BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Jan 28, 2025; 31(4): 93179
Published online Jan 28, 2025. doi: 10.3748/wjg.v31.i4.93179
Bletilla striata polysaccharides alleviate metabolic dysfunction-associated steatotic liver disease through enhancing hepatocyte RelA/ HNF1α signaling
Yi-Huai He, Aikedaimu Abudukeremu, Xuan-Yu Meng, Ya-Qun Guan, State Key Laboratory of Pathogenesis, Prevention and Treatment of High Incidence Diseases in Central Asia, Xinjiang Key Laboratory of Molecular Biology for Endemic Diseases, Department of Pathology, School of Basic Medical Sciences, Xinjiang Medical University, Urumqi 830000, Xinjiang Uyghur Autonomous Region, China
Yi-Huai He, Li-Li Ou, Jin-Lian Jiang, Yun-Fen Chen, Department of Infectious Diseases, Affiliated Hospital of Zunyi Medical University, Zunyi 563000, Guizhou Province, China
Yuan Xue, Department of Liver Diseases, Third People’s Hospital of Changzhou, Changzhou 213000, Jiangsu Province, China
Mao-Yuan Mu, Department of Intervention Radiology, Affiliated Hospital of Zunyi Medical University, Zunyi 563000, Guizhou Province, China
Wei-Wei Zhong, Department of Infectious Diseases, Jingmen Central Hospital, Jingmen 448000, Hubei Province, China
De-Lin Xu, Department of Cell Biology, Zunyi Medical University, Zunyi 563099, Guizhou Province, China
Ya-Qun Guan, Xinjiang Second Medical College, Karamay 834000, Xinjiang Uyghur Autonomous Region, China
ORCID number: Yi-Huai He (0000-0002-8639-3436); Li-Li Ou (0009-0002-5293-0309); Jin-Lian Jiang (0000-0002-0791-9680); Yun-Fen Chen (0000-0002-7940-7481); Aikedaimu Abudukeremu (0000-0002-3262-637X); Yuan Xue (0000-0002-5428-0058); Mao-Yuan Mu (0000-0001-5632-0167); Wei-Wei Zhong (0000-0002-9736-8148); De-Lin Xu (0000-0003-3695-2997); Xuan-Yu Meng (0000-0001-9164-1185); Ya-Qun Guan (0000-0002-5729-9889).
Author contributions: He YH, Xu DL, and Guan YQ designed the research study; He YH, Ou LL, Jiang JL, Chen YF, and Abudukeremu A performed the research; Xue Y, Mu MY, Zhong WW, Xu DL, and Meng XY contributed new reagents and analytic tools; He YH, Ou LL, Jiang JL, and Chen YF analyzed the data and wrote the manuscript; Guan YQ revised the manuscript; All authors have read and approved the final manuscript.
Supported by the National Natural Science Foundation of China, No. 32260089; the Science and Technology Research Foundation of Guizhou Province, No. QKHJC-ZK (2022) YB642; the Science and Technology Research Foundation of Hubei Province, No. 2022BCE030; the Science and Technology Research Foundation of Changzhou City, No. CE20225040; the Science and Technology Research Foundation of Zunyi City, No. ZSKHHZ (2022) 344 and No. ZSKHHZ (2022) 360; and WBE Liver Fibrosis Foundation, No. CFHPC2025028.
Institutional review board statement: All human hepatocyte studies were approved by the Medical Ethics Committee of Zunyi Medical University, No. (2023)1-172.
Institutional animal care and use committee statement: All animal studies were approved by the Animal Laboratory Studies Ethics Review Committee of Zunyi Medical University, No. ZMU21-2107-003 and No. ZMU22-2303-029.
Conflict-of-interest statement: The authors declare that they have no conflict of interest.
Data sharing statement: The datasets generated and analyzed during the present study are available from the corresponding author upon reasonable request.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Corresponding author: Ya-Qun Guan, MD, Professor, State Key Laboratory of Pathogenesis, Prevention and Treatment of High Incidence Diseases in Central Asia, Xinjiang Key Laboratory of Molecular Biology for Endemic Diseases, Department of Pathology, School of Basic Medical Sciences, Xinjiang Medical University, No. 393 Xinyi Road, Urumqi 830000, Xinjiang Uyghur Autonomous Region, China. yaqunguan557@xjmu.edu.cn
Received: February 21, 2024
Revised: October 15, 2024
Accepted: November 14, 2024
Published online: January 28, 2025
Processing time: 312 Days and 21 Hours

Abstract
BACKGROUND

Bletilla striata polysaccharides (BSP) have antioxidant, immune regulation, and anti-fibrotic activities. However, the therapeutic effect and mechanisms underlying the action of BSP in metabolic dysfunction-associated steatotic liver disease (MASLD) have not been fully understood.

AIM

To investigate the therapeutic effects and mechanisms of BSP on MASLD by centering on the hepatocyte nuclear factor kappa B p65 (RelA)/hepatocyte nuclear factor-1 alpha (HNF1α) signaling.

METHODS

A mouse model of MASLD was induced by feeding with a high-fat-diet (HFD) and a hepatocyte model of steatosis was induced by treatment with sodium oleate (SO) and sodium palmitate (SP). The therapeutic effects of BSP on MASLD were examined in vivo and in vitro. The mechanisms underlying the action of BSP were analyzed for their effect on lipid metabolism disorder, endoplasmic reticulum (ER) stress, and the RelA/HNF1α signaling.

RESULTS

HFD feeding reduced hepatocyte RelA and HNF1α expression, induced ER stress, lipid metabolism disorder, and necroptosis in mice, which were significantly mitigated by treatment with BSP. Furthermore, treatment with BSP or BSP-containing conditional rat serum significantly attenuated the sodium oleate/sodium palmitate (SO/SP)-induced hepatocyte steatosis by decreasing lipid accumulation, and lipid peroxidation, and enhancing the expression of RelA, and HNF1α. The therapeutic effects of BSP on MASLD were partially abrogated by RELA silencing in mice and RELA knockout in hepatocytes. RELA silencing or knockout significantly down-regulated HNF1α expression, and remodeled ER stress and oxidative stress responses during hepatic steatosis.

CONCLUSION

Treatment with BSP ameliorates MASLD, associated with enhancing the RelA/HNF1α signaling, remodeling ER stress and oxidative stress responses in hepatocytes.

Key Words: Bletilla striata polysaccharides; Metabolic dysfunction-associated steatotic liver disease; Nuclear factor kappa B p65/hepatocyte nuclear factor-1 alpha signaling; Endoplasmic reticulum stress; Oxidative stress; Lipid metabolism reprogramming

Core Tip: This study aimed to investigate the therapeutic effects and mechanisms of Bletilla striata polysaccharides (BSP) on metabolic dysfunction-associated steatotic liver disease (MASLD). Treatment with BSP ameliorates MASLD by enhancing the nuclear factor kappa B p65 (RelA)/hepatocyte nuclear factor-1 alpha (HNF1α) signaling in hepatocytes, which remodels ER stress and oxidative stress responses, and reduces lipid metabolism disorders, and necroptosis. The results suggest that targeting hepatocyte RelA/HNF1α signaling may be a new intervention for treating MASLD, and BSP may be a potential reagent for the treatment of MASLD.



INTRODUCTION

Metabolic dysfunction-associated steatotic liver disease (MASLD), the non-alcoholic fatty liver disease (NAFLD) or metabolic-associated fatty liver disease, is pathologically characterized by excessive accumulation of lipids in liver cells caused by metabolic dysfunction, and has become one of the most common chronic liver diseases[1,2]. The MASLD is diagnosed, based on new criteria of overweight/obesity, type 2 diabetes, or manifestations of metabolic dysfunctions, leading to the presence of fatty liver in liver biopsy histology or imaging, or blood biomarker examination[3]. MASLD emphasizes the importance of metabolic dysfunction in the development and progression of disease, and is not completely equivalent to NAFLD, which focuses on excluding alcohol abuse and other liver-damaging factors. In recent years, with the increasing prevalence of obesity, diabetes, and metabolic syndrome, the incidence of MASLD is increasing, affecting more than one-third of adult people in the world. MASLD initially presents as a simple fatty liver and gradually progresses to fatty hepatitis, liver fibrosis, cirrhosis, and even liver failure or liver cancer[4,5]. In addition, MASLD is closely related to the development of various diseases, such as cardiovascular diseases, malignant tumors, together with liver cirrhosis, leading to a reduced life expectancy for patients[6,7]. Currently, simple target treatments are difficult to effectively control the progression of MASLD, making it not yet a first-line and fundamental approach to the treatment of MASLD. Targeting multiple factors driving the progression of MASLD and implementing the combined interventions are the direction for developing new therapeutic strategies for the intervention of MASLD[8].

The imbalance of intake and synthesis of lipids and the breakdown metabolism and extrahepatic transport of lipids into liver cells will cause excessive accumulation of lipids in liver cells, leading to hepatic steatosis. The excessive accumulation of lipids and lipid metabolites in liver cells can induce inflammation, oxidative stress, endoplasmic reticulum (ER) stress, damaging liver cell membranes and ultimately leading to hepatocyte necroptosis and apoptosis[9]. Necroptosis is usually mediated by inflammatory signals, characterized by cytoplasmic membrane lysis, and shares similar morphological changes with necrosis, but is strictly regulated by intracellular signals and the released contents after cell dissolution can induce obvious inflammatory reactions[10]. Mixed lineage kinase domain-like protein (MLKL) is the executor of necroptosis, and its phosphorylation level is a classical marker for necroptosis activation[11]. A study has suggested that increased levels of lipid peroxidation, ceramide (Cer), and sphingosine (SPH) can activate necroptosis[12]. It is suggested that lipid remodeling may activate necroptosis in hepatocytes and promote MASLD. However, the changes in lipid content related to necroptosis signaling pathways and the mechanisms driving these changes in the progression of MASLD are not well understood.

ER is important to regulate protein and lipid homeostasis in liver cells. Excessive accumulation of intracellular proteins or lipids can induce ER stress and activate the unfolded protein response (UPR)[13,14]. Under physiological conditions, 78-kDa glucose-regulated protein (GRP78), a chaperon protein in the ER, binds to the UPR sensor, inositol-requiring enzyme 1 alpha, activating transcription factor 6 (ATF6), and protein kinase R-like ER kinase (PERK), inhibiting their activation. During the process of ER stress, GRP78 competitively binds to unfolded or misfolded proteins, causing the dissociation and activation of UPR sensor proteins from GRP78. The activation of UPR sensor proteins leads to the expression of activating transcription factor 4 (ATF4), GRP78, 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog (HRD1), and others, and promotes cell survival[15,16]. However, prolonged or excessive ER stress can induce cell apoptosis and necroptosis[17]. The activation of ER stress-related apoptotic signaling reflects a failure of physiological compensation and the initiation of damaging responses that are usually mediated by CCAAT-enhancer-binding protein homologous protein (CHOP), and caspase-12. Simultaneously, the failure to timely control ER stress can also promote the progression of MASLD by upregulating the expression of sterol-regulatory element binding protein (SREBP1) and forkhead box A3, increasing lipid synthesis, and exacerbating lipid metabolism disorders[18-21]. Hence, effective control of ER stress in liver cells can correct lipid metabolism disorders in liver cells. Our previous research has shown that ER stress acts as an intracellular signaling to activate hepatocyte necroptosis in acute liver injury[22]; ATF6 silencing can aggravate ER stress and hepatocyte necroptosis[23]. These suggest that interference with the activation of UPR receptors in MASLD may cause ER stress dysregulation, which may further worsen lipid metabolism disorders and activate necroptosis.

In ER stress, PERK dissociates from GRP78 and undergoes homologous dimerization and phosphorylation, leading to the phosphorylation of eukaryotic translational initiation factor 2 alpha (eIF2α), which inhibits overall protein translation in cells and relieving the burden of protein processing in the ER. At the same time, eIF2α selectively initiates the expression of ATF4 and other adaptive genes. ATF4 can regulate the expression of several adaptive genes, involving amino acid transport proteins, metabolic enzymes, redox balance, and ER chaperone molecules, primarily mitigating stress and promoting cell survival[24]. ATF4 can induce GRP78 expression, which regulates hepatic steatosis, insulin resistance, inflammation, and apoptosis, contributing to the pathogenesis of MASLD[25]. Engagement of GRP78 by pregnancy zone protein induces uncoupling protein 1 expression and activates brown adipose tissues to promote diet-induced thermogenesis[26]. These findings suggest that in the process of ER stress, activation of the ATF4/GRP78 signaling may help in inhibiting hepatic steatosis.

Hepatocyte nuclear factor-1 alpha (HNF1α) is expressed in liver cells and simultaneously regulates lipid metabolism and the UPR[27]. In the liver, there are cis-elements of HNF1α in the promoter regions of various detoxification, glucose, and lipid metabolism-related genes, as well as genes for plasma proteins[28]. An early study has shown that during the process of liver injury, activated nuclear factor kappa B p65 (RelA) can upregulate the expression of HNF1α, which increases the expression of ER stress-related ATF4 and GRP78, thereby alleviating the UPR in liver cells[29]. However, studies have found a decrease in the expression levels of HNF1α in liver tissues undergoing fatty degeneration[30]. This suggests that the RelA/HNF1α signaling in hepatocytes may be impaired in the progression of MASLD; the impaired RelA/HNF1α signal may interfere with ER stress response, aggravating hepatic steatosis.

Research has discovered certain low molecular weight plant polysaccharides, such as Salvia miltiorrhiza polysaccharide, and Astragalus polysaccharide, that possess anti-MASLD activity[31,32]. Bletilla striata polysaccharides (BSP) are the main active ingredients of Bletilla striata tuber, and have various pharmacological activities, such as antioxidant, regenerative, tissue repair enhancement, immune modulation, clotting promotion, anti-fibrosis, and others[33-35]. In the clinic, BSP have been used to treat gastrointestinal mucosal ulcers and renal fibrosis[36,37]. Furthermore, treatment with BSP can reduce endotoxin and inflammatory mediator levels[38] and alleviate liver fibrosis in mice[39]. The oligosaccharides of Polygonatum sibiricum can improve metabolic syndrome and prevent fatty liver by regulating the gut microbiota and intestinal metabolites in mice fed with a high-fat diet (HFD)[40]. However, whether BSP can reduce the severity of MASLD has not been clarified.

