BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Apr 28, 2025; 31(16): 104920
Published online Apr 28, 2025. doi: 10.3748/wjg.v31.i16.104920
Interventional effect of hesperetin on N-methyl-N’-nitro-N-nitrosoguanidine-induced exosomal circ008274 in affecting normal cells to promote gastric carcinogenesis
Zhao-Feng Liang, Xue-Zhong Xu, Wujin Institute of Molecular Diagnostics and Precision Cancer Medicine of Jiangsu University, Wujin Hospital Affiliated with Jiangsu University, Changzhou 213017, Jiangsu Province, China
Zhao-Feng Liang, Yu-Meng Xu, Jia-Jia Song, Zi-Han Gao, Hui Qian, Jiangsu Key Laboratory of Medical Science and Laboratory Medicine, School of Medicine, Jiangsu University, Zhenjiang 212013, Jiangsu Province, China
ORCID number: Zhao-Feng Liang (0000-0001-9799-0837).
Co-first authors: Zhao-Feng Liang and Yu-Meng Xu.
Co-corresponding authors: Zhao-Feng Liang and Xue-Zhong Xu.
Author contributions: Xu YM and Liang ZF wrote the manuscript; Xu YM, Song JJ, and Gao ZH conducted the data analyses; Xu YM prepared the figures; Xu XZ, Qian H, and Liang ZF contributed to the editing and revision of the manuscript; All authors reviewed the manuscript.
Supported by the National Natural Science Foundation of China, No. 81602883; Technology Development Project of Jiangsu University, No. 20220516; and Postgraduate Research and Practice Innovation Program of Jiangsu Province, No. KYCX233765.
Institutional review board statement: This study was exclusively focused on cellular research and did not involve animal models or human samples. This study was reviewed and approved by the Wujin Hospital Affiliated with Jiangsu University Institution Review Board.
Conflict-of-interest statement: The authors have no conflicts of interest to declare.
Data sharing statement: All data generated or analyzed in this study are included in this published article. Dataset available from the first author at liangzhaofeng@ujs.edu.cn. Participants gave informed consent for data sharing.
Corresponding author: Zhao-Feng Liang, MD, Doctor, Wujin Institute of Molecular Diagnostics and Precision Cancer Medicine of Jiangsu University, Wujin Hospital Affiliated with Jiangsu University, No. 2 Yongning North Road, Tianning District, Changzhou 213017, Jiangsu Province, China. liangzhaofeng@ujs.edu.cn
Received: January 10, 2025
Revised: February 25, 2025
Accepted: April 7, 2025
Published online: April 28, 2025
Processing time: 111 Days and 1.6 Hours

Abstract
BACKGROUND

Hesperetin, a flavonoid predominantly present in citrus fruits, exhibits significant intervention effects on both the initiation and progression of gastric cancer. However, the specific mechanisms underlying this effect remain unclear.

AIM

To investigate the interventional role of hesperetin on N-methyl-N’-nitro-N-nitrosoguanidine (MNNG)-induced exosomes in inducing gastric carcinogenesis.

METHODS

Bioinformatics technology was used to identify the critical molecular components underlying hesperetin-mediated inhibition of MNNG induced gastric carcinogenesis through exosomal circular RNA. Biological experiments were conducted to validate these findings.

RESULTS

Exosomes derived from TGES-1 cells (TGES-1-EX) significantly enhanced the proliferation, migration, invasion, epithelial-mesenchymal transition (EMT), and stemness of GES-1 cells. The oncogenic potential of TGES-1-EX was significantly diminished following hesperetin pretreatment. TGES-1-EX with overexpressed or knocked down circ0008274 was extracted and GES-1 cells were treated in combination with hesperetin or alone. Our investigation revealed that hesperetin exerted significant inhibitory effects on MNNG-induced gastric carcinogenesis by exosomal circ0008274. Bioinformatics prediction identified microRNA (miR)-526b-5p as a potential miRNA binding to circ0008274. Functional experiments demonstrated that hesperetin may mediate its intervention in MNNG-induced gastric cancer initiation by targeting miR-526b-5p through exosomal circ0008274. TGES-1-EX circ0008274 promoted the proliferation, EMT, and cancer stem cell-like characteristics in GES-1 cells through miR-526b-5p-mediated regulatory mechanisms.

CONCLUSION

Hesperetin exerted an interventional effect on the gastric carcinogenesis process, particularly through the modulation of exosomal circ0008274 and its interaction with miR-526b-5p.

Key Words: Hesperetin; Gastric cancer; N-methyl-N’-nitro-N-nitrosoguanidine; Exosomes; Circ0008274

Core Tip: Hesperetin, a citrus flavonoid, shows potential in inhibiting gastric cancer initiation and progression, but via unclear mechanisms. This study explored its role in countering N-methyl-N’-nitro-N-nitrosoguanidine-induced gastric carcinogenesis mediated by exosomal circular RNA. Bioinformatics and biological experiments revealed that exosomes from TGES-1 cells enhanced GES-1 cell proliferation, migration, invasion, epithelial-mesenchymal transition (EMT), and stemness, but hesperetin pretreatment significantly reduced these effects. Hesperetin targeted exosomal circ0008274, which interacts with microRNA-526b-5p, to inhibit cancer-inducing properties. Overexpression or knockdown of circ0008274 confirmed its role in promoting GES-1 cell proliferation, EMT, and stemness via miR-526b-5p. Hesperetin intervenes in gastric carcinogenesis by modulating the exosomal circ0008274/miR-526b-5p axis.



INTRODUCTION

Gastric cancer represents a global health challenge, ranking as the third most prevalent contributor to cancer mortality worldwide[1,2]. Epidemiological data particularly highlight its substantial prevalence across East Asian, with a significant disease burden in China[3,4]. Gastric carcinogenesis is a multifactorial process involving complex interactions among diet, Helicobacter pylori infection, environmental exposures, genetic predisposition, and chemical-induced precancerous lesions[5,6]. The clinical management of gastric cancer is further complicated by late-stage diagnosis in most patients, leading to unfavorable clinical outcomes and limited therapeutic efficacy[7]. These challenges underscore the critical need for developing reliable molecular biomarkers and implementing effective intervention strategies to enable early detection and improve treatment outcomes[8-10].

The occurrence and development of gastric cancer are closely associated with exposure to environmental carcinogens. Precancerous lesion of gastric cancer including gastric mucosal atrophy, intestinal metaplasia, and atypical hyperplasia, are histopathological changes that predispose to gastric cancer[11]. A widely recognized carcinogenic compound associated with gastric cancer and precancerous lesions is N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)[12,13]. MNNG is a common chemical substance, and the occurrence and development of gastric cancer in China is significantly correlated with the exposure to N-nitrosamine chemicals[14]. The precursors of N-nitrosamine, including nitrate, nitrite and amines, are widely distributed in various foods and the environment, particularly in vegetables, meat, dairy products and other daily foods[15,16]. They are carcinogenic substances that are difficult to completely avoid[15]. Previous studies have shown that MNNG can promote the progression of gastric cancer in vitro and in vivo[15,16]. MNNG has the capacity to elicit a range of cellular and biological effects, including induction of the epithelial-to-mesenchymal transition (EMT), abnormal cellular proliferation, tumorigenicity in nude mice, and the formation of precancerous lesions in the gastric tissues of rats or mice. Liang et al[17] found that chronic MNNG treatment suppresses autophagic activity in rats gastric tissues, concurrently facilitating EMT and enhancing cell proliferation while inhibiting the phosphatidylinositol 3-kinase (PI3K) and protein kinase B (AKT) pathway. MNNG is often used to construct gastric cancer cell models, which are essential for studying the disease mechanisms and progression[18]. In vitro studies often use MNNG concentrations in the range of 1-10 μmol/L to induce malignant transformation in cell cultures. In vivo studies may use slightly higher concentrations, but these are still relatively low, often in the range of 10-50 mg/L in drinking water or 1-10 mg/kg body weight through oral gavage or via other routes. Certainly, the dosage of MNNG will vary depending on the duration of exposure and specific experimental conditions.

