-89.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 27]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
32.  Hu H, Zhang Y, Xu Y, Liu C, Wang L. [Open-field behavioral study in rat hyperlipidemia combined with chronic unpredictable mild stress model]. Zhonghua Yi Xue Za Zhi. 2015;95:1854-1858.  [PubMed]  [DOI]
33.  Fan YJ, Wu LL, Li HY, Wang YJ, Zhou XF. Differential effects of pro-BDNF on sensory neurons after sciatic nerve transection in neonatal rats. Eur J Neurosci. 2008;27:2380-2390.  [PubMed]  [DOI]  [Full Text]
34.  Tayyab M, Shahi MH, Farheen S, Mariyath MPM, Khanam N, Castresana JS, Hossain MM. Sonic hedgehog, Wnt, and brain-derived neurotrophic factor cell signaling pathway crosstalk: potential therapy for depression. J Neurosci Res. 2018;96:53-62.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 45]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
35.  Castrén E, Kojima M. Brain-derived neurotrophic factor in mood disorders and antidepressant treatments. Neurobiol Dis. 2017;97:119-126.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 303]  [Cited by in RCA: 268]  [Article Influence: 29.8]  [Reference Citation Analysis (0)]
36.  Wang CS, Kavalali ET, Monteggia LM. BDNF signaling in context: From synaptic regulation to psychiatric disorders. Cell. 2022;185:62-76.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 513]  [Cited by in RCA: 433]  [Article Influence: 108.3]  [Reference Citation Analysis (0)]
37.  Saarelainen T, Hendolin P, Lucas G, Koponen E, Sairanen M, MacDonald E, Agerman K, Haapasalo A, Nawa H, Aloyz R, Ernfors P, Castrén E. Activation of the TrkB neurotrophin receptor is induced by antidepressant drugs and is required for antidepressant-induced behavioral effects. J Neurosci. 2003;23:349-357.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 659]  [Cited by in RCA: 570]  [Article Influence: 24.8]  [Reference Citation Analysis (0)]
38.  Gracie DJ, Hamlin PJ, Ford AC. The influence of the brain-gut axis in inflammatory bowel disease and possible implications for treatment. Lancet Gastroenterol Hepatol. 2019;4:632-642.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 306]  [Cited by in RCA: 260]  [Article Influence: 37.1]  [Reference Citation Analysis (0)]
39.  Brzozowski B, Mazur-Bialy A, Pajdo R, Kwiecien S, Bilski J, Zwolinska-Wcislo M, Mach T, Brzozowski T. Mechanisms by which Stress Affects the Experimental and Clinical Inflammatory Bowel Disease (IBD): Role of Brain-Gut Axis. Curr Neuropharmacol. 2016;14:892-900.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 155]  [Cited by in RCA: 140]  [Article Influence: 14.0]  [Reference Citation Analysis (0)]
40.  Masi G. Controversies in the Pharmacotherapy of Adolescent Depression. Curr Pharm Des. 2022;28:1975-1984.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 13]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
41.  Alboni S, van Dijk RM, Poggini S, Milior G, Perrotta M, Drenth T, Brunello N, Wolfer DP, Limatola C, Amrein I, Cirulli F, Maggi L, Branchi I. Fluoxetine effects on molecular, cellular and behavioral endophenotypes of depression are driven by the living environment. Mol Psychiatry. 2017;22:552-561.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 170]  [Cited by in RCA: 141]  [Article Influence: 15.7]  [Reference Citation Analysis (0)]
42.  Zheng W, Zhang YF, Zhong HQ, Mai SM, Yang XH, Xiang YT. Wuling Capsule for Major Depressive Disorder: A Meta-analysis of Randomised Controlled Trials. East Asian Arch Psychiatry. 2016;26:87-97.  [PubMed]  [DOI]
43.  Zheng J, Han J, Wang Y, Xu Y, Yu J, Han B, Tian Z. Antidepressant and anxiolytic effects of Wuling Capsule in CSDS mice: Alleviating HPA axis hyperactivity via the Nesfatin-1/NF-κB signaling pathway. J Ethnopharmacol. 2025;338:119111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 7]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
44.  Li D, Zheng J, Wang M, Feng L, Liu Y, Yang N, Zuo P. Wuling powder prevents the depression-like behavior in learned helplessness mice model through improving the TSPO mediated-mitophagy. J Ethnopharmacol. 2016;186:181-188.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 28]  [Cited by in RCA: 26]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