In this study, we first tested the therapeutic effect of BSP on MASLD and explored the mechanisms underlying the action of BSP against MASLD by centering on the RelA/HNF1α signaling. This study aimed to discover the pharmacological action of BSP and develop new therapeutic strategies for the intervention of MASLD.

MATERIALS AND METHODS
Mice

All animal studies were approved by the Animal Laboratory Studies Ethics Review Committee of Zunyi Medical University (No. ZMU21-2107-003 and No. ZMU22-2303-029). Male C57BL/6 mice (5-6 weeks old, 19.4 ± 1.6 g) were purchased from the Animal Center of Zunyi Medical University (Guizhou, China), and acclimated to the laboratory environment for 7 days before the experiment. The mice were kept in a specific pathogen-free facility in a temperature-controlled environment (20 °C-24 °C) and were allowed free-access to food and water in a 12-hour light and 12-hour dark cycle. There were 12 mice/group in all studies, unless noted otherwise.

Induction of hepatic steatosis in mice

The mice were fed with a HFD containing 20% protein, 20% carbohydrate, and 60% fat (XTHF60; Jiangsu Xietong Pharmaceutical Bio-engineering, Jiangsu province, China). The mice were randomized into six groups (n = 12 per group). The control group was fed with a regular rodent chow, and the modern group was fed with the HFD for 0, 4, and 8 weeks. The mice were examined for serum biochemical indices, and hepatic triglycerides (TG) content, as well as liver tissue pathology assessments.

BSP treatments in mice

To evaluate the safety of BSP (PB200425; Shaanxi Pioneer Biotech, Shanxi province, China), all mice were randomized into five groups (n = 12 per group), including the normal control group (NC) (untreated); solvent control group (control); simple BSP group (BSP; 0.1, 0.2, 0.4 g/kg). The normal control mice were untreated, the solvent control mice received the same dose of vehicle phosphate buffer saline (PBS) (20 mL/kg) for 4 weeks, whereas the mice in the BSP groups were treated with different doses of BSP (0.1, 0.2, 0.4 g/kg body weight) by gavage daily for 4 weeks. Twelve hours after the final treatment, the mice were fasted for 6 hours and anesthetized. Their blood and liver samples were collected.

To evaluate the anti-MASLD effect of BSP, the mice were initially fed with HFD for 8 weeks. Subsequently, they were randomized and untreated as the HFD, or treated with the vehicle PBS as the PBS + HFD, 0.2 g/kg body weight of BSP as the BSP + HFD or with 150 mg/kg polyenylphosphatidylcholine (PPC) (Sanofi Pharmaceuticals, Beijing, China) as the PPC + HFD group by gavage daily for 4 weeks (n = 12 per group). The mice were continually fed with HFD for the remaining 4 weeks. After being fasted for 6 hours, the mice were anesthetized and their liver samples were collected for subsequent experiments.

RELA knockdown in vivo

To investigate the impact of RelA on MASLD, 36 mice were randomized into three groups including the HFD, RELA-knockdown (KD) + HFD, and RELA-KD + BSP + HFD groups (n = 12 per group). The HFD group and other groups of mice were injected intravenously with 5 × 1010 to 1 × 1011 viral gene copies per mouse of recombinant adeno-associated virus virions (AAV), (serotype 8; carrying the promoter of thyroxine binding globulin; Genechem, China) for the expression of control small hairpin RNA (shRNA) and RELA-specific shRNA in the liver, respectively. The sequences of control and RELA-specific shRNAs are shown in Table 1. Four weeks later, these mice were fed with HFD for 8 weeks and treated with 20 mL/kg PBS or 0.2 g/kg BSP by gavage daily for 4 weeks. At the end of the experiment, the mice were fasted, anesthetized and their peripheral venous blood and liver samples were collected.

Table 1 The sequences of small hairpin RNAs used in vivo.
Parameter
5’ to 3’
RELATarget sequenceGGACCTATGAGACCTTCAAGA
RELA shRNAGGACCTATGAGACCTTCAAGA CGAATCTTGAAGGTCTCATAGGTCC
Control shRNAAAACGTGACACGTTCGGAGAACGAATTCTCCGAACGTGTCACGTTT
Measurements of serum biochemical index

The collected blood samples were coagulated and centrifuged to prepare serum samples. The levels of serum alanine aminotransferase (ALT), total cholesterol (TC), and TG in individual samples were measured using a Beckman Coulter autoanalyzer (AU5800, Beckman Coulter, United States), in accordance with the standard protocol[41]. Specifically, the levels of serum ALT were quantified using the rate method. TC levels were measured using the cholesterol oxidase method. TG levels were assessed using the enzymatic method.

Histopathological analysis

Liver tissues were fixed with 4% formaldehyde, and paraffin-embedded. The liver tissue sections (4 μm) were dewaxed, rehydrated, and routine-stained with hematoxylin and eosin (HE). Similarly, the liver tissue sections were subjected to Masson staining using potassium dichromate, iron hematoxylin, acid fuchsin (to stain muscle fibers, cellulose, and red blood cells), phosphomolybdic acid, and aniline blue (to stain collagen fibers). The liver tissue sections were imaged using a panoramic slice scanner (3DHISTECH CaseViewer, Pannoramic SCAN, Hungary). The images were analyzed using CaseViewer v2.4 software at various magnifications (1 × to 1000 ×, Budapest, Hungary). The target areas of the tissue sections were examined with a magnification of × 100 to × 400.

Terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-nick end labeling assay

Hepatocyte apoptosis in the liver tissue sections was determined by transferase-mediated deoxyuridine triphosphate-nick end labeling (TUNEL) assays using a commercially available TUNEL assay kit (11684817910; Roche), according to the manufacturer’s instructions. Six areas were randomly selected on the section to calculate the apoptotic index = number of positive cells/total number of cells × 100%.

Liposome detection

Lipid metabolism was analyzed using a liquid chromatography (LC)-tandem mass spectrometry system consisting of ExionLC system equipped with a QTRAP mass spectrometer. The extracted samples were analyzed by the triple quadrupole mass spectrometry with a multiple reaction monitoring mode to screen differential lipids, and elucidate metabolic pathways. The differential metabolites between the two groups were identified utilizing a variable importance in projection (VIP) (> 1) and a P value of < 0.05. The VIP values represent the contribution of the variable to the differences between the two groups, which were obtained from orthogonal partial least squares-discriminant analysis (OPLS-DA) analysis. To prevent overfitting, all data were subjected to log-transformation (log2) and mean-centering before conducting OPLS-DA, with a permutation test (200 permutations) applied during the analysis. Furthermore, all data were standardized by a unit variance scaling (Z-score normalization), resulting in standardized data with a mean of 0 and a standard deviation of 1. In addition, differential abundance score was used to reflect the overall changes of all lipids in metabolism pathways. It was calculated by subtracting the number of downregulated differential lipids from the number of upregulated differential lipids, and then dividing it by the total number of differential lipids in the pathway. The value is presented by the distance from the dot to the central axis. The size of the circle represents the total number of differential lipids.

Liver ultrastructural analysis

The ultrastructure of liver tissues was examined using transmission electron microscopy (TEM). Fresh mouse liver samples, each measuring 1 mm³, were fixed in 3% glutaraldehyde for 4 hours at 4 °C. This was followed by dehydration using ethanol and acetone, and subsequent embedding in epoxy resin. Ultrathin sections, 70 nm in thickness, were prepared and stained with uranyl acetate for 30 minutes and lead citrate for 10 minutes at room temperature to enhance contrast. The sections were examined using a JEOL JEM-1400 microscope (Tokyo, Japan), enabling detailed visualization of cellular structures at the nanometer scale.

Cells and treatment

Human hepatocyte HepG2 cells and mouse hepatocyte AML-12 cells were obtained from the American type culture collection, and identified by short tandem repeat profiling. HepG2 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. The research involving human hepatocyte was approved by the Medical Ethics Committee of Zunyi Medical University, No. (2023)1-172. AML-12 cells were cultured in DMEM/F12 medium supplemented with 10% FBS, 0.5% insulin-transferrin-selenium (PB180429; Proncell, Wuhan, Hubei province, China), 40 ng/mL dexamethasone, and 1% penicillin/streptomycin.

To induce steatosis in vitro, hepatocytes were treated with sodium oleate (SO) and sodium palmitate (SP) at 250/125 μmol/L as the SO/SP group or control bovine serum albumin as the control group for 48 hours.

BSP treatment in vitro

AML-12 and HepG2 cells were cultured into 6-well or 96-well plates overnight and treated in triplicate with vehicle as the control, 80 mg/L BSP as the BSP group, 250/125 μmol/L SO/SP as the SO/SP group, or a combination of 80 mg/L BSP and 250/125 μmol/L SO/SP as the BSP + SO/SP group for 48 hours.

In addition, to prepare the conditional rat serum containing BSP, healthy rats were fed with control PBS or 0.2 g/kg BSP by gavage every 12 hours for three days. Two hours after the last feeding, their abdominal arterial blood samples were collected to prepare serum samples. AML-12 and HepG2 cells were cultured overnight and treated in triplicate with 250/125 μmol/L SO/SP in the medium containing 10% of the control rat serum or conditional rat BSP serum for 48 hours.

To investigate the effect of RelA on the therapeutic effect of BSP, RELA-knockout (KO) HepG2 cells were generated by OBiO Technology (Shanghai, China) (Table 2). RELA-KO HepG2 cells were generated using a single-guide RNA targeting the RELA gene, with wild-type (WT) RELA-expressing HepG2 cells serving as controls. HepG2 cells were divided into three groups: The SO/SP group (RELA-WT + control rat serum + SO/SP), the RELA-KO + SO/SP group (RELA-KO + control rat serum + SO/SP), and the RELA-KO + BSP + SO/SP group (RELA-KO + conditional rat BSP serum + SO/SP). The cells were treated with 250/125 μmol/L SO/SP in the medium containing 10% of control serum or conditional rat BSP serum for 48 hours.

Table 2 The sequences of single guide RNAs used in vitro.
Parameter
5’ to 3’
RELARELA sgRNAGCTTCCGCTACAAGTGCGAGGGG
Oil red O staining

The lipid droplets in HepG2 or AML-12 cells were stained with oil red O. HepG2 or AML-12 cells (1.2 × 106 cells/well) were cultured in 6-well plates, and treated in triplicate with vehicle, BSP, or SO/SP (250/125 μmol/L) for 48 hours and fixed, followed by staining with oil red O using a lipid staining kit (MAK194, Sigma-Aldrich), according to the manufacturer’s instructions. The lipid droplets in hepatocytes were stained with red or orange-red color. The cells were photoimaged under a light microscope (DXS-3; Shanghai Telon Optical Instruments, Shanghai, China).

Cell viability assay

To evaluate the potential toxicity of SO/SP, HepG2 or AML-12 cells were seeded in 96-well plates (4 × 104-5 × 104 cells/mL, 0.2 mL/well), and treated in quintuplicate with vehicle, BSP, or 250/125 μmol/L SO/SP for 48 hours. During the last one-hour culture, 20 μL of cell counting kit-8 solution (product code A311, Vazyme, Nanjing, Jiangsu province, China) was added to each well. Absorbance was measured at 450 nm using a microplate reader (BioTek Epoch, United States).

Flow cytometry

The frequency of apoptotic cells was quantified by flow cytometry after staining with the Annexin V-allophycocyanin conjugate (APC)/propidium iodide (PI) cell apoptosis detection kit (Procell, China)[42]. Briefly, after treatment with vehicle, SO/SP or BSP for 48 hours, the cells were harvested and stained with Annexin V-APC and PI for 15 minutes in the dark. The percentages (apoptotic index) of Annexin V + apoptotic cells were quantified by flow cytometry (BriCyte E6, Mindray, China).

Measurement of TG content

The contents of TG in mouse liver, hepatocytes, and cell culture supernatant were determined using the TG content assay kit (AKFA003M, Boxbio, Beijing, China) following the manufacturer’s instructions. The absorbance at 420 nm was measured using a microplate reader (BioTek Epoch), and the contents of TG were subsequently calculated using the acquired data.

Measurement of malondialdehyde

The malondialdehyde (MDA) levels were quantified using the thiobarbituric acid assay with an MDA test kit (A003; Nanjing Jiancheng, China), following the manufacturer’s instructions. Samples were mixed with 50% glacial acetic acid, and boiled for 40 minutes. After cooling in running water, they were centrifuged, and the resulting supernatants (0.2 mL each) were transferred into 96-well plates. Absorbance was measured at 532 nm using a microplate reader (BioTek EPOCH). The MDA contents were calculated using a standard curve based on tetraethyl propane as a positive control, normalized to protein concentration.

Reduced glutathione determination

The quantification of glutathione (GSH) in liver tissues, HepG2 cells, or AML-12 cells was conducted using the 5,5’-dithiobis-(2-nitrobenzoic acid) assay (AKPR008M; Boxbio)[43]. Adhering to the manufacturer’s protocols for sample preparation and processing, the optical density of GSH at a wavelength of 412 nm was measured using a BioTek EPOCH microplate reader. The concentrations of GSH in mouse liver samples and hepatocytes were determined according to the protocol provided in the kit.

Western blot analysis

The relative levels of protein expression in the liver samples, or hepatocytes were quantified by Western blot analysis, as described previously[44]. Briefly, liver tissue samples were homogenized in radioimmune precipitation assay lysis buffer containing phosphatase inhibitors (R0010, Solarbio, China). After determining the protein concentration, the lysate samples (40 μg/Lane) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, and transferred onto polyvinylidene fluoride membranes (Millipore, United States). The membranes were blocked with 5% skim milk in Tris-buffered saline containing Tween-20 and incubated overnight at 4 °C with primary antibodies (Table 3). Subsequently, the membranes were incubated with horseradish peroxidase-conjugated anti-mouse (sc-516102, Santa Cruz, 1:10000) or anti-rabbit (sc-2357, Santa Cruz; 1:10000) antibodies overnight (at 4 °C) or for 5 hours (at room temperature) and visualized using the enhanced chemiluminescence reagents. The immunocomplex was photoimaged using a ChemiDocTM XRS+ imager (Bio-Rad). The relative levels of target protein to the control β-actin expression were analyzed using quantum one software (Bio-Rad) and Image J software[45].