Exosomes, ranging from 30 nm to 150 nm in diameter, represent a distinct class of membrane-bound extracellular vesicles actively released by various cell types[19]. Exosomes carry a complex molecular cargo comprising diverse biomolecules, such as nucleic acids, functional proteins, bioactive lipids, and metabolic products, which collectively reflect their cellular origin and functional status[20,21]. Due to their unique molecular composition and cell-specific characteristics, exosomes have emerged as promising candidates for minimally invasive diagnostic applications, particularly in the field of oncology, where they show significant potential for early detection and therapeutic monitoring of gastrointestinal malignancies, including gastric carcinoma[22]. Exosomes play a relatively important role in the occurrence and development of gastric cancer, and existing evidence shows that exosomes have an impact on the proliferation, migration, invasion, immune evasion and chemotherapy resistance of gastric cancer[23]. Circular guanosine monophosphate synthase gene (circGMPS), formed by reverse splicing of GMPS, played a significant role in the development and progression of gastric cancer. Zhang et al[24] found that the poor prognosis of patients with gastric cancer is related to the high expression of exosome-derived circGMPS, and which promotes malignant progression through microRNA-144-30 (miR-144-3p)/pumilio homolog 1 (PUM1) axis. CircGMP sponges miR-144-3p to regulate PUM1, thereby influencing the prognosis and malignant progression in patients with gastric cancer. Circular RNAs (circRNAs), a class of covalently closed single-stranded RNA molecules, are ubiquitously expressed across diverse cells[25]. Increasing evidence has illuminated the pivotal regulatory roles of circRNAs in the pathogenesis and progression of gastric cancer[6,26]. CircRNAs exert multifaceted oncogenic or tumor-suppressive functions through intricate molecular mechanisms, including but not limited to miRNA sponging, protein scaffolding, and transcriptional modulation, thereby influencing critical cancer hallmarks such as proliferative signaling, metastatic potential, cancer stemness, angiogenic processes, tumor immune microenvironment remodeling, and therapeutic resistance[27].

In recent years, natural phytochemicals have received much attention due to their potent anticancer activities[28-31]. Hesperetin is a flavonoid mainly found in citrus fruits[32,33] that exhibits a diverse array of pharmacological activities, particularly in modulating neoplastic processes, attenuating inflammatory responses, counteracting oxidative stress, and regulating lipid metabolism[17,34]. Hesperetin exerts anticancer effects by acting as a potent antioxidant, modulating cell proliferation and survival pathways, exerting pro-apoptotic effects, modulating inflammatory cascades, and inhibiting angiogenesis and metastatic dissemination processes. Hesperetin has also reportedly overcome multidrug-resistant tumor drugs, thereby improving defense mechanisms[34]. Hesperetin has great potential for clinical application due to its low toxicity and high bioavailability[17]. Hesperetin can interfere with the migration and invasion of gastric cancer cells and affect the activity of genes closely related to tumor metastasis. Mechanologically, hesperetin affects the stability of lysine methyltransferase DOT1 protein by regulating the activity of colostrum basic protein[35]. This finding highlights the epigenetic regulatory mechanisms of hesperetin, offering novel insights into the molecular pathways through which dietary flavonoids exert their antitumor effects.

Therefore, based on the malignant transformation model of GES-1 cells induced by long-term low-concentration MNNG exposure, this study employed various molecular biological techniques to investigate the intervention effect and the mechanism of hesperetin in MNNG promoting gastric carcinogenesis through exosomal circ0008274. Clarifying the mechanism of hesperetin intervention in the occurrence of gastric cancer and seeking therapeutic strategies for precancerous lesions are of great significance for improving the clinical application of hesperetin in the treatment of gastric cancer.

MATERIALS AND METHODS
Cell culture

The human gastric epithelial cell line GES-1 was commercially acquired from Shanghai Enzyme Research Biotechnology Co., Ltd. (Shanghai, China). GES-1 and TGES-1 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) high-glucose medium containing a mixture of 10% fetal bovine serum and 1% 100 U/mL penicillin-streptomycin mixture and placed in an incubator at 37 °C with 50 mL/L carbon dioxide. Cells were passaged when they reached a density of 80%-90%. A 0.01 mol/L MNNG storage solution was diluted in fresh DMEM culture medium to achieve a final concentration of 0 μmol/L and 1 μmol/L. Cells were continuously treated for approximately 30 passages. TGES-1 cells were treated with hesperetin (MedChemExpress, Monmouth Junction, NY, United States) to observe its intervention effect on gastric carcinogenesis.

Quantitative polymerase chain reaction assay

Total RNA was isolated from GES-1, TGES-1 and hesperetin-treated TGES-1 cells employing TRIzol reagent (Vazyme, Jiangsu Province, China). RNA quantification and quality assessment were conducted using the NanoDrop 1000 spectrophotometer. complementary DNA (cDNA) synthesis was carried out using the HiScript III 1st Strand cDNA synthesis kit (Vazyme), followed by quantitative polymerase chain (qPCR) analysis with the AceQ qPCR SYBR Green Master Mix (Vazyme) and Synbiotics-synthesized primers (Table 1). Relative gene expression levels were determined using the 2-ΔΔCt method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) serving as the internal reference.

Table 1 Primer sequences.
Genes
Primer sequence (5’-3’)
E-cadherinF: CGAGAGCTACACGTTCACGG
R: GGGTGTCGAGGGAAAAATAGG
N-cadherinF: CTCCACTTCCACCTCCACAT
R: GGACTCGCACCAGGAGTAAT
VimentinF: TCAATGTTAAGATGGCCCTTG
R: TGAGTGGGTATCAACCAGAGG
PCNAF: AACCTGCAGAGCATGGACTC
R: TCATTGCCGGCGCATTTTAG
NanogF: TTTGTGGGCCTGAAGAAAACT
R: AGGGCTGTCCTGAATAAGCAG
OCT4F: GGGAGATTGATAACTGGTGTGTT
R: GTGTATATCCCAGGGTGATCCTC
GAPDHF: CTTTGGTATCGTGGAAGGACTC
R: GTAGAGGCAGGGATGATGTTCT
Si1-circ0008274F: CAAGAUACAAGAUCUCCCCTT
R: GGGGAGAUCUUGUAUCUUGTT
Si2-circ0008274F: GAUACAAGAUCUCCCCAAUTT
R: AUUGGGGAGAUCUUGUAUCTT
U6F: CGCTTCGGCAGCACATATAC
R: TTCACGAATTTGCGTGTCATC
RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACAAAATA
MiR-4676-5pF: AAGCTGAGGAGCCAGTGGTGA
R: ATCCAGTGCAGGGTCCGAGG
RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACTCACTG
MiR-4733-3pF: AAGCACCCACCAGGTCTAGCA
R: ATCCAGTGCAGGGTCCGAGG
RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACATCCCA
MiR-5089-5pF: TCACGAGCGTGGGATTTCTGAG
R: ATCCAGTGCAGGGTCCGAGG
RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACGATGCT
MiR-526b-5pF: ACAGTAGCTCTTGAGGGAAGCAC
R: ATCCAGTGCAGGGTCCAGGG
RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACACAGAA
MiR-578F: CGCGGCACTTCTTGTGCTCT
R: ATCCAGTGCAGGGTCCGAGG
RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACACAATC
MiR-6077F: CAGTAGCGGGGAAGAGCTGTAC
R: ATCCAGTGCAGGGTCCGAGG
RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACGAAGGC
MiR-6513-5pF: ACAGTAGTTTGGGATTGACGCCA
R: ATCCAGTGCAGGGTCCAGGG
RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTG
GATACGACAGACAT
Cell Counting Kit-8 assay

Cells were seeded in 96-well plates at 1000 cells/well, and at least five multiple wells were seeded in each group and cultured in an incubator. The day after seeding, the Cell Counting Kit-8 (CCK-8) mixture prepared in advance was added (culture medium: CCK-8 solution = 9:1), and the CCK-8 solution was kept away from light. After culture for 3 hours, the absorbance (A) value at 450 nm wavelength was detected by microplate reader for four consecutive days. Growth curves were generated with cultivation time on the x-axis and absorbance values at 450 nm on the y-axis.

