Published online Jan 21, 2017. doi: 10.3748/wjg.v23.i3.455
Peer-review started: August 22, 2016
First decision: October 10, 2016
Revised: November 9, 2016
Accepted: December 16, 2016
Article in press: December 19, 2016
Published online: January 21, 2017
Processing time: 148 Days and 21.1 Hours
To investigate the abundance and potential functions of LAP+CD4+ T cells in colorectal cancer (CRC).
Proportions of LAP+CD4+ T cells were examined in peripheral blood and tumor/paratumor tissues of CRC patients and healthy controls using flow cytometry. Expression of phenotypic markers such as forkhead box (Fox)p3, cytotoxic T-lymphocyte-associated protein (CTLA)-4, chemokine CC receptor (CCR)4 and CCR5 was measured using flow cytometry. LAP-CD4+ and LAP+CD4+ T cells were isolated using a magnetic cell-sorting system and cell purity was analyzed by flow cytometry. Real-time quantitative polymerase chain reaction was used to measure expression of cytokines interleukin (IL)-10 and transforming growth factor (TGF)-β.
The proportion of LAP+CD4+ T cells was significantly higher in peripheral blood from patients (9.44% ± 3.18%) than healthy controls (1.49% ± 1.00%, P < 0.001). Among patients, the proportion of LAP+CD4+ T cells was significantly higher in tumor tissues (11.76% ± 3.74%) compared with paratumor tissues (3.87% ± 1.64%, P < 0.001). We also observed positive correlations between the proportion of LAP+CD4+ T cells and TNM stage (P < 0.001), distant metastasis (P < 0.001) and serum level of carcinoembryonic antigen (P < 0.05). Magnetic-activated cell sorting gave an overall enrichment of LAP+CD4+ T cells (95.02% ± 2.87%), which was similar for LAP-CD4+ T cells (94.75% ± 2.76%). In contrast to LAP-CD4+ T cells, LAP+CD4+ T cells showed lower Foxp3 expression but significantly higher levels of CTLA-4, CCR4 and CCR5 (P < 0.01). LAP+CD4+ T cells expressed significantly larger amounts of IL-10 and TGF-β but lower levels of IL-2, IL-4, IL-17 and interferon-γ, compared with LAP-CD4+ T cells.
LAP+CD4+ T cells accumulated in the tumor microenvironment of CRC patients and were involved in immune evasion mediated by IL-10 and TGF-β.
Core tip: Many carcinomas, including colorectal cancer, gastric and nasopharyngeal cancer, are associated with elevated numbers of T regulatory (Treg) cells. It is suggested that Treg cells promote tumor development and metastasis by inhibiting the proliferation of effector T lymphocytes. LAP+CD4+ T cells, a recently identified subset of CD4+ Treg cells, have 50-fold more potent immunosuppressive ability than traditional CD4+CD25+ T cells. Here, we present several lines of evidence correlating LAP+CD4+ T cells with colorectal cancer progression.
- Citation: Zhong W, Jiang ZY, Zhang L, Huang JH, Wang SJ, Liao C, Cai B, Chen LS, Zhang S, Guo Y, Cao YF, Gao F. Role of LAP+CD4+ T cells in the tumor microenvironment of colorectal cancer. World J Gastroenterol 2017; 23(3): 455-463
- URL: https://www.wjgnet.com/1007-9327/full/v23/i3/455.htm
- DOI: https://dx.doi.org/10.3748/wjg.v23.i3.455
Core tip: Many carcinomas, including colorectal cancer, gastric and nasopharyngeal cancer, are associated with elevated numbers of T regulatory (Treg) cells. It is suggested that Treg cells promote tumor development and metastasis by inhibiting the proliferation of effector T lymphocytes. LAP+CD4+ T cells, a recently identified subset of CD4+ Treg cells, have 50-fold more potent immunosuppressive ability than traditional CD4+CD25+ T cells. Here, we present several lines of evidence correlating LAP+CD4+ T cells with colorectal cancer progression.
Colorectal cancer (CRC) is the third most common carcinoma in men and second most common in women, with > 1 million new cases and > 500000 deaths every year worldwide[1,2]. CRC progression is a complex process involving interactions between host cellular immunity factors and the tumor, which take place in the so-called tumor microenvironment[3,4]. This environment includes numerous factors that promote tumor growth, such as energy and nutrients in blood vessels, growth factors from immune cells and stromal cells, and proinflammatory mediators secreted by tumor cells[5]. The environment also contains numerous factors that can limit tumor growth, such as tumor-infiltrating immune cells and tertiary lymphoid structures[6]. This complex mixture of factors largely determines patient prognosis and serves as an attractive therapeutic target[6,7].