Table 3 Primary antibody information.
Antibody
Source
Lot number
Manufacturer
Reactivity
ATF4Rabbit mAb11815Cell signaling technology, Danvers, MA, United StatesMouse, human
β-actinMouse mAbSc-81178Santa Cruz, Dallas, TX, United StatesMouse, human
CHOPMouse mAbAb11419Abcam, Cambridge, MA, United StatesMouse, human
Cleaved caspase-3Rabbit mAb9664Cell signaling technologyHuman, mouse
GPX4Mouse mAbSc-166437Santa CruzMouse, human
GRP78Rabbit mAbAb108615AbcamHuman, mouse
HNF1αMouse mAbSc-393668Santa CruzMouse, human
HRD1Rabbit pAbPa5-76137Thermo Fisher Scientific, Waltham, MA, United StatesMouse, human
MCADMouse mAbSc-365109Santa CruzMouse, human
MLKLRabbit mAbPa5-34733Thermo Fisher ScientificMouse, human
MTPMouse mAbSc-515742Santa CruzMouse, human
p-MLKLRabbit mAb37333sCell signaling technologyMouse, human
RelAMouse mAbSc-514451Santa CruzMouse, human
SREBP1Mouse mAbMa5-16124Thermo Fisher ScientificMouse, human
Statistical analysis

Continuous variables with a normal distribution are expressed as means and SD. An independent t-test was conducted to compare the two groups. A one-way or two-way analysis of variance was used to test for statistical significance among multiple groups, with post hoc pairwise comparisons conducted using the least significant difference t test method if significant differences were found. Statistical analysis was applicable using statistical product and service solutions v29.0 (IBM, Armonk, NY, United States). A P value of < 0.05 was considered statistically significant.

RESULTS
Lipid metabolism remodeling and RelA/HNF1α signaling damage during hepatic steatosis

Compared to the control mice fed with normal chow, feeding with HFD for 8 weeks significantly increased body weights (Figure 1A) (P < 0.01), liver weights (Figure 1B) (P < 0.01), the levels of serum ALT (Figure 1C) (P < 0.01), and TC (Figure 1D) (P < 0.01), but not serum TG (Figure 1E) (P > 0.05) in mice. Hepatic TG contents also significantly increased (Figure 1F) (P < 0.01), and histologically, HE staining displayed prominent hepatic steatosis, with fatty degeneration mainly around the central veins in the HFD-fed mice. Although the frequency of apoptotic hepatocytes was low (< 1%) the percentages of apoptotic hepatocytes in the HFD-fed mice were significantly higher than that in the control mice (Figure 1G and H) (P < 0.01). Masson’s staining exhibited collagen fibers (blue) that were mainly distributed around blood vessels and hepatic cells with steatosis (Figure 1H). Western blot revealed that the relative levels of hepatic cleaved caspase-3, and phosphorylated MLKL were significantly elevated in the HFD-fed mice at 8 weeks post HFD feeding (Figure 1I) (P < 0.01). Except for the elevated hepatic TG contents at 4 weeks post HFD feeding, feeding with HFD for 8 weeks, but not 4 weeks, caused the pathologic changes in the liver of mice, suggesting that feeding with HFD for 8 weeks may successfully induce MASLD in mice.

Figure 1
Figure 1 High-fat-diet feeding induces hepatic steatosis in mice. Male C57BL/6 mice were fed with normal chow (control) or high-fat-diet (60% fat, 20% carbohydrates, 20% protein) for 0, 4, or 8 weeks (n = 12; 72 mice in total), and their body weights were measured and their fasting serum samples were prepared. A: Body weights; B: Liver weights; C: The levels of serum alanine aminotransferase; D: The levels of serum total cholesterol; E: The levels of serum triglycerides (TG); F: Intrahepatic TG contents; G: Apoptosis index; H: Hematoxylin and eosin, Masson and transferase-mediated deoxyuridine triphosphate-nick end labeling (TUNEL) staining of liver tissue sections; I: Western blot analysis of cleaved caspase-3 and mixed lineage kinase domain-like protein phosphorylation. Data are representative images or expressed as the mean ± SD of each group of mice from at least three separate experiments. bP < 0.01. 1P < 0.01 vs the control group. 2P < 0.01 vs the 0 weeks group. HFD: High-fat-diet; ALT: Alanine aminotransferase; TC: Total cholesterol; TG: Triglycerides; HE: Hematoxylin and eosin; MLKL: Mixed lineage kinase domain-like protein; TUNEL: Transferase-mediated deoxyuridine triphosphate-nick end labeling; wk: Week.

To understand the pathogenic process, liver lipid metabolites were extracted from individual mice and analyzed. Compared with the control mice, the HFD-fed mice exhibited a significant change in the hepatic lipid composition, with a significant elevation in TG contents (Figure 2A). The differential lipids of the top 40 VIP values were mainly enriched in the TG metabolism and sphingolipid metabolism pathways (Figure 2B). Among them, TG enrichment was the highest, with an increase in 240 species, and a decrease in 1 species, resulting in 428 species in the HFD group, related to the control group. The HFD feeding not only elevated the levels of hepatic TG increase, but also increased the average number of carbon atoms in the elevated TG although the number of double bonds in the elevated TG decreased (Figure 2C) (P < 0.01), indicating that the increased TG acyl chains were longer and more saturated, suggesting that the degrees of lipid oxidation may increase. Sphingolipid metabolism involves sphingomyelin (SM), Cer, and SPH, which are closely related to disease progression. Their differential abundance scores were all positive, and there was a clear increase in the levels of Cer and SPH (Figure 2D). These changes tended to activate programmed cell death, including apoptosis, and necroptosis. In addition, phosphatidylcholine can promote intracellular lipid metabolism, TG secretion, and TC extrusion; phosphatidylinositol (PI) can inhibit inflammation, but their contents trended to decrease. There was an increasing trend of oxidized form of coenzyme Q10 (CoQ10) between these groups of mice (Figure 2E), supporting that the degrees of lipid oxidation increased. These data suggest that the reshaping of hepatic lipid composition may tend to activate the necroptosis in hepatocytes. To further explore hepatic lipid metabolism, the levels of hepatic MDA, an end product of oxidized lipids, reduced GSH determination, microsomal triglyceride transfer protein (MTP); (TG transport out of hepatocytes), medium-chain acyl-CoA dehydrogenase (MCAD); (mitochondrial fatty acid β-oxidation), glutathione peroxidase 4 (GPX4); (anti-oxidation), RelA, HNF1α, cleaved sterol regulatory element-binding protein 1 (SREBP1c); (lipid synthesis), ATF4, GRP78, HRD1, CHOP, cleaved caspase-3 (executing cell apoptosis) expression, and MLKL phosphorylation (necroptosis) were examined in mice. Compared with the control mice, significantly higher levels of MDA were detected in the HFD-fed mice at 8 weeks post HFD feeding (Figure 2F) (P < 0.01), as well as reduced levels of GSH (Figure 2G) (P < 0.01). Following 8 weeks of HFD induction, TEM revealed that hepatocytes exhibited several changes: Chromatin condensation, mitochondrial pyknosis, ER expansion, and extensive lipid droplet accumulation in the cytoplasm (Figure 2H). Western blot revealed that the relative levels of hepatic MTP, MCAD, GPX4, RelA, and HNF1α were significantly reduced while SREBP1c, ATF4, GRP78, HRD1, and CHOP were significantly elevated in the HFD-fed mice at 8 weeks post HFD feeding (Figure 2I-K) (P < 0.01). Apparently, HFD feeding induced oxidative stress, and reduced extracellular transport and metabolism of TG while promoting lipid synthesis as well as ER stress in mice.

Figure 2
Figure 2 Lipid metabolism remodeling, and nuclear factor kappa B p65/hepatocyte nuclear factor-1 alpha signaling damage in mouse liver with steatosis. Liver lipids were extracted from the control and high-fat-diet-fed mice and subjected to liposome analyses using extensive targeted lipidomics techniques. The underlying causes of lipid metabolism remodeling and validation of differential lipid biological functions were explored. A: A scatter plot of differential lipids; B: Z-value plot of differential lipids; C: The number of triglycerides with average carbon atom and double bonds; D: Differential abundance scores of the sphingolipid metabolism pathway. The size of the circles represents the number of differential lipid species; E: Differential abundance scores of phosphatidylcholine, phosphatidylinositol and reduced coenzyme Q10; F: Hepatic malondialdehyde levels; G: Hepatic reduced glutathione levels; H: Transmission electron microscopy analysis of liver tissue ultrastructure; I: Western blot analysis of the relative levels of lipid metabolism-related protein expression; J: Western blot analysis of nuclear factor kappa B p65, and hepatocyte nuclear factor-1 alpha protein expression; K: Western blot analysis of endoplasmic reticulum stress-related protein expression levels. Data are representative images or expressed as the mean ± SD of each group (n = 10-12) of mice from at least three separate experiments. bP < 0.01. 1P < 0.01 vs the corresponding control or total triglycerides group. 2P < 0.01 vs the 0-week group. HFD: High-fat-diet; TG: Triglycerides; SM: Sphingomyelin; Cer: Ceramide; SPH: Sphingosine; PC: Phosphatidylcholine; PI: Phosphatidylinositol; CoQ10: Reduced coenzyme Q10; ER: Endoplasmic reticulum; L: Lipid droplet; M: Mitochondria; N: Nucleus; VIP: Variable importance in projection; wk: Week; SREBP1c: Cleaved sterol regulatory element-binding protein 1; MTP: Microsomal triglyceride transfer protein; MCAD: Medium-chain acyl-CoA dehydrogenase; GPX4: Glutathione peroxidase 4; HNF1α: Hepatocyte nuclear factor-1 alpha; GRP78: 78-kDa glucose-regulated protein; CHOP: CCAAT-enhancer-binding protein homologous protein; HRD1: 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.

To understand the changes in relevant indicators and the process of hepatic steatosis, AML-12 cells were treated with vehicle or SO/SP for 48 hours. Oil Red O staining displayed that compared with the cells treated with vehicle, treatment with SO/SP for 48 hours obviously increased the lipid accumulation (Figure 3A), TG content (Figure 3B) (P < 0.01), significantly decreased the cell viability (Figure 3C) (P < 0.01), the apoptotic index (Figure 3D) (P < 0.01), and the levels of MDA (Figure 3E) (P < 0.01). Furthermore, treatment with SO/SP significantly decreased the GSH content, and the relative levels of MTP, MCAD, GPX4, RelA, and HNF1α expression in AML-12 cells, but increased the expression of SREBP1c, ATF4, GRP78, HRD1, CHOP, cleaved caspase-3, and p-MLKL (Figure 3F-J) (P < 0.01).

Figure 3
Figure 3 Stimulation with sodium oleate/sodium palmitate induces steatosis, and impairs nuclear factor kappa B p65/hepatocyte nuclear factor-1 alpha signaling in AML-12 cells. AML-12 cells were stimulated in triplicate with control bovine serum albumin, 250/125 μmol/L sodium oleate/sodium palmitate for 48 hours. A: Oil red O staining of lipids; B: Intracellular triglycerides content; C: Cell counting kit-8 analysis of cell viability; D: Flow cytometry analysis of the frequency of apoptotic cells; E: Intracellular malondialdehyde levels; F: Reduced glutathione levels; G: Western blot analysis of the relative levels of lipid metabolism-related protein expression; H: Western blot analysis of the relative levels of nuclear factor kappa B p65 and hepatocyte nuclear factor-1 alpha expression; I: Western blot analysis of the relative levels of endoplasmic reticulum stress-related protein expression; J: Western blot analysis of the relative levels of apoptosis-, and necroptosis-related protein expression. Data are representative images or expressed as the mean ± SD of each group from three separate experiments. bP < 0.01. 1P < 0.01 vs the respective control group. SO/SP: Sodium oleate/sodium palmitate; TG: Triglycerides; MDA: Malondialdehyde; GSH: Glutathione; APC: Allophycocyanin conjugate; MLKL: Mixed lineage kinase domain-like protein; SREBP1c: Cleaved sterol regulatory element-binding protein 1; TG: Triglycerides; MTP: Microsomal triglyceride transfer protein; MCAD: Medium-chain acyl-CoA dehydrogenase; GPX4: Glutathione peroxidase 4; HNF1α: Hepatocyte nuclear factor-1 alpha; GRP78: 78-kDa glucose-regulated protein; CHOP: CCAAT-enhancer-binding protein homologous protein; HRD1: 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.
Treatment with BSP enhances the RelA/HNF1α signaling, and mitigates hepatic steatosis in mice fed with HFD

To test the safety profile of BSP, WT mice were treated with 0.1, 0.2, and 0.4 g/kg BSP by gavage daily for 4 weeks. Compared to the untreated NC group, treatment with either dose of BSP did not significantly change liver weights, and the levels of serum ALT, TC, and TG in mice (Figure 4A-D) (P > 0.05) and the treatment also did not significantly alter hepatic TG contents (Figure 4E) (P > 0.05). Histologically, treatment with BSP at the tested doses did not cause abnormal changes in liver tissue, such as hepatocyte necrosis, inflammation, or apoptosis, in mice (Figure 4F and G) (P > 0.05). Treatment with higher doses of BSP significantly decreased the levels of hepatic MDA (Figure 4H) (P < 0.01), and increased the levels of hepatic GSH (Figure 4I) (P < 0.01). Treatment with BSP significantly up-regulated the levels of GPX4, RelA, HNF1α, ATF4, and GRP78 expression (P < 0.01), but did not affect the levels of other related protein expression (Figure 4J-M) (P > 0.05). Thus, treatment with BSP was relatively safe in healthy mice. Accordingly, we used 0.2 g/kg BSP for the subsequent experiments.