Cell colony formation assay

Each group of cells were seeded at 1000 cells/dish in 3.5 cm small dishes, and the culture was terminated when the cells grew to a cell colony formed by a single cell clone. Cell colonies were immobilized using 4% paraformaldehyde solution for 30 minutes at room temperature, followed by 5-minute staining with 0.1% crystal violet solution, and then photographed for recording.

Transwell assay

Log-phase cells were digested, and 3 × 104 cells/well were seeded in the upper chamber. Each group was inoculated into at least three chambers. Matrigel-coated chambers were used for invasion assays, while Matrigel uncoated chambers were used for migration assays. After 24 hours, the chambers were removed with forceps, the membranes of the chambers were gently washed with phosphate-buffered saline (PBS), and the chambers were fixed with 4% paraformaldehyde for 30 minutes. The lateral membrane of the chamber was washed gently with PBS and stained with crystal violet for 5 minutes. The membrane of the chamber was then gently rinsed with PBS. After drying, pictures were taken and recorded with an upright microscope and stored.

Western blot analysis

Gel preparation was conducted following the manufacturer’s protocol for the one-step PAGE Gel Fast Preparation Kit (Vazyme), with protein samples loaded into a 10-well comb configuration. The total protein extracted from each group of cells was separated using radio immunoprecipitation assay lysis buffer, followed by electrophoretic separation using sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The resolved proteins were then electrotransferred onto polyvinylidene difluoride membranes, which were subsequently blocked in 5% (w/v) non-fat dry milk in Tris-buffered saline with Tween 20 (TBST) under gentle agitation for 60 minutes at room temperature. The membranes were incubated overnight with primary antibodies and stored at 4 °C overnight. Then the membrane was washed three times with TBST for 5 minutes each, and incubated with secondary antibody for 1 hour at room temperature. After an additional three washes with TBST for 10 minutes each, proteins were visualized with a chemical gel analyzer, using an enhanced chemiluminescent substrate.

Exosome experiments

Exosome purification was achieved through a sequential centrifugation protocol. Cellular supernatants were initially centrifuged at 10000 × g for 30 minutes (4 °C), followed by membrane ultrafiltration and subsequent ultracentrifugation at 100000 × g for 2 hours (4 °C). The isolated exosomes were characterized using nanoparticle tracking analysis (NTA) for size distribution and concentration quantification, while structural morphology was examined by transmission electron microscopy. The purified exosome preparations were filtered through a 0.22 μm filter in an ultra-clean table to remove bacteria and fungi, packaged and stored at -80 °C.

Plasmid transfection

To validate the molecular interaction between circ0008274 and miR-526b-5p, we performed dual-luciferase reporter analysis. Specifically, recombinant plasmids incorporating either wild-type (WT) or mutant (MUT) miR-526b-5p binding sequences within the circ0008274 sequence were constructed. These constructs were subsequently co-transfected with either miR-526b-5p mimics or specific inhibitors into TGES-1 cells. Following a 48-hour incubation period, relative luciferase activity was quantified using a dual-luciferase reporter system. Notably, miR-526b-5p overexpression markedly suppressed the luciferase activity in cells transfected with the WT construct, whereas no significant alteration was observed in cells containing the MUT plasmid. These findings provide evidence for a direct and sequence-specific interaction between circ0008274 and miR-526b-5p at the predicted binding site.

Dual-luciferase reporter assay

The recombinant plasmids containing circ0008274-WT, circ0008274-MUT, miRNA mimics and corresponding negative controls, were designed and commercially synthesized by GenePharma Co., Ltd. (Suzhou, Jiangsu Province, China). Luciferase reporter assays were performed using the Dual-Luciferase® Reporter Assay System (Vazyme) in strict accordance with the manufacturer’s standardized protocol.

Statistical analyses

All of the experimental data involved in this study were statistically analyzed and plotted using SPSS 24.0 software (IBM SPSS Statistics, Armonk, NY, United States). All experiments were independently repeated three times (n = 3) to ensure the reliability of the results. The data are expressed as the mean ± SD. The t-test was used for comparison between two groups, and one-way analysis of variance was used for comparison between multiple groups.

RESULTS
Establishment of a cell malignant transformation model

According to our previous study and literature report[36], prolonged exposure of GES-1 cells to 1 μmol/L MNNG over 30 passages (approximately 70 days) resulted in the malignant transformation of these cells, and these transformed cells were named TGES-1 cells. In this study, we performed a simple validation of this cell model, as evidenced by increased proliferation, colony formation, migration, and invasion capabilities (Figure 1A-C). Western blotting and qPCR analyses demonstrated a significant downregulation of the epithelial marker E-cadherin and a marked upregulation of mesenchymal markers N-cadherin and vimentin, as well as stemness markers (Nanog and octamer-binding transcription factor 4 [OCT4]) and proliferation marker proliferating cell nuclear antigen (PCNA) (Figure 1D and E).These findings demonstrated that long-term MNNG exposure effectively induces malignant transformation in GES-1 cells, establishing a valuable cellular model for investigating the molecular mechanisms underlying MNNG-driven gastric carcinogenesis.

Figure 1
Figure 1 N-methyl-N’-nitro-N-nitrosoguanidine-induced malignant transformation of GES-1 cells. A: Cell Counting Kit-8 detection of the proliferative capacity of GES-1 cells following chronic N-methyl-N’-nitro-N-nitrosoguanidine (MNNG) exposure across 30 generations; B: Changes in the clonogenic capacity of MNNG-treated GES-1 cells; C: Alterations in the migratory invasive capacities of MNNG-treated GES-1 cells; D: Protein levels of epithelial-to-mesenchymal transition (EMT), stemness, and proliferative markers; E: mRNA levels of EMT, stemness, and proliferative markers. bP < 0.01. cP < 0.001. dP < 0.0001. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; OD: Optical density.
Hesperetin inhibits the proliferation, EMT, and stem cell characteristics of TGES-1 cells

TGES-1 cells were exposed to varying doses of hesperetin (5, 10, 25, 50, and 100 μmol/L) from MedChemExpress for 96 hours. Following cytotoxicity assessment using the CCK-8 assay, two effective concentrations (50 μmol/L and 100 μmol/L) were selected for subsequent experiments (Figure 2A). Subsequently, TGES-1 cells in logarithmic growth phase were treated with hesperetin at two concentrations of 50 μM and 100 μM for 96 hours. The cell growth curve demonstrated a significant reduction in proliferation ability (Figure 2B), along with markedly decreased colony formation, migration, and invasion capabilities (Figure 2C and D). Western blot and qPCR analyses revealed increased E-cadherin expression and decreased N-cadherin, vimentin, Nanog, OCT4, and PCNA expression (Figure 2E and F). These experimental data suggest that hesperetin exerts inhibitory effects on MNNG-induced malignant transformation of GES-1 cells, potentially playing a role in the mechanism underlying MNNG-mediated gastric carcinogenesis.