Several studies have suggested that during CRC progression, peripheral regulatory T (Treg) cells and myeloid suppressor cells increase in the tumor microenvironment, which is associated with worse prognosis[8-10]. Part of the reason appears to be that these cell populations counteract the host's antitumor immune response[11]. Downregulating Treg cells can render antitumor responses more effective, which may improve prognosis in patients with CRC and other malignant carcinomas[12].
LAP+CD4+ T cells are a newly identified subset of Treg cells that express latent-associated peptide (LAP), and function within the latent transforming growth factor (TGF)-β complex to block interaction between TGF-β and receptors on immune cells[13]. Among the various Treg cell populations, LAP+CD4+ T cells are endowed with more potent immunosuppressive function than traditional CD4+CD25+Foxp3+ Treg cells[14], and they are associated with autoimmune disease progression[13,15-17]. However, we are unaware of studies examining whether LAP+CD4+ T cells contribute to CRC progression. Thus, we analyzed the abundance, phenotype and cytokine secretion of LAP+CD4+ T cells in the tumor microenvironment in patients with CRC.
All patients enrolled in this study provided written informed consent. The study protocol conformed to the ethical guidelines of the Declaration of Helsinki (Fortaleza, Brazil; October 2013), and it was approved by the Research Ethics Committee of the First Affiliated Hospital of Guangxi Medical University, China.
This study involved 50 patients who underwent primary tumor resection for colorectal adenocarcinoma at the First Affiliated Hospital of Guangxi Medical University from January to August 2014. Samples of peripheral blood were obtained preoperatively, and colorectal tumor and paratumor tissues were obtained postoperatively from each patient. Paratumor tissue samples were taken from tissue near the resection margin (≥ 10 cm away from the tumor site) that was confirmed to be tumor-free based on routine pathology. The basic data regarding the study population are shown in Table 1.
| Characteristics | Value1 |
| Male | 31 |
| Female | 19 |
| Age, yr | 57.4 (37-76) |
| Location of primary tumor | |
| Colon | 22 |
| Rectum | 28 |
| TNM stage | |
| I/II | 23 |
| III/IV | 27 |
Patients were excluded if they (1) had already undergone CRC surgery or had been diagnosed with locoregional recurrence; or (2) were receiving any anticancer therapy, corticosteroids or other nonsteroidal anti-inflammatory drugs at the time of peripheral venous blood collection.
During the study period, peripheral blood was also collected from 25 healthy donors serving as a control group. Healthy controls were free of chronic pain, cardiovascular complaints, or other chronic inflammatory diseases. They were matched with patients in age and sex and showed no significant differences from patients.
Peripheral blood mononuclear cells (PBMCs) were isolated from patients using Ficoll density gradient centrifugation. Fresh tumor and paratumor samples were washed three times in RPMI 1640; after which, fatty, connective and necrotic tissues were removed. Samples were cut into 1-2-mm cubes, transferred to a 50-mL beaker, and incubated for 3 h at room temperature with a triple-enzyme digestion medium containing 1 mg/mL collagenase IV, 30 μg/mL DNase I and 0.1 mg/mL hyaluronidase (Sigma, St. Louis, MO, United States). Dissociated cell suspensions were filtered through a 70-μm nylon mesh, then tumor-infiltrating lymphocytes (TILs) were isolated from cell suspensions using discontinuous density gradient centrifugation[18]. LAP-CD4+ T cells and LAP+CD4+ T cells were isolated using a Magnetic cell sorting system (Miltenyi Biotec, Bergisch Gladbach, Germany). Cell purity was analyzed by flow cytometry as described below.
TILs and PBMCs were stimulated in culture for 4 h at 37 °C with 50 ng/mL phorbol-12-myristate-13-acetate, 1 μg/mL ionomycin, and 0.7 μl/mL GolgiStop reagent in a 5% CO2 incubator. T cells were identified based on surface or intracellular expression of markers labeled using antibodies (eBioscience, San Diego, CA, United States) against the following human antigens: LAP, CD4, forkhead box (Fox)p3, cytotoxic T-lymphocyte-associated protein (CTLA)-4, chemokine CC receptor (CCR)4, and CCR5. Antibodies were conjugated with one of the following fluorophores: phycoerythrin (PE), fluorescein isothiocyanate, PEcy5.5, PEcy7, peridinin chlorophyll protein (PerCP)-cy5.5, or allophycocyanin. Labeled cell suspensions were analyzed using a FACS Calibur flow cytometer (BD Bioscience, Franklin Lakes, NJ, United States) and FlowJo software (Tree Star, Ashland, OR, United States).