Figure 4
Figure 4 Treatment with Bletilla striata polysaccharides is relatively safe in healthy mice. All mice were randomized into five groups (12 individuals each) including the normal control group (untreated); solvent control group (control; phosphate buffer saline: 20 mL/kg; quaque die; irrigation; 4 weeks); simple Bletilla striata polysaccharides group (0.1, 0.2, 0.4 g/kg; quaque die; irrigation; 4 weeks) (n = 12). Twelve hours after the final treatment, the mice were fasted for 6 h and their blood and liver samples were collected. A: Liver weights; B: Serum alanine aminotransferase levels; C: Serum total cholesterol levels; D: Serum triglyceride levels; E: Liver tissue triglyceride contents; F: Apoptotic index; G: Hematoxylin and eosin staining analysis of liver tissue pathology and transferase-mediated deoxyuridine triphosphate-nick end labeling analysis of liver cell apoptosis; H: Hepatic malondialdehyde levels; I: Hepatic reduced glutathione levels; J: Western blot analysis of the relative levels of hepatic lipid metabolism-related protein expression; K: Western blot analysis of relative hepatic nuclear factor kappa B p65, and hepatocyte nuclear factor-1 alpha protein levels; L: Western blot analysis of hepatic endoplasmic reticulum stress-related protein expression; M: Western blot analysis of hepatic cleaved caspase-3 and mixed lineage kinase domain-like protein phosphorylation. Data are representative images or expressed as the mean ± SD of each group of mice from at least three separate experiments. bP < 0.01. 1P < 0.01 vs the untreated group. NC: Normal control; ALT: Alanine aminotransferase; TC: Total cholesterol; TG: Triglycerides; BSP: Bletilla striata polysaccharides; HE: Hematoxylin and eosin; MLKL: Mixed lineage kinase domain-like protein; TUNEL: Transferase-mediated deoxyuridine triphosphate-nick end labeling; wk: Week; MDA: Malondialdehyde; GSH: Glutathione; PBS: Phosphate buffer saline; SREBP1c: Cleaved sterol regulatory element-binding protein 1; MTP: Microsomal triglyceride transfer protein; MCAD: Medium-chain acyl-CoA dehydrogenase; GPX4: Glutathione peroxidase 4; HNF1α: Hepatocyte nuclear factor-1 alpha; GRP78: 78-kDa glucose-regulated protein; CHOP: CCAAT-enhancer-binding protein homologous protein; HRD1: 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.

Next, we tested the therapeutic efficacy of BSP in the HFD-fed mice, C57BL/6 mice were fed with HFD for 8 weeks, randomized and untreated as the HFD group or treated with vehicle PBS as the PBS + HFD group, 0.2 g/kg BSP as the BSP + HFD group or 150 mg/kg PPC as the PPC + HFD group by gavage daily for 4 weeks (Figure 5A). Compared with the HFD group, treatment with BSP, but not the positive control PPC (P > 0.05), for 4 weeks significantly mitigated the HFD-increased body weights in mice (Figure 5B) (P < 0.01). However, treatment of either BSP or PPC reduced the HFD-induced gain in liver weights (Figure 5C) (P < 0.01). Laboratory tests exhibited that treatment with BSP, like with PPC, significantly mitigated the HFD-increased serum ALT, and TC (Figure 5D and E) (P < 0.01), but not TG (Figure 5F) (P > 0.05), and decreased the hepatic TG contents, and steatosis in mice (Figure 5G) (P < 0.01), accompanied by alleviating hepatocyte apoptosis (Figures 5H and I). Western blot analysis revealed that treatment with BSP or PPC significantly decreased the levels of cleaved caspase-3, and phosphorylated MLKL in the liver of HFD-fed mice (Figures 5J) (P < 0.01). There was no statistically significant difference in these related indicators between the HFD and PBS + HFD groups (Figure 5C-H).

Figure 5
Figure 5 Treatment with Bletilla striata polysaccharides mitigates the high-fat-diet-induced hepatic steatosis in mice. A: After being fed with high-fat-diet (HFD) for 8 weeks, the mice were randomized and untreated as the HFD group or treated with phosphate buffer saline (PBS) as the PBS + HFD group, 0.2 g/kg Bletilla striata polysaccharides (BSP) as the BSP + HFD group, or 150 mg/kg polyenylphosphatidylcholine (PPC) as the PPC + HFD group by gavage daily for 4 weeks (n = 12). The mice were continually fed with HFD for another 4 weeks; B: Longitudinal measurements of mouse body weights; C: Liver weights; D: Serum alanine aminotransferase levels; E: Serum total cholesterol levels; F: Serum triglyceride (TG) levels; G: Hepatic TG contents; H: Liver cell apoptotic index; I: Hematoxylin and eosin and Masson staining of liver tissue sections and transferase-mediated deoxyuridine triphosphate-nick end labeling analysis of hepatic cell apoptosis; J: Western blot analysis of the relative levels of apoptosis-, and necroptosis-related protein. Data are representative images or expressed as the mean ± SD of each group of mice from at least three separate experiments. bP < 0.01. 1P < 0.01 vs the high-fat-diet group. PBS: Phosphate buffer saline; ALT: Alanine aminotransferase; TC: Total cholesterol; TG: Triglycerides; HFD: High-fat-diet; BSP: Bletilla striata polysaccharides; HE: Hematoxylin and eosin; MLKL: Mixed lineage kinase domain-like protein; TUNEL: Transferase-mediated deoxyuridine triphosphate-nick end labeling; wk: Week; qd: Quaque die; PPC: Polyenylphosphatidylcholine.

Compared to the HFD group, treatment with BSP or PPC significantly decreased the levels of MDA (Figure 6A) (P < 0.01), and elevated the levels of GSH (Figure 6B) (P < 0.01). TEM revealed that both BSP and PPC significantly mitigated the degrees of chromatin condensation, mitochondrial pyknosis, ER expansion, and extensive lipid droplet accumulation in hepatocytes induced by HFD (Figure 6C). Western blot analysis revealed that treatment with BSP or PPC significantly increased the relative levels of MTP, MCAD, and GPX4 expression and decreased the levels of SREBP1c, HRD1, and CHOP expression in the liver of HFD-fed mice (P < 0.01). While treatment with PPC failed to significantly change the relative levels of hepatic RelA and HNF1α expression (P > 0.05), and decreased ATF4 and GRP78 expression (P < 0.01), BSP treatment significantly increased the relative levels of RelA, HNF1α, ATF4, and GRP78 expression in the liver of HFD-fed mice (Figure 6D-G) (P < 0.01). Collectively, treatment with BSP significantly mitigated the HFD-induced lipid metabolism disorders in mice, and its therapeutic effect may be related to the restoration of the RelA/HNF1α signaling.

Figure 6
Figure 6 Treatment with Bletilla striata polysaccharides enhances the nuclear factor kappa B p65/hepatocyte nuclear factor-1 alpha signaling and mitigates the high-fat-diet-induced hepatic lipid metabolism disorder in mice. A: Hepatic malondialdehyde levels; B: Hepatic reduced glutathione levels; C: Transmission electron microscopy analysis of liver tissue ultrastructure; D: Western blot analysis of the relative levels of hepatic nuclear factor kappa B p65 and hepatocyte nuclear factor-1 alpha protein expression; E: Western blot analysis of the relative levels of hepatic endoplasmic reticulum tress-related protein expression; F: Western blot analysis of the relative levels of hepatic lipid-metabolism related protein expression; G: Comparison of the effects of Bletilla striata polysaccharides and polyenylphosphatidylcholine on high-fat-diet-induced mice. Data are presented as representative images or expressed as the mean ± SD of each group of mice from at least three separate experiments. bP < 0.01. 1P < 0.01 vs the high-fat-diet group. 2P < 0.01 vs the polyenylphosphatidylcholine + high-fat-diet group. HFD: High-fat-diet; BSP: Bletilla striata polysaccharides; PBS: Phosphate buffer saline; MDA: Malondialdehyde; GSH: Glutathione; wk: Week; ER: Endoplasmic reticulum; L: Lipid droplet; M: Mitochondria; N: Nucleus; HNF1α: Hepatocyte nuclear factor-1 alpha; GRP78: 78-kDa glucose-regulated protein; CHOP: CCAAT-enhancer-binding protein homologous protein; HRD1: 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog; SREBP1c: Cleaved sterol regulatory element-binding protein 1; MTP: Microsomal triglyceride transfer protein; MCAD: Medium-chain acyl-CoA dehydrogenase; GPX4: Glutathione peroxidase 4; PPC: Polyenylphosphatidylcholine; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.
Treatment with BSP enhances the RelA/HNF1α signaling, and improves lipid metabolism disorders in SO/SP-induced hepatocytes

We further tested the effect of BSP treatment on the SO/SP-enhanced ER stress and lipid degeneration in both AML-12 and HepG2 cells. First, treatment with BSP increased the viability of both AML-12 and HepG2 cells (P < 0.05), but did not significantly alter lipid contents (P > 0.05). While treatment with SO/SP increased the lipid contents and reduced the viability of AML-12 and HepG2 cells, treatment with BSP partially mitigated the lipid accumulation and rescued the viability of AML-12 and HepG2 cells (Figure 7A-C) (P < 0.01). Treatment with BSP also significantly elevated the SO/SP-increased GSH contents, and the levels of RelA, HNF1α, ATF4, GRP78, MTP, MCAD, and GPX4 expression, but mitigated the MDA levels, SERBP1c, HRD1, CHOP, cleaved caspase-3 expression, and MLKL phosphorylation in HepG2 cells (Figure 7D-I) (P < 0.05). Finally, BSP treatment significantly decreased the SO/SP-triggered apoptosis of HepG2 cells in vitro (Figure 7J) (P < 0.01). Thus, BSP treatment partially mitigated the SO/SP-induced lipid degeneration in hepatocytes in vitro.

Figure 7
Figure 7 Bletilla striata polysaccharides treatment enhances the nuclear factor kappa B p65/hepatocyte nuclear factor-1 alpha signaling and alleviates the lipid degeneration in the sodium oleate/sodium palmitate-stimulated hepatocytes. A: Oil red O staining of lipids in AML-12 and HepG2 cells; B: Intracellular triglycerides content; C: Cell counting kit-8 analysis of the viability of AML-12 and HepG2 cells; D: Malondialdehyde levels; E: Reduced glutathione levels; F: Western blot analysis of the relative levels of nuclear factor kappa B p65 and hepatocyte nuclear factor-1 alpha expression; G: Western blot analysis of the relative levels of endoplasmic reticulum stress-related protein expression; H: Western blot analysis of the relative levels of lipid metabolism-related protein expression; I: Western blot analysis of the relative levels of cleaved caspase-3 and mixed lineage kinase domain-like protein phosphorylation; J: Flow cytometry analysis of the frequency of apoptotic cells. Data are representative images or expressed as the mean ± SD of each group from three separate experiments. aP < 0.05. bP < 0.01. 1P < 0.01 vs the control group. 2P < 0.01 vs the sodium oleate/sodium palmitate group. SO/SP: Sodium oleate/sodium palmitate; BSP: Bletilla striata polysaccharides; TG: Triglycerides; MDA: Malondialdehyde; GSH: Glutathione; HNF1α: Hepatocyte nuclear factor-1 alpha; GRP78: 78-kDa glucose-regulated protein; CHOP: CCAAT-enhancer-binding protein homologous protein; HRD1: 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog; OD: Optical density; SREBP1c: Cleaved sterol regulatory element-binding protein 1; MTP: Microsomal triglyceride transfer protein; MCAD: Medium-chain acyl-CoA dehydrogenase; GPX4: Glutathione peroxidase 4; MLKL: Mixed lineage kinase domain-like protein; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.

We further tested the effect of conditional rat BSP serum samples on the SO/SP-induced RelA/HNF1α signaling, ER stress, oxidative stress, and lipid metabolism in hepatocytes. Healthy rats were fed with 0.2 g/kg BSP twice per day for 3 consecutive days and their conditional serum samples were prepared (Figure 8A). Compared with the cells treated with SO/SP in the presence of control serum, treatment with SO/SP in the presence of conditional rat BSP serum obviously reduced the lipid contents, TG, and MDA levels, and increased the viability, and the GSH contents in AML-12 and HepG2 cells (Figure 8B-F) (P < 0.01). Treatment with the conditional rat BSP serum significantly up-regulated the levels of RelA, HNF1α, ATF4, GRP78, MTP, MCAD, and GPX4 expression in HepG2 cells, but down-regulated the expression of HRD1, CHOP, SREBP1c, cleaved caspase-3, and the phosphorylation of MLKL as well as decreased the apoptosis rate in HepG2 cells (Figure 8G-K) (P < 0.01). Therefore, these additional lines of evidence demonstrated that treatment with BSP enhanced the RelA/HNF1α signaling and ameliorated the lipid metabolism disorder in hepatocytes in vitro.