Figure 2
Figure 2 Intervention effect of hesperetin on TGES-1 cells. A: Cell Counting Kit-8 (CCK-8) detection of the survival rate of TGES-1 cells; B: CCK-8 detection of the proliferation ability of TGES-1 cells; C: Alteration of the clonogenic ability of TGES-1 cells; D: Alteration of the migratory and invasive abilities of TGES-1 cells; E: Protein levels of epithelial-to-mesenchymal transition (EMT), stemness, and proliferative markers; F: mRNA levels of EMT, stemness, and proliferative markers. aP < 0.05. bP < 0.01. cP < 0.001. dP < 0.0001. DMSO: Dimethyl sulfoxide; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; MNNG: N-methyl-N’-nitro-N-nitrosoguanidine; OD: Optical density.
Hesperetin exerts intervention effects on alterations in the biological characteristics of GES-1 cells mediated by TGES-1-derived exosomes

The morphology, particle size and markers of TGES-1 cell-derived exosomes and TGES-1 cells pretreated with 100 μmol/L hesperetin were characterized. The typical bilayer membrane structure of TGES-1 cell-derived exosomes and TGES-1 cells pretreated with 100 μmol/L hesperetin was observed by transmission electron microscopy (Figure 3A). NTA analysis showed average particle sizes of 165.4 nm for TGES-1-derived exosomes and 149.8 nm for hesperetin-pretreated TGES-1-derived exosomes (Figure 3B). Then the exosome surface marker proteins were detected by Western blotting. HSP70, TSG101, and Alix were positive in cells and exosomes, while calnexin was positive in cells and negative in exosomes (Figure 3C). After treatment with labeled exosomes for 24 hours, confocal microscopy showed that exosomes emitting red fluorescence could enter GES-1 cells (Figure 3D). Treatment of GES-1 cells with exosomes derived from TGES-1 cells (TGES-1-EX) for 72 hours significantly enhanced cell proliferation, as shown by the CCK-8 assay (Figure 3E). Additionally, TGES-1-EX promoted colony formation, migration, and invasion capabilities of GES-1 cells (Figure 3F and G), suggesting a potential role in MNNG-induced gastric carcinogenesis. Hes + TGES-1-EX interfered with the promoting effect of TGES-1-EX on the proliferation of GES-1 cells (Figure 3H). Consistent with the CCK-8 proliferation data (Figure 3I and J), functional assays including colony formation and transwell migration/invasion experiments revealed that hesperetin significantly attenuated the oncogenic effects mediated by TGES-1-derived exosomes. Hesperetin were found to interfere with the promoting effect of TGES-1-EX on the EMT, stemness and proliferation of GES-1 cells (Figure 3K and L). These results indicate that hesperetin plays a significant intervention role in the alteration of biological characteristics of normal gastric mucosal epithelial cells by TGES-1-EX and in the carcinogenesis of gastric cancer induced by MNNG.

Figure 3
Figure 3 Exosomes derived from TGES-1 cells promoted GES-1 cell proliferation, migration, and invasion. A: Transmission electron microscopy detected exosome morphology; B: Nanoparticle tracking analysis detected exosome particle size; C: Exosomal surface protein expression was characterized by Western blotting; D: 4’,6-diamidino-2-phenylindole blue fluorescence labeling of nuclei, Dil red fluorescence labeling of exosomes, and confocal microscopy showed that exosomes were taken up by GES-1 cells; E: Cell Counting Kit-8 detection of proliferative capacity of exosomes derived from TGES-1 cells (TGES-1-EX) after action on GES-1 cells; F: Clonogenic capacity of TGES-1-EX after action on GES-1 cells; G: Migration invasion ability of TGES-1-EX after action on GES-1 cells; H: Proliferative capacity after hesperetin-pretreated TGES-1-EX action on GES-1 cells; I: Clonogenic capacity of TGES-1 cells pretreated with hesperetin after action on GES-1 cells; J: Invasion and migration ability of GES-1 cells after treatment with exosomes; K: Protein levels of epithelial-to-mesenchymal transition (EMT), stemness, and proliferative markers; L: mRNA expression of EMT, stemness, and proliferative markers. aP < 0.05. bP < 0.01. cP < 0.001. dP < 0.0001. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; MNNG: N-methyl-N’-nitro-N-nitrosoguanidine; OD: Optical density.
Hesperetin suppresses circ0008274 expression in TGES-1 cells and exosomes

Bioinformatics analysis of differentially expressed circRNAs from Gene Expression Omnibus databases (GSE89143 and GSE83521) identified circ0008274 as a circRNA with low expression in gastric cancer tissues (Figure 4A and B). Circ0008274 is a circRNA looped from exons 37 and 38 of human chromosome 13 (Figure 4C). qPCR analysis confirmed the specificity of circ0008274 primers, as evidenced by a single peak in the melting curve and a single band of the expected size in agarose gel electrophoresis, indicating amplification from cDNA but not genomic DNA (Figure 4D and E). Furthermore, circ0008274 demonstrated significantly higher resistance to RNase R digestion compared to its linear counterpart GAPDH, indicating enhanced structural stability characteristic of circRNA molecules (Figure 4F). Nuclear and cytoplasmic separation experiments showed that circ0008274 was more present in the cytoplasm and a small amount in the nucleus in GES-1 and TGES-1 cells (Figure 4G). qPCR analysis showed that circ0008274 expression was significantly downregulated in TGES-1 cells compared to GES-1 cells, but its expression was restored following hesperetin treatment (Figure 4H). Similarly, circ0008274 levels were significantly reduced in TGES-1-EX, but hesperetin pretreatment increased circ0008274 expression in these exosomes (Figure 4I). Our results revealed a significant downregulation of circ0008274 expression in GES-1 cells following exposure to TGES-1-EX, while TGES-1-EX-mediated suppression was effectively reversed when cells treated with the hesperetin-pretreated TGES-1 cell exosomes (Figure 4J).

Figure 4
Figure 4 Identification of circ0008274 and its expression in cells and exosomes. A: Differently expressed circular RNAs (circRNAs) overlapping in public databases; B: Hierarchical clustering analysis of differentially expressed circRNAs as visualized in the heat map; C: Circ0008274 cyclisation mechanism; D: Cellular RNA and exosomes RNA quantitative polymerase chain reaction (qPCR) melting curves; E: Agarose gel electrophoresis; F: qPCR to detect before and after treatment with RNase R circ0008274 expression level; G: Nucleoplasmic separation to determine circ0008274 localization; H: Effect of hesperetin on the level of circ0008274 in cells; I: Modulatory effects of hesperetin on circ0008274 expression in exosomes; J: Expression of circ0008274 in exosomes derived from TGES-1 cells and hesperetin-pretreated TGES-1 cell exosomes after action on GES-1 cells. aP < 0.05. bP < 0.01. cP < 0.001. dP < 0.0001. cDNA: Complementary DNA; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; gDNA: Genomic DNA; TGES-1-EX: Exosomes derived from TGES-1 cells.

The aforementioned results indicate that we identified cir0008274, which is lowly expressed in gastric cancer tissues, through data screening. Subsequent validation revealed that cir0008274 is also expressed at low levels in both TGES-1 and TGES-1-EX. However, hesperetin was found to upregulate the expression of cir0008274 in TGES-1-EX. Additionally, we observed that treatment of GES-1 cells with TGES-1-EX suppressed the expression level of cir0008274 in GES-1 cells, and this suppression was reversed by hesperetin. We hypothesize that hesperetin may exert its intervention effect by regulating the expression of cir0008274 in the biological changes induced by TGES-1-EX in GES-1 cells.