45.  Kurita M, Nishino S, Kato M, Numata Y, Sato T. Plasma brain-derived neurotrophic factor levels predict the clinical outcome of depression treatment in a naturalistic study. PLoS One. 2012;7:e39212.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 59]  [Cited by in RCA: 61]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
46.  Yuan X, Chen B, Duan Z, Xia Z, Ding Y, Chen T, Liu H, Wang B, Yang B, Wang X, Liu S, Zhou JY, Liu Y, Wang Q, Shen Z, Xiao J, Shang H, Liu W, Shi G, Zhu L, Chen Y. Depression and anxiety in patients with active ulcerative colitis: crosstalk of gut microbiota, metabolomics and proteomics. Gut Microbes. 2021;13:1987779.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 223]  [Cited by in RCA: 188]  [Article Influence: 37.6]  [Reference Citation Analysis (1)]
47.  Barberio B, Zamani M, Black CJ, Savarino EV, Ford AC. Prevalence of symptoms of anxiety and depression in patients with inflammatory bowel disease: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol. 2021;6:359-370.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 614]  [Cited by in RCA: 512]  [Article Influence: 102.4]  [Reference Citation Analysis (1)]
48.  Gao X, Tang Y, Lei N, Luo Y, Chen P, Liang C, Duan S, Zhang Y. Symptoms of anxiety/depression is associated with more aggressive inflammatory bowel disease. Sci Rep. 2021;11:1440.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 70]  [Cited by in RCA: 64]  [Article Influence: 12.8]  [Reference Citation Analysis (0)]
49.  Marrie RA, Graff LA, Fisk JD, Patten SB, Bernstein CN. The Relationship Between Symptoms of Depression and Anxiety and Disease Activity in IBD Over Time. Inflamm Bowel Dis. 2021;27:1285-1293.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 111]  [Cited by in RCA: 98]  [Article Influence: 19.6]  [Reference Citation Analysis (1)]
50.  Karakula-Juchnowicz H, Rog J, Juchnowicz D, Łoniewski I, Skonieczna-Żydecka K, Krukow P, Futyma-Jedrzejewska M, Kaczmarczyk M. The study evaluating the effect of probiotic supplementation on the mental status, inflammation, and intestinal barrier in major depressive disorder patients using gluten-free or gluten-containing diet (SANGUT study): a 12-week, randomized, double-blind, and placebo-controlled clinical study protocol. Nutr J. 2019;18:50.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 75]  [Cited by in RCA: 60]  [Article Influence: 8.6]  [Reference Citation Analysis (0)]
51.  Bernstein CN, Hitchon CA, Walld R, Bolton JM, Sareen J, Walker JR, Graff LA, Patten SB, Singer A, Lix LM, El-Gabalawy R, Katz A, Fisk JD, Marrie RA; CIHR Team in Defining the Burden and Managing the Effects of Psychiatric Comorbidity in Chronic Immunoinflammatory Disease. Increased Burden of Psychiatric Disorders in Inflammatory Bowel Disease. Inflamm Bowel Dis. 2019;25:360-368.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 225]  [Cited by in RCA: 208]  [Article Influence: 29.7]  [Reference Citation Analysis (0)]
52.  Chen DL, Dai YC, Zheng L, Chen YL, Zhang YL, Tang ZP. Features of the gut microbiota in ulcerative colitis patients with depression: A pilot study. Medicine (Baltimore). 2021;100:e24845.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 29]  [Article Influence: 5.8]  [Reference Citation Analysis (1)]
53.  Masanetz RK, Winkler J, Winner B, Günther C, Süß P. The Gut-Immune-Brain Axis: An Important Route for Neuropsychiatric Morbidity in Inflammatory Bowel Disease. Int J Mol Sci. 2022;23:11111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 59]  [Cited by in RCA: 47]  [Article Influence: 11.8]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade C, Grade C

Novelty: Grade B, Grade B

Creativity or Innovation: Grade B, Grade B

Scientific Significance: Grade B, Grade C

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Ding L; Yu RQ S-Editor: Wang JJ L-Editor: A P-Editor: Zheng XM

Write to the Help Desk