Figure 8
Figure 8 Treatment with conditional rat Bletilla striata polysaccharides-containing serum enhances the sodium oleate/sodium palmitate-stimulated nuclear factor kappa B p65/hepatocyte nuclear factor-1 alpha signaling and alleviates lipid metabolism disorder in hepatocytes. A: Healthy rats were treated with control phosphate buffer saline or 0.2 g/kg Bletilla striata polysaccharides (BSP) by gavage every 12 hours for three consecutive days. Two hours after the last administration, their blood samples were obtained for preparing conditional rat serum samples. AML-12 and HepG2 cells were cultured in the medium supplemented with 10% control or conditional rat BSP-containing serum and stimulated with 250/125 μmol/L sodium oleate/sodium palmitate for 48 hours; B: Oil red O staining of lipids in AML-12 and HepG2 cells; C: Intracellular triglycerides content; D: Cell counting kit-8 assay of the viability; E: Intracellular malondialdehyde levels; F: Reduced glutathione levels; G: Western blot analysis of the relative levels of nuclear factor kappa B p65, and hepatocyte nuclear factor-1 alpha expression; H: Western blot analysis of the relative levels of endoplasmic reticulum stress-related protein expression; I: Western blot analysis of the relative levels of lipid metabolism-related protein expression; J: Western blot analysis of the relative levels of cleaved caspase-3, and mixed lineage kinase domain-like protein phosphorylation; K: Flow cytometry analysis of the frequency of apoptotic cells. Data are representative images or expressed as the mean ± SD of each group from three separate experiments. bP < 0.01. 1P < 0.01 vs the sodium oleate/sodium palmitate group. SO/SP: Sodium oleate/sodium palmitate; BSP: Bletilla striata polysaccharides; TG: Triglycerides; MDA: Malondialdehyde; GSH: Glutathione; HNF1α: Hepatocyte nuclear factor-1 alpha; GRP78: 78-kDa glucose-regulated protein; CHOP: CCAAT-enhancer-binding protein homologous protein; HRD1: 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog; SREBP1c: Cleaved sterol regulatory element-binding protein 1; MTP: Microsomal triglyceride transfer protein; MCAD: Medium-chain acyl-CoA dehydrogenase; GPX4: Glutathione peroxidase 4; MLKL: Mixed lineage kinase domain-like protein; OD: Optical density; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.
Hepatic RELA-silencing partially abolishes the therapeutic effect of BSP on MASLD

To understand the role of the RelA/HNF1α signaling on hepatic steatosis, the mice were transduced with recommended AAVs for the expression of control shRNA or RELA-specific shRNA and four weeks later, the mice were fed with HFD for 8 weeks and treated with vehicle PBS or BSP by gavage daily for 4 weeks, resulting in three groups of the HFD, RELA-KD + HFD, and RELA-KD + BSP + HFD groups (Figure 9A). Compared to the HFD, RELA silencing (RELA-KD + HFD), and BSP treatment (RELA-KD + BSP + HFD) did not significantly change body weights in mice (Figure 9B) (P > 0.05). Furthermore, RELA silencing significantly elevated liver weights (Figure 9C) (P < 0.01), the levels of serum ALT (Figure 9D) (P < 0.01), and TC (Figure 9E) (P < 0.01), but not TG in mice (Figure 9F) (P > 0.05) and increased hepatic TG in mice (Figure 9G) (P < 0.01), accompanied by enhancing hepatocyte steatosis and apoptosis (Figure 9H and I) (P < 0.01). Moreover, RELA silencing significantly enhanced the relative levels of cleaved caspase-3 expression, and MLKL phosphorylation in mice (Figure 9J) (P < 0.01). Interestingly, treatment with BSP almost abrogated the changes in these indicators induced by RELA silencing in mice compared to the HFD group (Figure 9C-J) (P > 0.05).

Figure 9
Figure 9 RELA silencing partially abrogates the therapeutic effects of Bletilla striata polysaccharides on hepatic steatosis in mice. A: C57BL/6 mice were treated intravenously with recommended adeno-associated virus virions for the expression of control shRNA or RELA-specific shRNA and four weeks later, they were fed with high-fat-diet (HFD) for 12 weeks. During the last 4-week of HFD feeding, the RELA silencing mice were randomized and treated with vehicle phosphate buffer saline or Bletilla striata polysaccharides (BSP) for 4 weeks, leading to the HFD, RELA-knockdown (KD) + HFD group, and RELA-KD + BSP + HFD groups (n = 12); B: Mouse body weights; C: Liver weights; D: Serum aminotransferase levels; E: Serum total cholesterol levels; F: Serum triglyceride (TG) levels; G: Liver tissue TG contents; H: Apoptotic index; I: Hematoxylin and eosin and Masson staining of liver tissue sections and transferase-mediated deoxyuridine triphosphate-nick end labeling analysis of liver cell apoptosis; J: Western blot analysis of the relative levels of hepatic cleaved caspase-3, and mixed lineage kinase domain-like protein phosphorylation. Data are representative images or expressed as the mean ± SD of each group of mice from three separate experiments. bP < 0.01. 1P < 0.01 vs the high-fat-diet group. BSP: Bletilla striata polysaccharides; TG: Triglycerides; KD: Knockdown; HFD: High-fat-diet; wk: Week; shRNA: Small hairpin ribonucleic acid; ALT: Alanine aminotransferase; TC: Total cholesterol; TG: Triglycerides; MLKL: Mixed lineage kinase domain-like protein; HE: Hematoxylin and eosin; qd: Quaque die; TUNEL: Transferase-mediated deoxyuridine triphosphate-nick end labeling.

Furthermore, compared to the HFD, RELA silencing (RELA-KD + HFD) significantly elevated hepatic MDA contents (Figure 10A) (P < 0.01), and decreased hepatic GSH contents in mice (Figure 10B) (P < 0.01). TEM revealed that RELA silencing exacerbated the HFD-induced accumulation of lipid droplets, swelling of the ER, and damage to mitochondria in hepatocytes. Notably, BSP nearly eliminated these severe alterations caused by RELA silencing (Figure 10C). Additionally, RELA silencing not only decreased hepatic RelA levels, but also reduced the relative expression levels of HNF1α, ATF4, GRP78, MTP, MCAD, and GPX4 in mice (Figure 10D-F) (P < 0.01). In contrast, RELA silencing significantly enhanced the relative expression levels of HRD1, CHOP, and SREBP1c (Figure 10E and F) (P < 0.01). Interestingly, treatment with BSP did not significantly alter the hepatic levels of RelA and HNF1α expression, but almost abrogated the change in the hepatic MDA contents, and GSH contents, as well as the expression levels of HRD1, CHOP, and SREBP1c induced by RELA silencing in mice. Moreover, compared to the RELA-KD mice (RELA-KD + HFD), BSP treatment (RELA-KD + BSP + HFD) partially restored the expression levels ATF4, GRP78, and GPX4 in mice (Figure 10E and F) (P < 0.01). Together, these data suggest that the therapeutic effect of BSP on lipid metabolism disorders in the liver of mice may be partially dependent on the RelA-mediated signaling.

Figure 10
Figure 10 RELA silencing alters endoplasmic reticulum and oxidative responses in mouse liver induced by high-fat-diet. A: Intracellular malondialdehyde levels; B: Reduced glutathione levels; C: Transmission electron microscopy analysis of liver tissue ultrastructure; D: Western blot analysis of the relative levels of hepatic nuclear factor kappa B p65, and hepatocyte nuclear factor-1 alpha protein expression; E: Western blot analysis of the relative levels of hepatic endoplasmic reticulum stress-related protein expression; F: Western blot analysis of the relative levels of hepatic lipid metabolism-related protein expression. Data are representative images or expressed as the mean ± SD of each group of mice from three separate experiments. bP < 0.01. 1P < 0.01 vs the high-fat-diet group. 2P < 0.01 vs the RELA-knockdown + high-fat-diet group. BSP: Bletilla striata polysaccharides; KD: Knockdown; HFD: High-fat-diet; MDA: Malondialdehyde; GSH: Glutathione; ER: Endoplasmic reticulum; L: Lipid droplet; M: Mitochondria; N: Nucleus; HNF1α: Hepatocyte nuclear factor-1 alpha; GRP78: 78-kDa glucose-regulated protein; CHOP: CCAAT-enhancer-binding protein homologous protein; HRD1: 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog; SREBP1c: Cleaved sterol regulatory element-binding protein 1; MTP: Microsomal triglyceride transfer protein; MCAD: Medium-chain acyl-CoA dehydrogenase; GPX4: Glutathione peroxidase 4; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.

Finally, we tested the effect of RelA on the BSP-treated lipid degeneration in hepatocytes. The RELA-WT and the RELA-KO hepatocytes were treated with SO/SP in the medium containing 10% of control rat serum or conditional rat BSP serum for 48 hours (Figure 11A). Compared with the control cells (WT) that had been treated with SO/SP in the medium containing 10% of control rat serum, the RELA knockout obviously increased the lipid accumulation (Figure 11B), TG contents (Figure 11C) (P < 0.01), and the levels of MDA (P < 0.01), and reduced the HepG2 cell viability, and GSH levels (Figure 11D-F) (P < 0.01). The RELA knockout significantly down-regulated the levels of HNF1α, ATF4, GRP78, MTP, MCAD, and GPX4 expression in HepG2 cells, but up-regulated the expression of HRD1, CHOP, SREBP1c, cleaved caspase-3, and p-MLKL as well as increased the apoptosis rate in HepG2 cells (Figure 11G-K) (P < 0.01). Apparently, activation of the RELA signaling ameliorated the ER stress-induced lipid metabolism disorder in hepatocytes in vitro.

Figure 11
Figure 11 RELA knockout partially abolishes the therapeutic effect of Bletilla striata polysaccharides on the sodium oleate/sodium palmitate-induced lipid degeneration in hepatocytes. A: RELA-wild-type (WT) and RELA-knockout (KO) HepG2 cells were randomized into three groups, including the sodium oleate/sodium palmitate (SO/SP) group (healthy rat serum + SO/SP incubated RELA-WT HepG2 cells); RELA-KO + SO/SP group (healthy rat serum + SO/SP incubated RELA-KO HepG2 cells); RELA-KO + Bletilla striata polysaccharides (BSP) + SO/SP group (conditional rat BSP serum + SO/SP incubated RELA-KO HepG2 cells). RELA-WT and RELA-KO HepG2 cells were stimulated with SO/SP in the medium containing 10% control rat serum or the conditional rat BSP serum for 48 hours; B: Oil red O staining of lipids in HepG2 cells; C: Intracellular triglycerides content; D: Cell counting kit-8 analysis of the viability of HepG2 cells; E: Malondialdehyde levels; F: Reduced glutathione levels; G: Western blot analysis of the relative levels of nuclear factor kappa B p65 and hepatocyte nuclear factor-1 alpha expression; H: Western blot analysis of the relative levels of endoplasmic reticulum stress-related protein expression; I: Western blot analysis of the relative levels of lipid metabolism-related protein expression; J: Western blot analysis of the relative levels of cleaved caspase-3, and mixed lineage kinase domain-like protein phosphorylation; K: Flow cytometry analysis of the frequency of apoptotic cells. Data are representative images or expressed as the mean ± SD of each group from three separate experiments. bP < 0.01. 1P < 0.01 vs the sodium oleate/sodium palmitate group; 2P < 0.01 vs the RELA-knockout + sodium oleate/sodium palmitate group. KO: Knockout; WT: Wild type; BSP: Bletilla striata polysaccharides; TG: Triglycerides; MDA: Malondialdehyde; GSH: Glutathione; HNF1α: Hepatocyte nuclear factor-1 alpha; GRP78: 78-kDa glucose-regulated protein; CHOP: CCAAT-enhancer-binding protein homologous protein; HRD1: 3-hydroxy-3-methyl glutaryl coenzyme A reductase degradation 1 homolog; SREBP1c: Cleaved sterol regulatory element-binding protein 1; MTP: Microsomal triglyceride transfer protein; MCAD: Medium-chain acyl-CoA dehydrogenase; GPX4: Glutathione peroxidase 4; MLKL: Mixed lineage kinase domain-like protein; APC: Allophycocyanin conjugate; OD: Optical density; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.

Compared with the cells that had been treated with SO/SP in the medium containing control rat serum (SO/SP group), treatment with SO/SP in the presence of conditional rat BSP serum (RELA-KO + BSP + SO/SP group) did not obviously alter the lipid contents and the viability of RELA-KO HepG2 cells (Figure 11A-D) (P > 0.05). Treatment with conditional rat BSP serum significantly down-regulated the levels of RelA, HNF1α, ATF4, GRP78, and GPX4 expression in the RELA-KO HepG2 cells (Figure 11G-I) (P < 0.01), but did not alter the levels of MDA, and GSH (Figure 11E and F) (P > 0.05), the expression of HRD1, CHOP, MTP, MCAD, SREBP1c, cleaved caspase-3, and the phosphorylation of MLKL as well as the apoptosis rate in the RELA-KO HepG2 cells (Figure 11H-K) (P > 0.05). In addition, compared to the RELA-KO HepG2 cells treated alone with SO/SP (RELA-KO + SO/SP group), treatment with SO/SP in the presence of conditional rat BSP serum (RELA-KO + BSP + SO/SP group) markedly enhanced the expression levels of ATF4, GRP78, and GPX4 in the RELA-KO HepG2 cells (Figure 11H and I) (P < 0.01). Apparently, treatment with the conditional rat BSP serum almost abrogated the deteriorating effect of RELA knockout on the SO/SP-induced lipid degeneration in hepatocytes in vitro, except for unable to rescue RelA and HNF1α expression. Therefore, treatment with BSP ameliorated MASLD through enhancing the RelA-related signaling.

DISCUSSION

In this study, we investigated the therapeutic effect and potential mechanisms underlying the action of BSP in a mouse model of HFD-induced MASLD by testing whether BSP treatment could modulate the RelA/HNF1α signaling to reduce the lipid metabolism disorder and necroptosis in hepatocytes under an ER stress. Our data indicated that treatment with BSP reduced lipid accumulation in liver cells and optimized lipid composition, alleviating MASLD in mice. Like the positive control PPC, treatment with BSP alleviated the ER stress and necroptosis, reduced lipid synthesis, and enhanced TG extracellular transport, and fatty acid β-oxidation in mouse liver. Interestingly, treatment with BSP increased the expression of hepatic RelA, HNF1α, ATF4, GRP78, and GPX4 in hepatocytes. Treatment with BSP or conditional rat BSP serum also significantly alleviated the SO/SP-induced hepatocyte steatosis in vitro. Furthermore, induction of RELA silencing or knockout effectively reduced the expression of HNF1α, ATF4, GRP78, and GPX4, exacerbated the ER stress, and oxidative stress, and almost abrogated the therapeutic effect of BSP on MASLD. Together, these findings demonstrated that treatment with BSP inhibited the progression of MASLD by enhancing the RelA/HNF1α signaling, remodeling the ER/oxidative stress response, improving lipid metabolism and reducing necroptosis in hepatocytes. To the best of our knowledge, these novel findings may provide new insights into the molecular mechanisms underlying the action of BSP in therapeutic intervention of MASLD.

The liver is crucial for lipid metabolism. In patients with MASLD, de novo lipogenesis (DNL) contributes approximately one-third of the TG stored in the liver. This suggests that the stored lipids in the liver may also be due to increased intake, decreased breakdown, and reduced extracellular transport. Although the HFD-induced MASLD in mice is associated with increased lipid intake by liver cells, it is unclear whether and how changes in DNL, lipid breakdown, and extracellular transport are involved in the process of hepatic steatosis. SREBP1 regulates the expression of genes that are involved in the synthesis and accumulation of TG. Upon activation, SREBP1 protein undergoes proteolytic cleavage, generating a mature and transcriptionally active fragment. MTP is critical for very low-density lipoprotein-mediated TG export from liver cells. MCAD can mediate fatty acid β-oxidation in mitochondria. In this study, we found that HFD feeding significantly changed the quantity and quality of liver lipids in the mice, accompanied by increasing lipid contents and composition remodeling. Furthermore, HFD feeding also upregulated the expression of SREBP1c, but downregulated the expression of MTP, and MCAD, implying that the upregulated lipid synthesis, impaired fatty acid β-oxidation, and TG extracellular transport promote lipid accumulation in hepatocytes during the process of hepatic steatosis.