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, United States), and first-strand cDNA was generated using oligo (dT) primers and the SuperScript III First-Strand Synthesis System (Invitrogen). Levels of mRNAs encoding cytokines secreted by LAP+CD4+ T cells and LAP-CD4+ T cells (TGF-β, INF-γ, IL-2, IL-4, IL-10 and IL-17) were determined using SYBR-based real-time polymerase chain reaction (7500 StepOnePlus system, Applied Biosystems, Carlsbad, CA, United States) and primers purchased from TaKaRa Biosystems (Table 2). Relative expression levels were calculated using the 2-ΔΔCT method and normalized to levels of β-actin mRNA.
| Gene | Sequence (5’-3’) | Product (bp) | T (°C) |
| IL-2 | F:5’ CAGCTACAACTGGAGCATTTAC | 130 | 60 |
| R:5’ TCAGTTCTGTGGCCTTCTTG | |||
| IL-4 | F:5’ GACCGTAACAGACATCTTTGC | 180 | 60 |
| R:5’ TCGAGCCGTTTCAGGAAT | |||
| IL-10 | F:5’ TTGCCAAGCCTTGTCTGA | 160 | 60 |
| R:5’ ACAGGGAAGAAATCGATGAC | |||
| IL-17 | F:5’ CCTCAGAGATCAACAGACCAA | 80 | 60 |
| R:5’ GGTGCCTTGATCAGACAGAA | |||
| IFN-g | F:5’ GGCAAGGCTATGTGATTACA | 180 | 60 |
| R:5’ TAAAGCACTGGCTCAGATTG | |||
| TGF-β1 | F:5’ CACGTGGAGCTGTACCAGAA | 219 | 60 |
| R:5’ GAACCCGTTGATGTCCACTT | |||
| 18srRNA | F:5’ CCTGGATACCGCAGCTAGGA | 112 | 60 |
| R:5’ GCGGCGCAATACGAATGCCCC |
Data were expressed as mean ± SD. Differences between two groups were assessed for significance using the Mann-Whitney U test, t-test, or paired t-test, as appropriate. All statistical tests were performed using SPSS version 16.0 (SPSS, Chicago, IL, United States), and the threshold of significance was defined as P < 0.05.
PBMCs were isolated preoperatively and TILs were isolated postoperatively from patients who underwent radical resection for CRC. To understand further the roles of LAP+CD4+ T cells in the tumor microenvironment in patients with CRC, the proportion of LAP+CD4+ T cells in PBMCs and tissues was detected by flow cytometry (Figure 1). The proportion of LAP+CD4+ T cells was significantly higher in peripheral blood from patients (9.44% ± 3.18%) than healthy controls (1.49% ± 1.00%, P < 0.001; Figure 1B and C). Among CRC patients, the proportion of LAP+CD4+ T cells was significantly higher in tumor tissue (11.76% ± 3.74%) compared with paratumor tissue (3.87% ± 1.64%, P < 0.001; Figure 1B and D).
We also observed positive correlations between the proportion of LAP+CD4+ T cells and TNM stage (P < 0.001; Figure 2A), distant metastasis (P < 0.001; Figure 2B) and serum level of carcinoembryonic antigen (CEA) (P < 0.05; Figure 2C) (Table 3).