Biological characteristic changes of GES-1 cells induced by exosomal circ0008274 were mediated by hesperetin

Following 48-hour lentiviral transduction in TGES-1 cells, the overexpression efficiency of circ0008274 was confirmed (Figure 5A). qPCR results suggested that the expression level of circ0008274 in the overexpression group was nearly 20-fold higher than that in the control group (Figure 5B). Both si-circ0008274 fragments reduced the expression level of circ0008274 to less than 50% in TGES-1 cells (Figure 5C). Hesperetin pretreatment significantly upregulated circ0008274 expression in TGES-1-derived exosomes, but this effect was not further enhanced when combined with circ0008274 overexpression (Figure 5D). Circ00008274 expression was significantly increased in exosomes pretreated with hesperetin. Notably, knocking down circ00008274 obviously inhibited the hesperetin-induced upregulation of circ00008274 expression (Figure 5D). Treatment of GES-1 cells with exosomes overexpressing circ0008274 or hesperetin-pretreated exosomes both significantly increased circ0008274 levels in GES-1 cells. However, when the overexpression and hesperetin treatment were combined, there was no statistically significant alterations in circ0008274 expression levels compared to the individual treatments (Figure 5E). Conversely, exosomes with circ0008274 knockdown significantly reduced circ0008274 levels in GES-1 cells, and this reduction was further enhanced when combined with hesperetin pretreatment (Figure 5E).

Figure 5
Figure 5 Hesperetin pretreatment of exosomes from overexpressed/knockdown circ0008274 TGES-1 cells action on GES-1 cells. A: Expression level of circ0008274 after transfection with overexpressing lentivirus; B: Level of circ0008274 in TGES-1 cells after puromycin screening; C: Expression of circ0008274 after TGES-1 transfection with small interfering RNA; D: Circ0008274 expression in exosomes of hesperetin pretreated overexpressing/knockdown circ0008274 TGES-1 cells; E: Circ0008274 expression after hesperetin pretreatment overexpression/knockdown of exosomes of circ0008274 TGES-1 cells acting on GES-1 cells; F: Changes in growth capacity of GES-1 cells treated with exosomes from different groups; G: Protein levels of epithelial-to-mesenchymal transition (EMT), stemness and proliferation markers in GES-1 cells treated with hesperetin and overexpression/knockdown circ0008274 exosomes derived from TGES-1 cells (TGES-1-EX); H: Changes in clonogenic capacity of GES-1 cells treated with exosomes from different groups; I: Changes in migration and invasion capacity of GES-1 cells treated with exosomes from different groups; J: mRNA expression of EMT, stemness and proliferation markers in GES-1 cells treated with hesperetin and overexpression/knockdown circ0008274 TGES-1-EX. aP < 0.05. bP < 0.01. cP < 0.001. dP < 0.0001. GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; LV: Lentivirus vector; NC: Negative control; OD: Optical density; OE: Overexpression; si-NC: Small interfering RNA negative control; si-NC-EX: Small interfering RNA negative control-exosome; TGES-1-EX: Exosomes derived from TGES-1 cells.

Furthermore, a series of functional experiments showed that the overexpression/knockdown of circ0008274 exosomes significantly inhibited/promoted the promoting effects of TGES-1-EX on the proliferation, colony formation, migration and invasion of GES-1 cells (Figure 5F-J). Exosomes with overexpression/knockdown of circ0008274 reduced/increased the expression of N-cadherin, vimentin, PCNA, OCT4, and Nanog. The expression of E-cadherin was increased/decreased, which was consistent with/opposite to the trend after hesperetin pretreatment of exosomes overexpressing circ00008274 TGES-1 cells acting on GES-1 cells, and the inhibitory effect of hesperetin and hesperetin combined treatment was not significantly different (Figure 5G and J). These results suggest that hesperetin may play an intervention role in MNNG-induced gastric carcinogenesis through exosome-mediated circ0008274.

Hesperetin attenuates MNNG-induced gastric carcinogenesis through exosomal circ0008274/miR-526b-5p ceRNA axis modulation

To explore the molecular mechanism of hesperetin intervention in MNNG induced exosomal circ0008274 to promote gastric cancer occurrence, we used bioinformatics methods to analyze. Both circ-interactome and circ-atlas databases showed that Argonaute 2 had binding ability with circ0008274 (Figure 6A), suggesting that circ0008274 might function as a competing endogenous RNA (ceRNA) through its miRNA sponge activity. The targets miRNA that bound to circ0008274 was predicted by circ-bank, circ-atlas databases and the intersection was taken (Figure 6B). qPCR analysis demonstrated a significant downregulation of miR-4676-5p expression concomitant with upregulation of miR-526b-5p in TGES-1 cells with knockdown of circ0008274 (Figure 6C). The level of miR-526-5p was found to be significantly downregulated in TGES-1 cells overexpressing circ0008274 (Figure 6D). The dual luciferase reporter gene vector containing circ0008274 and the complementary binding sequence for miR-526b-5p was designed and constructed. The experimental results demonstrated that miR-526b-5p markedly suppressed the fluorescence ratio of circ0008274-WT. However, there was no statistically significant variation in the fluorescence ratio between the group transfected with circ0008274-mut and miR-526b-5p mimics and the negative control group (Figure 6E), suggesting that miR-526b-5p was the target of circ0008274. The results showed that circ0008274 could act as a ceRNA by targeting miR-526b-5p and play the role of miRNA sponge.

Figure 6
Figure 6 Hesperetin mediated N-methyl-N’-nitro-N-nitrosoguanidine induced gastric cancer by targeting miR-526b-5p through exosomal circ0008274. A: Circlnteractome and circ-atlas databases showed that Argonaute 2 has the ability to bind to circ0008274; B: Circ-bank and circ-atlas databases predicted the microRNAs (miRNAs) that circ0008274 binds to and take the intersections; C: MiR-526b-5p was highly expressed and miR-4676-5p was lowly expressed after circ0008274 knockdown; D: MiR-526b-5p was lowly expressed after overexpression of circ0008274; E: Dual-luciferase reporter gene assay; F: Quantitative polymerase chain reaction detection of miR-526b-5p expression in cells and exosomes; G: MiR-526b-5p expression after transfection of miR-526b-5p mimics/inhibitor; H: Circ0008274 expression after transfection of miR-526b-5p mimics/inhibitor; I: Proliferative capacity of TGES-1 cells after treated with exosomes from different groups; J: Changes in clonogenic capacity of TGES-1 cells treated with exosomes from different groups; K: Changes in migration and invasion capacity of TGES-1 cells treated with exosomes from different groups. aP < 0.05. bP < 0.01. cP < 0.001. dP < 0.0001. EX: Exosome; LV: Lentivirus vector; MUT: Mutant; NC: Negative control; OD: Optical density; OE: Overexpression; si-NC: Small interfering RNA negative control; TGES-1-EX: Exosomes derived from TGES-1 cells; WT: Wild-type.

The results showed that miR-15b-5p was highly expressed in TGES-1 cells and exosomes (Figure 6F). Experimental data demonstrated that miR-526b-5p mimics and inhibitor significantly increased and decreased the level of miR-526b-5p, respectively (Figure 6G). It was found that the expression of circ0008274 was significantly decreased and increased after transfection of miR-526b-5p mimics and inhibitor in TGES-1 cells (Figure 6H). These results indicated that circ0008274 and miR-526b-5p had a competitive inhibition effect. Experimental results demonstrated that the clonogenic potential, migratory capacity, and invasive properties of GES-1 cells overexpressing circ0008274 were decreased after hesperetin-pretreated exosomes treated. After transfection of miR-526b-5p mimics, the clonogenic potential, migratory capacity, and invasive properties of GES-1 cells were enhanced compared with the group treated with hesperetin pretreatment exosomes and overexpression of circ0008274 in combination. Combination treatment of GES-1 cells with exosomes pretreated with hesperetin and knockdown of circ0008274, the experimental data demonstrated a significant enhancement in colony formation, migratory capacity, and invasive potential of GES-1 cells. However, following transfection with the miR-526b-5p inhibitor, these malignant phenotypes were markedly attenuated compared to the control group treated with hesperetin-pretreated exosomes and circ0008274 knockdown (Figure 6I-K). These results suggest that hesperetin can mediate exosomal circ0008274 to target miR-526b-5p and play an intervention role in MNNG-induced gastric carcinogenesis.