Interestingly, the lipidomics revealed that the abundance of hepatic TG was the highest with increased number of TG having long carbon chains and decreased number of TG with double bonds in MASLD mice. Given that extracellular free fatty acids (FFA) are the main resource for the synthesis of hepatic TG, and FFA can also be oxidized in hepatocytes, the elongation of the carbon chain may be related to the intake of high-fat components in the diet or the decreased fatty acid oxidation. The decrease in the number of TG with double bonds suggests an increase in hepatic lipid saturation, which may indicate an increase in the degree of lipid oxidation. The contents of oxidized CoQ10 and MDA increased, as well as reduced GSH content and GPX4 expression, supporting the existence of lipid peroxidation, and the activation of oxidative stress in the liver. Lipid peroxidation can increase the rate of Cer synthesis. Cer is central to sphingolipid metabolism, and their synthesis mainly occurs through three pathways: Hydrolysis of SMs in cell membranes by sphingomyelinase, a series of enzyme-catalyzed reactions involving palmitic acid and serine, and the generation of Cer synthase by SPH. Cers generated through the recycling of SPH contribute to 50% to 90% of their total biosynthesis. Cer can also be produced from the conversion of SM and SPH. Cer is hydrolyzed by ceramidase to form SPH, while its C-1 hydroxyl group reacts with a phosphocholine (or phosphoethanolamine) to form SM. Cer and SPH have inhibitory effects on cell differentiation and proliferation, while promoting apoptosis and necroptosis. In MASLD model mice, the contents of SM, Cer, and SPH increased, and Cer had the highest abundance, indicating a tendency to activate apoptosis and necroptosis. In addition, PC and PI, which have significant physiological functions, are reduced. PC is a critical component of the cell membrane and crucial for bile production from bile acid and cholesterol, intracellular transport of fatty acids, and extracellular transport of TG, serving as a signaling molecule to transmit cellular signals. The PC reduction can significantly disrupt hepatic lipid metabolism and promote lipid degeneration during the process of liver diseases. TC can be transported out of the cells through direct diffusion and carrier transport, but the extracellular transport of TG from hepatocytes depends on either transporters or cell lysis. In this study, we found that HFD feeding increased serum TC, but not TG levels in mice, indirectly supporting the notion that HFD feeding impaired lipid excretion. PI has an inhibitory effect on inflammation, and its reduction exacerbates hepatic inflammatory responses. Increased lipid peroxidation, abnormal SM metabolism, and imbalanced inflammatory responses are closely related to ER stress, apoptosis, and necroptosis[46-49]. Indeed, we found that HFD feeding enhanced the ER stress, apoptosis, and necroptosis in hepatocytes of mice, reshaping lipid metabolism, and contributing to the progression of MASLD in mice.

Bletilla striata tubers are mainly composed of mannose residue (Man) and glucose residue (Glc), and they usually contain a relative Man to Glc molar ratio of 1.26-8.09: 1, with a relative molecular mass ranging from 12 to 820 Kd[50]. These residues are polymerized through glycosidic bonds, and can be degraded by saliva and intestinal flora. These polysaccharides may target multiple organs and molecules, and have comprehensive and multifaceted activities against MASLD, including protecting hepatocytes, eliminating inflammation, and regulating lipid metabolism imbalance. Their anti-MASLD activity may be primarily attributed to their antioxidant effects. As free radical scavengers, natural polysaccharides can not only reduce the consumption of oxidative molecules under oxidative stress, but also inhibit the oxidative degradation of lipids, enzymes, and nucleic acids, protecting cell membrane structure and organelles, ultimately protecting liver function. BSP have various beneficial pharmacological activities, and has been used for the treatment of gastric ulcers[36], and prevention and treatment of renal fibrosis[35], due to its potent antioxidant activity[51,52]. It is possible that BSP may block the upregulated expression of NADPH oxidase 4, thereby inhibiting the generation of oxygen free radicals[53]; BSP may also increase the activity of serum superoxide dismutase (SOD) and reduce serum MDA and nitric oxide levels in the silicosis rats. Additionally, BSP have hepatoprotective activities[39,40,54]. In this study, we found that treatment with BSP alleviated the HFD-induced hepatic steatosis in mice, and the SO/SP-induced hepatocytes steatosis in vitro, suggesting that oral administration with BSP can be absorbed and reach the liver to alleviate MASLD. Mechanistically, treatment with BSP, like PPC, inhibited hepatic lipid synthesis, enhanced fatty acid β-oxidation, and increased lipid efflux in mice, accompanied by inhibiting lipid peroxidation, hepatocyte apoptosis, and necroptosis. Therefore, treatment with BSP alleviated MASLD by reducing liver lipid accumulation and optimizing lipid composition in mice.

PPC can protect liver cell membranes from inflammatory injury, and has been used for the treatment of liver diseases[55-57]. As a substance that repairs the damaged liver cell and organelle membranes to restore their function, PPC can provide phospholipids and other necessary nutrients to the body to increase membrane fluidity and stability, improve and restore the functions of organelles, such as mitochondria, ER, and Golgi apparatus[58,59]. Mechanistically, PPC can regulate the activity of membrane-bound enzymes, reduce the content and activity of cytochrome P450 2El as well as free radicals, and enhance the activity of SOD, catalase, and GSH reductase. PPC can also promote the β-oxidation of fatty acids by enhancing the peroxisome proliferator-activated receptor alpha/carnitine palmitoyltransferase 1A pathway to alleviate hepatic steatosis. In this study, we found that treatment with PPC, a positive control, effectively alleviated HFD-induced hepatic steatosis in mice. Interestingly, while treatment with BSP significantly decreased body weights, but restored the HFD-decreased hepatic RelA, and HNF1α expression, and increased ATF4 and GRP78 expression during ER stress in mice, treatment with PPC did not significantly change body weights, but like the HFD feeding, decreased hepatic ATF4 and GRP78 expression in mice. Our previous study has shown that the RelA/HNF1α signaling can alleviate ER stress by increasing the relative levels of ATF4 and GRP78 expression[29]. These data suggest that BSP may have different mechanistic actions in regulating lipid metabolism disorder by enhancing the RelA/HNF1α signaling to improve the dysregulated ER stress status during the process of MASLD in mice.

RelA is one member of the nuclear factor kappa B family[60]. Activated RelA can recruit co-transcriptional regulatory factors and basal transcription factors to regulate the transcriptional activity of many targeted genes[61,62]. Depending on its cellular localization, RelA can simultaneously regulate multiple targets during the process of a specific disease. For example, RelA expression and activation are closely related to liver inflammatory injury, liver fibrosis, and liver cirrhosis by regulating the basic functions of Kupffer cells, lymphocytes, and hepatic stellate cells[63]. Furthermore, RelA is also involved in liver regeneration and hepatocarcinogenesis by regulating hepatocyte proliferation and apoptosis[64]. HNF1α can enhance the transcriptional activity of the MTP gene and promote lipid efflux from liver cells[65]. Upregulated HNF1α expression in hepatocytes significantly alleviates MASLD, while the HNF1α-/- mice display hyperlipidemia, hyperglycemia, higher liver fatty acid synthesis, and significantly lower expression of liver fatty acid binding protein (L-FABP)[30,66]. L-FABP can mediate the transport and utilization of cytoplasmic lipids in hepatocytes, increase fatty acid β-oxidation, and alleviate oxidative stress[67], an important endogenous protective factor in MASLD. In this study, we found that the levels of RelA and HNF1α expression were reduced in steatotic hepatocytes while treatment with BSP effectively restored the expression of RelA and HNF1α in hepatocytes. RELA silencing or knockout decreased the expression of HNF1α, ATF4, GRP78, and GPX4, aggravated the ER stress, and oxidative stress, and partially abrogated the effect of BSP on MASLD. The results support the notion that BSP ameliorates MASLD by enhancing the RelA/HNF1α signaling to remodel the ER/oxidative stress in hepatocytes. However, there is controversy regarding the expression levels of HNF1α in liver tissue exhibiting steatosis[30,68]. This difference may be dependent on fatty degeneration and ER stress status in hepatocytes. Regardless, the levels of hepatic HNF1α expression are crucial for the process of MASLD and may be a good biomarker for the prognosis of MASLD.

ATF4 is a transcription factor and its expression can be induced by stress, such as hypoxia, amino acid deprivation, ER stress, and oxidative stress. However, under sustained stressful conditions, such as the process of ER stress, ATF4 can promote cellular apoptosis[69]. Treatment with salubrinal, a selective eIF2α dephosphorylation inhibitor, inhibits liver steatosis by increasing the hepatic eIF2α activation and ATF4 expression[70]. A previous study has also found that salubrinal treatment can alleviate ER stress-mediated hepatocyte apoptosis by increasing eIF2α phosphorylation and ATF4 expression in acute liver injury[71]. GRP78 over-expression down-regulates the expression of SREBP1c, reducing hepatic TG and TC levels, and improving insulin sensitivity[72]. GRP78 over-expression can not only reduce ER stress and hepatic steatosis[73], but also decrease lipid peroxidation and oxidative stress-related injury[74]. These results suggest that BSP may target the ER stress in hepatocytes, possibly by enhancing the RelA/HNF1α signaling to up-regulate the expression of ATF4 and GRP78, inhibiting the ER stress-mediated detrimental reactions and lipid metabolism disorders, and MASLD progression.

In addition, the molecular weight, monosaccharide composition, functional groups and other factors of polysaccharides can affect their activities[75,76]. Actually, the molecular weight distribution of polysaccharides has a significant impact on their biological activity[77-79]. While high molecular weight polysaccharides usually have a lower biological activity than those with low molecular weights, due to their poor ability to penetrate the cell membrane. The degradation of high molecular weight polysaccharides may significantly improve their bioactivity[78,80]. BSP are multiple forms of polysaccharides, dependent on the raw material, extraction, purification, and drying methods for obtaining BSP[33,52]. BSP have good biodegradability and can be partially degraded by saliva and rapidly degraded and utilized by intestinal flora, altering the composition and structure of the intestinal flora[81], and enhancing intestinal barrier function. In this study, we found that BSP or conditional rat BSP-containing serum had anti-MASLD effects in mice. It is possible that treatment with BSP or conditional rat BSP-containing serum may also regulate intestinal flora, intestinal barrier, and liver functions by different sizes of molecules to alleviate MASLD in mice. Theoretically, a single form of polysaccharide in BSP ultimately degrades into different sizes of molecules by the saliva and intestinal flora, exerting multi-target regulatory effects.

CONCLUSION

Treatment with BSP inhibited the progression of MASLD by inhibiting hepatic lipid accumulation, optimizing lipid composition, and reducing apoptosis and necroptosis. Mechanistically, treatment with BSP enhanced the RelA/HNF1α signaling in hepatocytes, thereby increasing the expression of ATF4, GRP78, and GPX4, and alleviating ER and oxidative stress. These findings may provide theoretical foundations for the potential applications of BSP as an anti-MASLD agent (Figure 12).

Figure 12
Figure 12  The mechanism of Bletilla striata polysaccharides in combating metabolic dysfunction-associated steatotic liver disease. Bletilla striata polysaccharides alleviates metabolic dysfunction-associated steatotic liver disease (MASLD) by enhancing the nuclear factor kappa B p65/hepatocyte nuclear factor-1 alpha signaling in hepatocytes, remodeling endoplasmic reticulum stress and oxidative stress responses, mitigating the metabolic disorder, apoptosis, and necroptosis of hepatocytes, and reducing MASLD. GRP78: 78-kDa glucose-regulated protein; GPX4: Glutathione peroxidase 4; ATF4: Activating transcription factor 4; RelA: Nuclear factor kappa B p65.
References
1.  Eslam M, Newsome PN, Sarin SK, Anstee QM, Targher G, Romero-Gomez M, Zelber-Sagi S, Wai-Sun Wong V, Dufour JF, Schattenberg JM, Kawaguchi T, Arrese M, Valenti L, Shiha G, Tiribelli C, Yki-Järvinen H, Fan JG, Grønbæk H, Yilmaz Y, Cortez-Pinto H, Oliveira CP, Bedossa P, Adams LA, Zheng MH, Fouad Y, Chan WK, Mendez-Sanchez N, Ahn SH, Castera L, Bugianesi E, Ratziu V, George J. A new definition for metabolic dysfunction-associated fatty liver disease: An international expert consensus statement. J Hepatol. 2020;73:202-209.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3855]  [Cited by in RCA: 3397]  [Article Influence: 566.2]  [Reference Citation Analysis (7)]
2.  Allen AM, Pose E, Reddy KR, Russo MW, Kamath PS. Nonalcoholic Fatty Liver Disease Gets Renamed as Metabolic Dysfunction-Associated Steatotic Liver Disease: Progress But With Challenges. Gastroenterology. 2024;166:229-234.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 15]  [Article Influence: 7.5]  [Reference Citation Analysis (1)]
3.  Ress C, Kaser S. Mechanisms of intrahepatic triglyceride accumulation. World J Gastroenterol. 2016;22:1664-1673.  [PubMed]  [DOI]  [Full Text]
4.  Chan KE, Koh TJL, Tang ASP, Quek J, Yong JN, Tay P, Tan DJH, Lim WH, Lin SY, Huang D, Chan M, Khoo CM, Chew NWS, Kaewdech A, Chamroonkul N, Dan YY, Noureddin M, Muthiah M, Eslam M, Ng CH. Global Prevalence and Clinical Characteristics of Metabolic-associated Fatty Liver Disease: A Meta-Analysis and Systematic Review of 10 739 607 Individuals. J Clin Endocrinol Metab. 2022;107:2691-2700.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 264]  [Cited by in RCA: 255]  [Article Influence: 63.8]  [Reference Citation Analysis (0)]
5.  Lim GEH, Tang A, Ng CH, Chin YH, Lim WH, Tan DJH, Yong JN, Xiao J, Lee CW, Chan M, Chew NW, Xuan Tan EX, Siddiqui MS, Huang D, Noureddin M, Sanyal AJ, Muthiah MD. An Observational Data Meta-analysis on the Differences in Prevalence and Risk Factors Between MAFLD vs NAFLD. Clin Gastroenterol Hepatol. 2023;21:619-629.e7.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 173]  [Cited by in RCA: 170]  [Article Influence: 56.7]  [Reference Citation Analysis (0)]
6.  Li J, Zou B, Yeo YH, Feng Y, Xie X, Lee DH, Fujii H, Wu Y, Kam LY, Ji F, Li X, Chien N, Wei M, Ogawa E, Zhao C, Wu X, Stave CD, Henry L, Barnett S, Takahashi H, Furusyo N, Eguchi Y, Hsu YC, Lee TY, Ren W, Qin C, Jun DW, Toyoda H, Wong VW, Cheung R, Zhu Q, Nguyen MH. Prevalence, incidence, and outcome of non-alcoholic fatty liver disease in Asia, 1999-2019: a systematic review and meta-analysis. Lancet Gastroenterol Hepatol. 2019;4:389-398.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 880]  [Cited by in RCA: 788]  [Article Influence: 112.6]  [Reference Citation Analysis (5)]
7.  Younossi ZM. Non-alcoholic fatty liver disease - A global public health perspective. J Hepatol. 2019;70:531-544.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1844]  [Cited by in RCA: 1634]  [Article Influence: 233.4]  [Reference Citation Analysis (6)]
8.  Eslam M, Sarin SK, Wong VW, Fan JG, Kawaguchi T, Ahn SH, Zheng MH, Shiha G, Yilmaz Y, Gani R, Alam S, Dan YY, Kao JH, Hamid S, Cua IH, Chan WK, Payawal D, Tan SS, Tanwandee T, Adams LA, Kumar M, Omata M, George J. The Asian Pacific Association for the Study of the Liver clinical practice guidelines for the diagnosis and management of metabolic associated fatty liver disease. Hepatol Int. 2020;14:889-919.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 712]  [Cited by in RCA: 636]  [Article Influence: 106.0]  [Reference Citation Analysis (7)]
9.  Scavo MP, Negro R, Arrè V, Depalo N, Carrieri L, Rizzi F, Mastrogiacomo R, Serino G, Notarnicola M, De Nunzio V, Lippolis T, Pesole PL, Coletta S, Armentano R, Curri ML, Giannelli G. The oleic/palmitic acid imbalance in exosomes isolated from NAFLD patients induces necroptosis of liver cells via the elongase-6/RIP-1 pathway. Cell Death Dis. 2023;14:635.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 17]  [Article Influence: 5.7]  [Reference Citation Analysis (0)]
10.  Zhao Y, Main K, Aujla T, Keshavjee S, Liu M. Necroptosis in Organ Transplantation: Mechanisms and Potential Therapeutic Targets. Cells. 2023;12.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 17]  [Cited by in RCA: 14]  [Article Influence: 4.7]  [Reference Citation Analysis (1)]
11.  Petrie EJ, Hildebrand JM, Murphy JM. Insane in the membrane: a structural perspective of MLKL function in necroptosis. Immunol Cell Biol. 2017;95:152-159.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 51]  [Cited by in RCA: 72]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
12.  Zhang X, Matsuda M, Yaegashi N, Nabe T, Kitatani K. Regulation of Necroptosis by Phospholipids and Sphingolipids. Cells. 2020;9.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 27]  [Cited by in RCA: 23]  [Article Influence: 3.8]  [Reference Citation Analysis (1)]
13.  Tilg H, Moschen AR. Evolution of inflammation in nonalcoholic fatty liver disease: the multiple parallel hits hypothesis. Hepatology. 2010;52:1836-1846.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2088]  [Cited by in RCA: 1961]  [Article Influence: 122.6]  [Reference Citation Analysis (6)]
14.  Flessa CM, Kyrou I, Nasiri-Ansari N, Kaltsas G, Kassi E, Randeva HS. Endoplasmic reticulum stress in nonalcoholic (metabolic associated) fatty liver disease (NAFLD/MAFLD). J Cell Biochem. 2022;123:1585-1606.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 68]  [Cited by in RCA: 57]  [Article Influence: 14.3]  [Reference Citation Analysis (0)]
15.  Zou Y, Qi Z. Understanding the Role of Exercise in Nonalcoholic Fatty Liver Disease: ERS-Linked Molecular Pathways. Mediators Inflamm. 2020;2020:6412916.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 23]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
16.  Kim YS, Kim SG. Endoplasmic reticulum stress and autophagy dysregulation in alcoholic and non-alcoholic liver diseases. Clin Mol Hepatol. 2020;26:715-727.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 57]  [Cited by in RCA: 52]  [Article Influence: 8.7]  [Reference Citation Analysis (1)]
17.  Maiers JL, Malhi H. Endoplasmic Reticulum Stress in Metabolic Liver Diseases and Hepatic Fibrosis. Semin Liver Dis. 2019;39:235-248.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 129]  [Cited by in RCA: 124]  [Article Influence: 17.7]  [Reference Citation Analysis (0)]
18.  Luo Y, Jiao Q, Chen Y. Targeting endoplasmic reticulum stress-the responder to lipotoxicity and modulator of non-alcoholic fatty liver diseases. Expert Opin Ther Targets. 2022;26:1073-1085.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 11]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
19.  Lebeaupin C, Vallée D, Hazari Y, Hetz C, Chevet E, Bailly-Maitre B. Endoplasmic reticulum stress signalling and the pathogenesis of non-alcoholic fatty liver disease. J Hepatol. 2018;69:927-947.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 819]  [Cited by in RCA: 738]  [Article Influence: 92.3]  [Reference Citation Analysis (5)]
20.  Cinaroglu A, Gao C, Imrie D, Sadler KC. Activating transcription factor 6 plays protective and pathological roles in steatosis due to endoplasmic reticulum stress in zebrafish. Hepatology. 2011;54:495-508.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 111]  [Cited by in RCA: 101]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
21.  Liu C, Zhou B, Meng M, Zhao W, Wang D, Yuan Y, Zheng Y, Qiu J, Li Y, Li G, Xiong X, Bian H, Zhang H, Wang H, Ma X, Hu C, Xu L, Lu Y. FOXA3 induction under endoplasmic reticulum stress contributes to non-alcoholic fatty liver disease. J Hepatol. 2021;75:150-162.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 85]  [Cited by in RCA: 78]  [Article Influence: 15.6]  [Reference Citation Analysis (0)]
22.  Tian RD, Chen YQ, He YH, Tang YJ, Chen GM, Yang FW, Li Y, Huang WG, Chen H, Liu X, Lin SD. Phosphorylation of eIF2α mitigates endoplasmic reticulum stress and hepatocyte necroptosis in acute liver injury. Ann Hepatol. 2020;19:79-87.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 29]  [Article Influence: 4.8]  [Reference Citation Analysis (0)]
23.  Huang MY, Wan DW, Deng J, Guo WJ, Huang Y, Chen H, Xu DL, Jiang ZG, Xue Y, He YH. Downregulation of RIP3 Improves the Protective Effect of ATF6 in an Acute Liver Injury Model. Biomed Res Int. 2021;2021:8717565.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 11]  [Article Influence: 2.2]  [Reference Citation Analysis (4)]
24.  Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M, Sadri N, Yun C, Popko B, Paules R, Stojdl DF, Bell JC, Hettmann T, Leiden JM, Ron D. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol Cell. 2003;11:619-633.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2380]  [Cited by in RCA: 2661]  [Article Influence: 115.7]  [Reference Citation Analysis (0)]
25.  Gentile CL, Frye M, Pagliassotti MJ. Endoplasmic reticulum stress and the unfolded protein response in nonalcoholic fatty liver disease. Antioxid Redox Signal. 2011;15:505-521.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 89]  [Cited by in RCA: 82]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
26.  Lin J, Jiang X, Dong M, Liu X, Shen Q, Huang Y, Zhang H, Ye R, Zhou H, Yan C, Yuan S, Wu X, Chen L, Wang Y, He M, Tao Y, Zhang Z, Jin W. Hepatokine Pregnancy Zone Protein Governs the Diet-Induced Thermogenesis Through Activating Brown Adipose Tissue. Adv Sci (Weinh). 2021;8:e2101991.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 27]  [Cited by in RCA: 27]  [Article Influence: 5.4]  [Reference Citation Analysis (1)]
27.  Begum S. Hepatic Nuclear Factor 1 Alpha (HNF-1α) In Human Physiology and Molecular Medicine. Curr Mol Pharmacol. 2020;13:50-56.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 15]  [Article Influence: 2.5]  [Reference Citation Analysis (3)]
28.  Pontoglio M. Hepatocyte nuclear factor 1, a transcription factor at the crossroads of glucose homeostasis. J Am Soc Nephrol. 2000;11 Suppl 16:S140-S143.  [PubMed]  [DOI]
29.  Liu SY, Rao JX, Deng J, Zhang GJ, Jiang XL, Cheng J, Chen H, Jiang ZG, Xu DL, He YH. Feedback loop between hepatocyte nuclear factor 1α and endoplasmic reticulum stress mitigates liver injury by downregulating hepatocyte apoptosis. Sci Rep. 2022;12:11602.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 9]  [Article Influence: 2.3]  [Reference Citation Analysis (4)]
30.  Ni Q, Ding K, Wang KQ, He J, Yin C, Shi J, Zhang X, Xie WF, Shi YQ. Deletion of HNF1α in hepatocytes results in fatty liver-related hepatocellular carcinoma in mice. FEBS Lett. 2017;591:1947-1957.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 35]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
31.  Wang W, Xu AL, Li ZC, Li Y, Xu SF, Sang HC, Zhi F. Combination of Probiotics and Salvia miltiorrhiza Polysaccharide Alleviates Hepatic Steatosis via Gut Microbiota Modulation and Insulin Resistance Improvement in High Fat-Induced NAFLD Mice. Diabetes Metab J. 2020;44:336-348.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 112]  [Cited by in RCA: 99]  [Article Influence: 16.5]  [Reference Citation Analysis (5)]
32.  Zheng N, Wang H, Zhu W, Li Y, Li H. Astragalus polysaccharide attenuates nonalcoholic fatty liver disease through THDCA in high-fat diet-fed mice. J Ethnopharmacol. 2024;320:117401.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 26]  [Article Influence: 13.0]  [Reference Citation Analysis (1)]
33.  Wang Y, Han S, Li R, Cui B, Ma X, Qi X, Hou Q, Lin M, Bai J, Li S. Structural characterization and immunological activity of polysaccharides from the tuber of Bletilla striata. Int J Biol Macromol. 2019;122:628-635.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 63]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
34.  Liu C, Dai KY, Ji HY, Jia XY, Liu AJ. Structural characterization of a low molecular weight Bletilla striata polysaccharide and antitumor activity on H22 tumor-bearing mice. Int J Biol Macromol. 2022;205:553-562.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 59]  [Article Influence: 14.8]  [Reference Citation Analysis (0)]
35.  Wang Y, Liu D, Chen S, Wang Y, Jiang H, Yin H. A new glucomannan from Bletilla striata: structural and anti-fibrosis effects. Fitoterapia. 2014;92:72-78.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 96]  [Cited by in RCA: 83]  [Article Influence: 6.9]  [Reference Citation Analysis (0)]
36.  Zhang C, Gao F, Gan S, He Y, Chen Z, Liu X, Fu C, Qu Y, Zhang J. Chemical characterization and gastroprotective effect of an isolated polysaccharide fraction from Bletilla striata against ethanol-induced acute gastric ulcer. Food Chem Toxicol. 2019;131:110539.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 118]  [Cited by in RCA: 89]  [Article Influence: 12.7]  [Reference Citation Analysis (0)]
37.  Wang B, Zhang H, Chen L, Mi Z, Xu Y, Zhao G, Liu S, Lei H, Wang Z, Niu J. Extraction, purification, and determination of the gastroprotective activity of glucomannan from Bletilla striata. Carbohydr Polym. 2020;246:116620.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 38]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
38.  Luo L, Zhou Z, Xue J, Wang Y, Zhang J, Cai X, Liu Y, Yang F. Bletilla striata polysaccharide has a protective effect on intestinal epithelial barrier disruption in TAA-induced cirrhotic rats. Exp Ther Med. 2018;16:1715-1722.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 13]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
39.  Jiang G, Wang B, Wang Y, Kong H, Wang Y, Gao P, Guo M, Li W, Zhang J, Wang Z, Niu J. Structural characteristics of a novel Bletilla striata polysaccharide and its activities for the alleviation of liver fibrosis. Carbohydr Polym. 2023;313:120781.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 59]  [Cited by in RCA: 43]  [Article Influence: 14.3]  [Reference Citation Analysis (0)]
40.  Hu B, Yang H, Chen G, Sun X, Zou X, Ma J, Yao X, Liang Q, Liu H. Structural characterization and preventive effect on non-alcoholic fatty liver disease of oligosaccharides from Bletilla striata. Food Funct. 2022;13:4757-4769.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 14]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