DISCUSSION

In this study, we primarily focused on the role of hesperetin in modulating exosomal circ0008274 to attenuate MNNG-induced gastric carcinogenesis. Our findings demonstrate that hesperetin upregulates circ0008274, which in turn inhibits miR-526b-5p, leading to the suppression of cell proliferation, EMT, and stemness in GES-1 cells. Firstly, a variety of experiments were used to study the intervention effect of hesperetin in the MNNG-induced gastric cancer initiation and malignant lesions by exosomes. Next, using bioinformatics analysis to screen for the key molecule circ0008274 transported by exosomes, TGES-1-EX with overexpression/knockdown circ0008274 were extracted to treated GES-1 cells. The results revealed the regulatory role of exosomal circ0008274 in MNNG induced gastric carcinogenesis. Hesperetin pretreatment enhanced the inhibition effect of exosomes with overexpression/knockdown of circ0008274 on GES-1 cells. Hesperetin played an intervention role in MNNG promoting gastric cancer by mediating exosome-derived circ0008274. Functional experiments showed that hesperetin play an intervention role in MNNG-promoted gastric carcinogenesis via exosomal circ0008274 by targeting miR-526b-5p.

Gastric cancer ranks as one of the most prevalent malignant tumors globally. Early gastric cancer often lacks symptoms and is typically diagnosed at advanced stages. Malignantly transformed cells and cancer cells play a facilitating role in the initiation and development of tumors such as gastric cancer by influencing the biological characteristics of normal cells such as EMT and abnormal cell proliferation[26,37]. EMT is a common cellular process whereby epithelial cells relinquishing their epithelial attributes while gaining mesenchymal characteristics[38]. The acquisition of EMT characteristics by normal cellular populations represents a critical early event in the multistep process of the carcinogenic process. The dysregulation of cellular proliferation of cells is also one of the characteristics of tumorigenesis including gastric cancer[39]. Therefore, this study elucidated whether the exosomes derived from malignantly transformed cells can promote MNNG-induced gastric carcinogenesis by influencing the biological characteristics of normal gastric mucosal epithelial cells, such as proliferation and EMT.

Notably, nitrite intake is a significant dietary factor contributing to gastric cancer[40]. MNNG it is frequently employed as a model to simulate the carcinogenesis of gastric mucosal cells induced by nitroso compounds[41]. Phytochemicals and some effective ingredients from natural sources exhibit excellent anti-tumor effects in tumors such as gastric cancer[28,42-44]. However, further research is needed to identify phytochemicals with early intervention effects in MNNG-induced gastric cancer. Our screening has revealed that hesperetin may possess significant intervention efficacy in MNNG-induced gastric cancer. Hesperidin exerted a significant inhibitory effect during the malignant transformation of GES-1 cells induced by MNNG exposure (Figure 2). However, further verification was necessary to determine whether hesperidin can inhibit the alteration of biological characteristics in normal gastric mucosal cells induced by malignantly transformed cells. Exosomes serve as essential mediators of intercellular communication, with their cargo of circRNAs actively participating in diverse biological processes and disease pathogenesis[45]. The results of our study demonstrated that exosomes derived from malignantly transformed cells (TGES-1) induced by MNNG enhance the proliferation, migration, and invasion capabilities of normal GES-1 cells. Pretreatment with hesperidin could interfere with and counteract the enhanced proliferation, migration, and invasion capabilities of GES-1 cells induced by exosomes from these malignantly transformed cells (Figure 3).

Further study we found that abnormal expression of circ0008274 in TGES-1 cells, TGES-1-EX, and exosomes treated with hesperetin. By treating GES-1 cells with exosomes that overexpress or knockdown circ0008274, either alone or in combination with hesperidin, the experimental results demonstrated that hesperidin may play an interventional role in modifying the biological characteristics of GES-1 cells induced by TGES-1-EX circ0008274 (Figure 5). Studies have found that circRNAs have a variety of functions such as binding miRNA or proteins, and play an important role in the occurrence and development of tumors[46,47]. Wu et al[48] found that the circ-protein arginine methyltransferase 5/miR-509-3p axis could aggravates the malignant characteristics of breast cancer cells by regulating the PI3K/AKT pathway. Circ0136666 stimulated gastric cancer progression and tumor immune escape by targeting miR-375 and regulating programmed cell death ligand 1[49]. It is reported that circular SR-related CTD associated factor 8 exerts oncogenic functions in gastric cancer by promoting tumor proliferation and metastatic spread via miR-1293 targeting[50]. Although many studies have reported that circRNAs affect tumor development and progression by targeting miRNAs, However, whether hesperetin can play an intervention role in MNNG promoting gastric carcinogenesis by mediating exosome-derived circRNAs targeting miRNAs is still unclear.

To explore the mechanism by which hesperidin interventions affect the MNNG-induced promotion of gastric carcinogenesis via exosomal circ0008274, we employed bioinformatics analysis and functional experiments, which revealed that circ0008274 can directly target and bind to miR-526b-5p. We treated normal GES-1 cells with TGES-1-EX, hesperidin, miRNA mimic, miRNA inhibitor, overexpress or knockdown circ0008274, respectively, to verify the intervention mechanism of hesperidin. The results showed that hesperetin played an intervention role in MNNG-induced gastric carcinogenesis by mediating exosomal circ0008274 and targeting miR-526b-5p (Figure 6). The hesperetin-modulated circ0008274/miR-526b-5p regulatory axis emerges as a promising therapeutic target for attenuating gastric cancer progression and offers novel insights into the management of gastric precancerous conditions.

CONCLUSION

Our current research explored the intervention effect of hesperetin in MNNG-promoted gastric carcinogenesis by mediating exosome-derived circ0008274 targeting miR-526b-5p. Our findings indicate that the hesperidin-mediated exosomes circ0008274/miR-526b-5p axis can serve as a potential target for slowing the onset of gastric cancer, presenting a novel approach for gastric cancer treatment and providing a scientific basis for the use of phytochemicals, such as hesperidin, in the management of gastric precancerous lesions.