41.  Glibert B, Bourleaux V, Peeters R, Reynolds T, Vranken G. Analytical Performance Verification of the Beckman Coulter AU5800 Clinical Chemistry Analyser Against Recognized Quality Specifications Reveals Relevance of Method Harmonization. Clin Lab. 2016;62:57-72.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 8]  [Cited by in RCA: 8]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
42.  Chen H, Chen GM, Liu YJ, Rao JX, Zhou SZ, Chen S, Chen PT, Yang FW, Cheng QJ, He YH. Alpha-fetoprotein/endoplasmic reticulum stress signaling mitigates injury in hepatoma cells. Neoplasma. 2021;68:983-993.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 5]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
43.  Rahman I, Kode A, Biswas SK. Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method. Nat Protoc. 2006;1:3159-3165.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1965]  [Cited by in RCA: 1691]  [Article Influence: 84.6]  [Reference Citation Analysis (0)]
44.  Hou Y, Sun X, Gheinani PT, Guan X, Sharma S, Zhou Y, Jin C, Yang Z, Naren AP, Yin J, Denning TL, Gewirtz AT, Liu Y, Xie Z, Li C. Epithelial SMYD5 Exaggerates IBD by Down-regulating Mitochondrial Functions via Post-Translational Control of PGC-1α Stability. Cell Mol Gastroenterol Hepatol. 2022;14:375-403.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 19]  [Cited by in RCA: 17]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
45.  Chen YF, Liu SY, Cheng QJ, Wang YJ, Chen S, Zhou YY, Liu X, Jiang ZG, Zhong WW, He YH. Intracellular alpha-fetoprotein mitigates hepatocyte apoptosis and necroptosis by inhibiting endoplasmic reticulum stress. World J Gastroenterol. 2022;28:3201-3217.  [PubMed]  [DOI]  [Full Text]
46.  Adameova A, Horvath C, Abdul-Ghani S, Varga ZV, Suleiman MS, Dhalla NS. Interplay of Oxidative Stress and Necrosis-like Cell Death in Cardiac Ischemia/Reperfusion Injury: A Focus on Necroptosis. Biomedicines. 2022;10.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 50]  [Cited by in RCA: 47]  [Article Influence: 11.8]  [Reference Citation Analysis (1)]
47.  Basit F, van Oppen LM, Schöckel L, Bossenbroek HM, van Emst-de Vries SE, Hermeling JC, Grefte S, Kopitz C, Heroult M, Hgm Willems P, Koopman WJ. Mitochondrial complex I inhibition triggers a mitophagy-dependent ROS increase leading to necroptosis and ferroptosis in melanoma cells. Cell Death Dis. 2017;8:e2716.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 513]  [Cited by in RCA: 489]  [Article Influence: 54.3]  [Reference Citation Analysis (5)]
48.  Lou J, Wang X, Zhang H, Yu G, Ding J, Zhu X, Li Y, Wu Y, Xu H, Xu H, Gao W, Xiao J, Zhou K. Inhibition of PLA2G4E/cPLA2 promotes survival of random skin flaps by alleviating Lysosomal membrane permeabilization-Induced necroptosis. Autophagy. 2022;18:1841-1863.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 91]  [Cited by in RCA: 88]  [Article Influence: 22.0]  [Reference Citation Analysis (0)]
49.  Xue C, Gu X, Li G, Bao Z, Li L. Mitochondrial Mechanisms of Necroptosis in Liver Diseases. Int J Mol Sci. 2020;22.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 59]  [Cited by in RCA: 51]  [Article Influence: 8.5]  [Reference Citation Analysis (0)]
50.  Zhu Z, Liang T, Dai G, Zheng J, Dong J, Xia C, Duan B. Extraction, structural-activity relationships, bioactivities, and application prospects of Bletilla striata polysaccharides as ingredients for functional products: A review. Int J Biol Macromol. 2023;245:125407.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 58]  [Cited by in RCA: 49]  [Article Influence: 16.3]  [Reference Citation Analysis (0)]
51.  Qu Y, Li C, Zhang C, Zeng R, Fu C. Optimization of infrared-assisted extraction of Bletilla striata polysaccharides based on response surface methodology and their antioxidant activities. Carbohydr Polym. 2016;148:345-353.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 109]  [Cited by in RCA: 155]  [Article Influence: 15.5]  [Reference Citation Analysis (0)]
52.  Chen H, Zeng J, Wang B, Cheng Z, Xu J, Gao W, Chen K. Structural characterization and antioxidant activities of Bletilla striata polysaccharide extracted by different methods. Carbohydr Polym. 2021;266:118149.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 219]  [Cited by in RCA: 167]  [Article Influence: 33.4]  [Reference Citation Analysis (0)]
53.  Yue L, Wang W, Wang Y, Du T, Shen W, Tang H, Wang Y, Yin H. Bletilla striata polysaccharide inhibits angiotensin II-induced ROS and inflammation via NOX4 and TLR2 pathways. Int J Biol Macromol. 2016;89:376-388.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 86]  [Article Influence: 8.6]  [Reference Citation Analysis (0)]
54.  Hu B, Ye C, Leung EL, Zhu L, Hu H, Zhang Z, Zheng J, Liu H. Bletilla striata oligosaccharides improve metabolic syndrome through modulation of gut microbiota and intestinal metabolites in high fat diet-fed mice. Pharmacol Res. 2020;159:104942.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 55]  [Article Influence: 9.2]  [Reference Citation Analysis (0)]
55.  Lu Y, Feng T, Zhao J, Jiang P, Xu D, Zhou M, Dai M, Wu J, Sun F, Yang X, Lin Q, Pan W. Polyene Phosphatidylcholine Ameliorates High Fat Diet-Induced Non-alcoholic Fatty Liver Disease via Remodeling Metabolism and Inflammation. Front Physiol. 2022;13:810143.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 26]  [Cited by in RCA: 22]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
56.  Li Y, Chen A, Li Z, Cui X, Zhang G. Effectiveness of polyene phosphatidylcholine and its combination with other drugs in patients with liver diseases based on real-world research. Expert Rev Clin Pharmacol. 2022;15:1363-1375.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 10]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
57.  Xu J, Fan Y, Yu Y, Han Y, Kang Q, Tan N, Yang Y, Chen H, Pan J, Xu X. A Multicenter Real-World Study Evaluating the Hepatoprotective Effect of Polyene Phosphatidylcholine Against Chronic Hepatitis B. Front Med (Lausanne). 2022;9:842098.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 6]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
58.  Zhang Y, Lv J, Zhang J, Lv Z, Yu M. Lipidomic-based investigation into the therapeutic effects of polyene phosphatidylcholine and Babao Dan on rats with non-alcoholic fatty liver disease. Biomed Chromatogr. 2022;36:e5271.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 4]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
59.  Zhang J, Zang X, Lv J, Zhang Y, Lv Z, Yu M. Changes in Lipidomics, Metabolomics, and the Gut Microbiota in CDAA-Induced NAFLD Mice after Polyene Phosphatidylcholine Treatment. Int J Mol Sci. 2023;24.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 15]  [Cited by in RCA: 15]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
60.  Yu H, Lin L, Zhang Z, Zhang H, Hu H. Targeting NF-κB pathway for the therapy of diseases: mechanism and clinical study. Signal Transduct Target Ther. 2020;5:209.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1846]  [Cited by in RCA: 1669]  [Article Influence: 278.2]  [Reference Citation Analysis (4)]
61.  Kim Y, Allen E, Baird LA, Symer EM, Korkmaz FT, Na E, Odom CV, Jones MR, Mizgerd JP, Traber KE, Quinton LJ. NF-κB RelA Is Required for Hepatoprotection during Pneumonia and Sepsis. Infect Immun. 2019;87.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 10]  [Cited by in RCA: 10]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
62.  Yao F, Deng Y, Zhao Y, Mei Y, Zhang Y, Liu X, Martinez C, Su X, Rosato RR, Teng H, Hang Q, Yap S, Chen D, Wang Y, Chen MM, Zhang M, Liang H, Xie D, Chen X, Zhu H, Chang JC, You MJ, Sun Y, Gan B, Ma L. A targetable LIFR-NF-κB-LCN2 axis controls liver tumorigenesis and vulnerability to ferroptosis. Nat Commun. 2021;12:7333.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 272]  [Cited by in RCA: 248]  [Article Influence: 49.6]  [Reference Citation Analysis (4)]
63.  Oakley F, Teoh V, Ching-A-Sue G, Bataller R, Colmenero J, Jonsson JR, Eliopoulos AG, Watson MR, Manas D, Mann DA. Angiotensin II activates I kappaB kinase phosphorylation of RelA at Ser 536 to promote myofibroblast survival and liver fibrosis. Gastroenterology. 2009;136:2334-2344.e1.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 105]  [Cited by in RCA: 95]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
64.  Moles A, Butterworth JA, Sanchez A, Hunter JE, Leslie J, Sellier H, Tiniakos D, Cockell SJ, Mann DA, Oakley F, Perkins ND. A RelA(p65) Thr505 phospho-site mutation reveals an important mechanism regulating NF-κB-dependent liver regeneration and cancer. Oncogene. 2016;35:4623-4632.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 30]  [Cited by in RCA: 31]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
65.  Dai K, Hussain MM. NR2F1 disrupts synergistic activation of the MTTP gene transcription by HNF-4α and HNF-1α. J Lipid Res. 2012;53:901-908.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 28]  [Cited by in RCA: 26]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
66.  Akiyama TE, Ward JM, Gonzalez FJ. Regulation of the liver fatty acid-binding protein gene by hepatocyte nuclear factor 1alpha (HNF1alpha). Alterations in fatty acid homeostasis in HNF1alpha-deficient mice. J Biol Chem. 2000;275:27117-27122.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 23]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
67.  Wang G, Bonkovsky HL, de Lemos A, Burczynski FJ. Recent insights into the biological functions of liver fatty acid binding protein 1. J Lipid Res. 2015;56:2238-2247.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 231]  [Cited by in RCA: 211]  [Article Influence: 19.2]  [Reference Citation Analysis (0)]
68.  Lake AD, Chaput AL, Novak P, Cherrington NJ, Smith CL. Transcription factor binding site enrichment analysis predicts drivers of altered gene expression in nonalcoholic steatohepatitis. Biochem Pharmacol. 2016;122:62-71.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 17]  [Cited by in RCA: 16]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
69.  Wortel IMN, van der Meer LT, Kilberg MS, van Leeuwen FN. Surviving Stress: Modulation of ATF4-Mediated Stress Responses in Normal and Malignant Cells. Trends Endocrinol Metab. 2017;28:794-806.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 558]  [Cited by in RCA: 503]  [Article Influence: 55.9]  [Reference Citation Analysis (5)]
70.  Li J, Li X, Liu D, Zhang S, Tan N, Yokota H, Zhang P. Phosphorylation of eIF2α signaling pathway attenuates obesity-induced non-alcoholic fatty liver disease in an ER stress and autophagy-dependent manner. Cell Death Dis. 2020;11:1069.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 49]  [Cited by in RCA: 44]  [Article Influence: 7.3]  [Reference Citation Analysis (0)]
71.  Tang YJ, Chen H, Yi Y, Chen GM, Yang FW, Li Y, Tian RD, Huang WG, Cheng QJ, He YH. Inhibition of eIF2α Dephosphorylation Protects Hepatocytes from Apoptosis by Alleviating ER Stress in Acute Liver Injury. Biomed Res Int. 2020;2020:2626090.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 7]  [Article Influence: 1.2]  [Reference Citation Analysis (5)]
72.  Kammoun HL, Chabanon H, Hainault I, Luquet S, Magnan C, Koike T, Ferré P, Foufelle F. GRP78 expression inhibits insulin and ER stress-induced SREBP-1c activation and reduces hepatic steatosis in mice. J Clin Invest. 2009;119:1201-1215.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 626]  [Cited by in RCA: 596]  [Article Influence: 35.1]  [Reference Citation Analysis (0)]
73.  Chen WT, Zhu G, Pfaffenbach K, Kanel G, Stiles B, Lee AS. GRP78 as a regulator of liver steatosis and cancer progression mediated by loss of the tumor suppressor PTEN. Oncogene. 2014;33:4997-5005.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 62]  [Cited by in RCA: 69]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
74.  Teodoro-Morrison T, Schuiki I, Zhang L, Belsham DD, Volchuk A. GRP78 overproduction in pancreatic beta cells protects against high-fat-diet-induced diabetes in mice. Diabetologia. 2013;56:1057-1067.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 42]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
75.  Jiang F, Ding Y, Tian Y, Yang R, Quan M, Tong Z, Zhang X, Luo D, Chi Z, Liu C. Hydrolyzed low-molecular-weight polysaccharide from Enteromorpha prolifera exhibits high anti-inflammatory activity and promotes wound healing. Biomater Adv. 2022;133:112637.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 61]  [Cited by in RCA: 43]  [Article Influence: 10.8]  [Reference Citation Analysis (0)]
76.  Ramesh HP, Tharanathan RN. Carbohydrates--the renewable raw materials of high biotechnological value. Crit Rev Biotechnol. 2003;23:149-173.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 125]  [Cited by in RCA: 76]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
77.  Du B, Yang Y, Bian Z, Xu B. Molecular weight and helix conformation determine intestinal anti-inflammatory effects of exopolysaccharide from Schizophyllum commune. Carbohydr Polym. 2017;172:68-77.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 79]  [Cited by in RCA: 62]  [Article Influence: 6.9]  [Reference Citation Analysis (0)]
78.  Sheng J, Sun Y. Antioxidant properties of different molecular weight polysaccharides from Athyrium multidentatum (Doll.) Ching. Carbohydr Polym. 2014;108:41-45.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 103]  [Cited by in RCA: 87]  [Article Influence: 7.3]  [Reference Citation Analysis (0)]
79.  Sun L, Wang C, Shi Q, Ma C. Preparation of different molecular weight polysaccharides from Porphyridium cruentum and their antioxidant activities. Int J Biol Macromol. 2009;45:42-47.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 315]  [Cited by in RCA: 240]  [Article Influence: 14.1]  [Reference Citation Analysis (1)]
80.  Zhou J, Hu N, Wu YL, Pan YJ, Sun CR. Preliminary studies on the chemical characterization and antioxidant properties of acidic polysaccharides from Sargassum fusiforme. J Zhejiang Univ Sci B. 2008;9:721-727.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 56]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
81.  Wang Q, Chen H, Yin M, Cheng X, Xia H, Hu H, Zheng J, Zhang Z, Liu H. In vitro digestion and human gut microbiota fermentation of Bletilla striata polysaccharides and oligosaccharides. Front Cell Infect Microbiol. 2023;13:1105335.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 23]  [Article Influence: 7.7]  [Reference Citation Analysis (0)]
Footnotes

Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade A, Grade B, Grade D

Novelty: Grade A, Grade B, Grade B

Creativity or Innovation: Grade A, Grade B, Grade B

Scientific Significance: Grade A, Grade B, Grade B

P-Reviewer: Chen LT; Ji CD S-Editor: Fan M L-Editor: A P-Editor: Zheng XM

Write to the Help Desk