References
1.  Smyth EC, Nilsson M, Grabsch HI, van Grieken NC, Lordick F. Gastric cancer. Lancet. 2020;396:635-648.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4042]  [Cited by in RCA: 3496]  [Article Influence: 582.7]  [Reference Citation Analysis (17)]
2.  Wu M, Yuan S, Liu K, Wang C, Wen F. Gastric Cancer Signaling Pathways and Therapeutic Applications. Technol Cancer Res Treat. 2024;23:15330338241271935.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 18]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
3.  Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209-249.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 76817]  [Cited by in RCA: 69976]  [Article Influence: 13995.2]  [Reference Citation Analysis (56)]
4.  Zhou D, Zuo J, Zeng C, Zhang L, Gao X, Li G, Wang X. Impact of body composition, grip strength, and physical performance on clinical outcomes for locally advanced gastric cancer during neoadjuvant chemotherapy: A prospective cohort study. Nutrition. 2024;125:112472.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Reference Citation Analysis (0)]
5.  Ko KP. Risk Factors of Gastric Cancer and Lifestyle Modification for Prevention. J Gastric Cancer. 2024;24:99-107.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 38]  [Article Influence: 19.0]  [Reference Citation Analysis (0)]
6.  Ma Q, Yang F, Xiao B, Guo X. Emerging roles of circular RNAs in tumorigenesis, progression, and treatment of gastric cancer. J Transl Med. 2024;22:207.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 15]  [Cited by in RCA: 14]  [Article Influence: 7.0]  [Reference Citation Analysis (1)]
7.  Guan WL, He Y, Xu RH. Gastric cancer treatment: recent progress and future perspectives. J Hematol Oncol. 2023;16:57.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 763]  [Cited by in RCA: 673]  [Article Influence: 224.3]  [Reference Citation Analysis (9)]
8.  Chen Y, Chen H, Zhang W, Ding Y, Zhao T, Zhang M, Mao G, Feng W, Wu X, Yang L. Bioaccessibility and biotransformation of anthocyanin monomers following in vitro simulated gastric-intestinal digestion and in vivo metabolism in rats. Food Funct. 2019;10:6052-6061.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 45]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
9.  Cassotta M, Cianciosi D, De Giuseppe R, Navarro-Hortal MD, Armas Diaz Y, Forbes-Hernández TY, Pifarre KT, Pascual Barrera AE, Grosso G, Xiao J, Battino M, Giampieri F. Possible role of nutrition in the prevention of inflammatory bowel disease-related colorectal cancer: A focus on human studies. Nutrition. 2023;110:111980.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 21]  [Reference Citation Analysis (2)]
10.  Afrin S, Haneefa SM, Fernandez-Cabezudo MJ, Giampieri F, Al-Ramadi BK, Battino M. Therapeutic and preventive properties of honey and its bioactive compounds in cancer: an evidence-based review. Nutr Res Rev. 2020;33:50-76.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 73]  [Article Influence: 10.4]  [Reference Citation Analysis (0)]
11.  Banks M, Graham D, Jansen M, Gotoda T, Coda S, di Pietro M, Uedo N, Bhandari P, Pritchard DM, Kuipers EJ, Rodriguez-Justo M, Novelli MR, Ragunath K, Shepherd N, Dinis-Ribeiro M. British Society of Gastroenterology guidelines on the diagnosis and management of patients at risk of gastric adenocarcinoma. Gut. 2019;68:1545-1575.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 524]  [Cited by in RCA: 476]  [Article Influence: 68.0]  [Reference Citation Analysis (13)]
12.  Liu T, Feng YL, Wang RY, Yang S, Ge YL, Zhang TY, Li J, Li CY, Ruan Y, Luo B, Liang GY. Long-term MNNG exposure promotes gastric carcinogenesis by activating METTL3/m6A/miR1184 axis-mediated epithelial-mesenchymal transition. Sci Total Environ. 2024;913:169752.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 19]  [Reference Citation Analysis (2)]
13.  Wang Q, Huang Y, Jiang M, Tang Y, Wang Q, Bai L, Yu C, Yang X, Ding K, Wang W, Bai J, Chen Y. The demethylase ALKBH5 mediates ZKSCAN3 expression through the m(6)A modification to activate VEGFA transcription and thus participates in MNNG-induced gastric cancer progression. J Hazard Mater. 2024;473:134690.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 8]  [Cited by in RCA: 29]  [Article Influence: 14.5]  [Reference Citation Analysis (1)]
14.  Lu L, Chen B, Zhang X, Xu Y, Jin L, Qian H, Liang ZF. The effect of phytochemicals in N-methyl-N-nitro-N-nitroguanidine promoting the occurrence and development of gastric cancer. Front Pharmacol. 2023;14:1203265.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 8]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
15.  Gunes-Bayir A, Guler EM, Bilgin MG, Ergun IS, Kocyigit A, Dadak A. Anti-Inflammatory and Antioxidant Effects of Carvacrol on N-Methyl-N'-Nitro-N-Nitrosoguanidine (MNNG) Induced Gastric Carcinogenesis in Wistar Rats. Nutrients. 2022;14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 47]  [Reference Citation Analysis (0)]
16.  Cui G, Wei F, Wei M, Xie L, Lin Z, Feng X. Modulatory effect of Tagetes erecta flowers essential oils via Nrf2/HO-1/NF-κB/p65 axis mediated suppression of N-methyl-N'nitro-N-nitroguanidine (MNNG) induced gastric cancer in rats. Mol Cell Biochem. 2021;476:1541-1554.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 20]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
17.  Liang Z, Song J, Xu Y, Zhang X, Zhang Y, Qian H. Hesperidin Reversed Long-Term N-methyl-N-nitro-N-Nitroguanidine Exposure Induced EMT and Cell Proliferation by Activating Autophagy in Gastric Tissues of Rats. Nutrients. 2022;14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 22]  [Article Influence: 5.5]  [Reference Citation Analysis (2)]
18.  Tong Y, Liu L, Wang R, Yang T, Wen J, Wei S, Jing M, Zou W, Zhao Y. Berberine Attenuates Chronic Atrophic Gastritis Induced by MNNG and Its Potential Mechanism. Front Pharmacol. 2021;12:644638.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 59]  [Cited by in RCA: 53]  [Article Influence: 10.6]  [Reference Citation Analysis (0)]
19.  Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science. 2020;367.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9106]  [Cited by in RCA: 8044]  [Article Influence: 1340.7]  [Reference Citation Analysis (13)]
20.  Wortzel I, Dror S, Kenific CM, Lyden D. Exosome-Mediated Metastasis: Communication from a Distance. Dev Cell. 2019;49:347-360.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1089]  [Cited by in RCA: 986]  [Article Influence: 140.9]  [Reference Citation Analysis (3)]
21.  Singh S, Paul D, Nath V, A R. Exosomes: current knowledge and future perspectives. Tissue Barriers. 2024;12:2232248.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 22]  [Article Influence: 11.0]  [Reference Citation Analysis (0)]
22.  Wang D, Li R, Jiang J, Qian H, Xu W. Exosomal circRNAs: Novel biomarkers and therapeutic targets for gastrointestinal tumors. Biomed Pharmacother. 2023;157:114053.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 21]  [Reference Citation Analysis (0)]
23.  Wu H, Fu M, Liu J, Chong W, Fang Z, Du F, Liu Y, Shang L, Li L. The role and application of small extracellular vesicles in gastric cancer. Mol Cancer. 2021;20:71.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 19]  [Cited by in RCA: 87]  [Article Influence: 17.4]  [Reference Citation Analysis (0)]
24.  Zhang Y, Xie W, Zheng W, Qian X, Deng C. Exosome-mediated circGMPS facilitates the development of gastric cancer cells through miR-144-3p/PUM1. Cytotechnology. 2024;76:53-68.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 7]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
25.  Vea A, Llorente-Cortes V, de Gonzalo-Calvo D. Circular RNAs in Blood. Adv Exp Med Biol. 2018;1087:119-130.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 38]  [Article Influence: 4.8]  [Reference Citation Analysis (0)]
26.  Liang Z, Fang S, Zhang Y, Zhang X, Xu Y, Qian H, Geng H. Cigarette Smoke-Induced Gastric Cancer Cell Exosomes Affected the Fate of Surrounding Normal Cells via the Circ0000670/Wnt/β-Catenin Axis. Toxics. 2023;11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 10]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
27.  Li J, Sun D, Pu W, Wang J, Peng Y. Circular RNAs in Cancer: Biogenesis, Function, and Clinical Significance. Trends Cancer. 2020;6:319-336.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 591]  [Cited by in RCA: 529]  [Article Influence: 88.2]  [Reference Citation Analysis (1)]
28.  Khan H, Belwal T, Efferth T, Farooqi AA, Sanches-Silva A, Vacca RA, Nabavi SF, Khan F, Prasad Devkota H, Barreca D, Sureda A, Tejada S, Dacrema M, Daglia M, Suntar İ, Xu S, Ullah H, Battino M, Giampieri F, Nabavi SM. Targeting epigenetics in cancer: therapeutic potential of flavonoids. Crit Rev Food Sci Nutr. 2021;61:1616-1639.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 58]  [Article Influence: 9.7]  [Reference Citation Analysis (1)]
29.  Ouyang Y, Qiu Y, Liu Y, Zhu R, Chen Y, El-Seedi HR, Chen X, Zhao C. Cancer-fighting potentials of algal polysaccharides as nutraceuticals. Food Res Int. 2021;147:110522.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 35]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
30.  Salama S, Shou Q, Abd El-Wahed AA, Elias N, Xiao J, Swillam A, Umair M, Guo Z, Daglia M, Wang K, Khalifa SAM, El-Seedi HR. Royal Jelly: Beneficial Properties and Synergistic Effects with Chemotherapeutic Drugs with Particular Emphasis in Anticancer Strategies. Nutrients. 2022;14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 25]  [Reference Citation Analysis (0)]
31.  Ding Q, Wu RA, Shi T, Yu Y, Yan Y, Sun N, Sheikh AR, Luo L, He R, Ma H. Antiproliferative effects of mealworm larvae (Tenebrio molitor) aqueous extract on human colorectal adenocarcinoma (Caco-2) and hepatocellular carcinoma (HepG2) cancer cell lines. J Food Biochem. 2021;45:e13778.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 15]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
32.  Kim HK, Jeong TS, Lee MK, Park YB, Choi MS. Lipid-lowering efficacy of hesperetin metabolites in high-cholesterol fed rats. Clin Chim Acta. 2003;327:129-137.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 150]  [Cited by in RCA: 140]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
33.  Liu J, Zhang X, Tian J, Li Y, Liu Q, Chen X, Feng F, Yu X, Yang C. Multiomics analysis reveals that peach gum colouring reflects plant defense responses against pathogenic fungi. Food Chem. 2022;383:132424.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 23]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
34.  Sohel M, Sultana H, Sultana T, Al Amin M, Aktar S, Ali MC, Rahim ZB, Hossain MA, Al Mamun A, Amin MN, Dash R. Chemotherapeutic potential of hesperetin for cancer treatment, with mechanistic insights: A comprehensive review. Heliyon. 2022;8:e08815.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 60]  [Article Influence: 15.0]  [Reference Citation Analysis (0)]
35.  Wang SW, Sheng H, Zheng F, Zhang F. Hesperetin promotes DOT1L degradation and reduces histone H3K79 methylation to inhibit gastric cancer metastasis. Phytomedicine. 2021;84:153499.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 26]  [Cited by in RCA: 35]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
36.  Zhang Y, Chen Z, Song J, Qian H, Wang Y, Liang Z. The role of m6A modified circ0049271 induced by MNNG in precancerous lesions of gastric cancer. Heliyon. 2024;10:e35654.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 5]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
37.  Nader GPF, Agüera-Gonzalez S, Routet F, Gratia M, Maurin M, Cancila V, Cadart C, Palamidessi A, Ramos RN, San Roman M, Gentili M, Yamada A, Williart A, Lodillinsky C, Lagoutte E, Villard C, Viovy JL, Tripodo C, Galon J, Scita G, Manel N, Chavrier P, Piel M. Compromised nuclear envelope integrity drives TREX1-dependent DNA damage and tumor cell invasion. Cell. 2021;184:5230-5246.e22.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 26]  [Cited by in RCA: 193]  [Article Influence: 38.6]  [Reference Citation Analysis (0)]
38.  Zhu Y, Huang C, Zhang C, Zhou Y, Zhao E, Zhang Y, Pan X, Huang H, Liao W, Wang X. LncRNA MIR200CHG inhibits EMT in gastric cancer by stabilizing miR-200c from target-directed miRNA degradation. Nat Commun. 2023;14:8141.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 67]  [Article Influence: 22.3]  [Reference Citation Analysis (0)]
39.  Zhou Q, Liu T, Qian W, Ji J, Cai Q, Jin Y, Jiang J, Zhang J. HNF4A-BAP31-VDAC1 axis synchronously regulates cell proliferation and ferroptosis in gastric cancer. Cell Death Dis. 2023;14:356.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 21]  [Cited by in RCA: 45]  [Article Influence: 15.0]  [Reference Citation Analysis (0)]
40.  Wang XQ, Terry PD, Yan H. Review of salt consumption and stomach cancer risk: epidemiological and biological evidence. World J Gastroenterol. 2009;15:2204-2213.  [PubMed]  [DOI]  [Full Text]
41.  Cai Y, Cao Y, Cheng S, Zou L, Yang T, Zhang Y, Shou Q, Chen B, Chen W. Study on the Mechanism of Sancao Tiaowei Decoction in the Treatment of MNNG-Induced Precancerous Lesions of Gastric Carcinoma Through Hedgehog Signaling Pathway. Front Oncol. 2022;12:841553.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 7]  [Reference Citation Analysis (0)]
42.  Mazzoni L, Giampieri F, Alvarez Suarez JM, Gasparrini M, Mezzetti B, Forbes Hernandez TY, Battino MA. Isolation of strawberry anthocyanin-rich fractions and their mechanisms of action against murine breast cancer cell lines. Food Funct. 2019;10:7103-7120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 43]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
43.  Wang K, Bai F, Zhou X, Wang J, Li Y, Xu H, Gao R, Wu H, Liu K, Zhao Y. Characterization of chondroitin sulfates isolated from large hybrid sturgeon cartilage and their gastroprotective activity against ethanol-induced gastric ulcers. Food Chem. 2021;363:130436.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 28]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
44.  Sun Y, Tang Z, Hao T, Qiu Z, Zhang B. Simulated Digestion and Fermentation In Vitro by Obese Human Gut Microbiota of Sulforaphane from Broccoli Seeds. Foods. 2022;11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 17]  [Reference Citation Analysis (0)]
45.  Wang N, Zheng Y, Zhang X, Xu SW, Li XH, Meng YL, Liu JQ. Roles of circ_0000135/miR-140-3p/PDZK1 network in cervical cancer. Clin Transl Oncol. 2022;24:1086-1099.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 6]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
46.  Zhang P, Dai M. CircRNA: a rising star in plant biology. J Genet Genomics. 2022;49:1081-1092.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 38]  [Article Influence: 9.5]  [Reference Citation Analysis (1)]
47.  Deng C, Huo M, Chu H, Zhuang X, Deng G, Li W, Wei H, Zeng L, He Y, Liu H, Li J, Zhang C, Chen H. Exosome circATP8A1 induces macrophage M2 polarization by regulating the miR-1-3p/STAT6 axis to promote gastric cancer progression. Mol Cancer. 2024;23:49.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 134]  [Reference Citation Analysis (0)]
48.  Wu D, Jia H, Zhang Z, Li S. Circ-PRMT5 promotes breast cancer by the miR-509-3p/TCF7L2 axis activating the PI3K/AKT pathway. J Gene Med. 2021;23:e3300.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 31]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
49.  Miao Z, Li J, Wang Y, Shi M, Gu X, Zhang X, Wei F, Tang X, Zheng L, Xing Y. Hsa_circ_0136666 stimulates gastric cancer progression and tumor immune escape by regulating the miR-375/PRKDC Axis and PD-L1 phosphorylation. Mol Cancer. 2023;22:205.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 33]  [Cited by in RCA: 87]  [Article Influence: 29.0]  [Reference Citation Analysis (1)]
50.  Mei B, Chen J, Peng Y. The circRNA circSCAF8 promotes tumor growth and metastasis of gastric cancer via miR-1293/TIMP1signaling. Gene Ther. 2025;32:142-153.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 4]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade A, Grade A, Grade A, Grade A, Grade B

Novelty: Grade A, Grade A, Grade A, Grade A, Grade B

Creativity or Innovation: Grade A, Grade A, Grade A, Grade B, Grade B

Scientific Significance: Grade A, Grade A, Grade A, Grade B, Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Al-Nimer MSM; Pan ZJ; Zhu MM S-Editor: Fan M L-Editor: Filipodia P-Editor: Zheng XM

Write to the Help Desk