| n | LAP+CD4+ Treg (%) | t | P value | 95%CI | |
| Age, yr | |||||
| < 60 | 29 | 11.15 ± 2.03 | 0.747 | 0.458 | -1.35-2.94 |
| ≥ 60 | 21 | 11.96 ± 4.51 | |||
| Sex | |||||
| Male | 31 | 11.37 ± 3.24 | 0.444 | 0.659 | -1.60-2.50 |
| Female | 19 | 11.82 ± 3.89 | |||
| Location | |||||
| Colon | 22 | 10.35 ± 3.45 | 0.652 | 0.517 | -1.11-2.18 |
| Rectum | 28 | 11.89 ± 3.17 | |||
| TNM stage | |||||
| I/II | 23 | 8.45 ± 2.98 | 4.973 | 0.000 | 3.85-9.07 |
| III/IV | 27 | 14.90 ± 5.58 | |||
| Pathological pattern | |||||
| Tubular/ papillary | 43 | 11.09 ± 3.54 | 1.335 | 0.188 | -0.73-3.60 |
| Myxoma/ ring cell | 7 | 12.83 ± 3.26 | |||
| Differentiation | |||||
| High | 42 | 10.50 ± 3.22 | 0.877 | 0.385 | -1.45-3.70 |
| Low | 8 | 12.43 ± 3.87 | |||
| Metastasis | |||||
| Yes | 9 | 12.51 ± 4.17 | 4.322 | 0.000 | 2.49-6.82 |
| No | 41 | 7.85 ± 2.61 | |||
| Ileus | |||||
| Yes | 9 | 12.22 ± 3.49 | 0.904 | 0.470 | -1.30-3.44 |
| No | 41 | 11.15 ± 3.14 | |||
| CEA (ng/mL) | |||||
| ≤ 5 | 34 | 9.94 ± 3.15 | 2.692 | 0.010 | 0.81-5.58 |
| > 5 | 16 | 13.13 ± 4.06 | |||
| CA199 (U/mL) | |||||
| ≤ 37 | 32 | 11.34 ± 3.21 | 0.854 | 0.370 | -1.51-3.85 |
| > 37 | 18 | 12.42 ± 4.35 |
Further studies of phenotypic marker expression revealed differences between LAP+CD4+ T cells and LAP-CD4+ T cells. In contrast to LAP-CD4+ T cells, LAP+CD4+ T cells showed lower Foxp3 expression but significantly higher levels of CTLA-4, CCR4 and CCR5 (P < 0.01; Figures 3 and 4).
Magnetic-activated cell sorting gave an overall enrichment of LAP+CD4+ T cells (95.02% ± 2.87%; Figure 3A) and enrichment was similar for LAP-CD4+ T cells (94.75% ± 2.76%; Figure 3B).
The expression levels of cytokine profiles were measured by real-time qPCR, LAP+CD4+ T cells expressed significantly larger amounts of IL-10 and TGF-β but lower levels of IL-2, IL-4, IL-17 and IFN-γ, compared with LAP-CD4+ T cells (Table 4).
| IL-2 | IL-4 | IL-10 | IL-17 | IFN-g | TGF-β | |
| LAP+CD4+ | 0.22 ± 0.01 | 0.32 ± 0.12 | 1.13 ± 0.23 | 0.38 ± 0.10 | 0.18 ± 0.08 | 1.40 ± 0.15 |
| LAP-CD4+ | 1.49 ± 0.37 | 0.86 ± 0.23 | 0.86 ± 0.22 | 0.98 ± 0.23 | 0.69 ± 0.21 | 0.89 ± 0.11 |
| t | 8.811 | 5.505 | -2.327 | 6.435 | 5.981 | -7.316 |
| P value | 0.000 | 0.000 | 0.038 | 0.000 | 0.000 | 0.000 |
Many carcinomas, including colorectal, gastric and nasopharyngeal cancer, are associated with elevated numbers of Treg cells[19-21], and it is suggested that Treg cells promote tumor development and metastasis by inhibiting the proliferation of effector T lymphocytes[22]. LAP+CD4+ T cells, a recently identified subset of CD4+ Treg cells, have 50-fold more potent immunosuppressive activity than traditional CD4+CD25+ T cells[13,23]. Here we present several lines of evidence correlating LAP+CD4+ T cells with CRC progression. These cells were more abundant in peripheral blood and tumor tissue from patients with CRC compared with healthy controls. In CRC patients, the abundance of these cells correlated positively with TNM stage, metastasis, and serum level of CEA. CEA is the most widely used serum marker and is related to the prognosis of patients with CRC. The main use of CEA in CRC is in surveillance following curative resection for primary cancer[24,25]. These results suggest that LAP+CD4+ T cells, like traditional CD4+CD25+ Treg cells, accumulate in the tumor microenvironment and postoperative monitoring of the LAP+CD4+ T cells in CRC patients may be useful for assessing prognosis and predicting distant metastasis.
In our study, expression of CCR4 and CCR5 was higher in LAP+CD4+ T cells than in LAP-CD4+ T cells. CCR4 and CCR5 are highly expressed in tumor microenvironments and appear to act as proinflammatory cytokine receptors[26,27]. Some studies have reported that CCR4 and its ligands are associated with increased tumor recurrence and impaired overall survival in patients with gastric cancer[28,29]. Wang et al[30] have shown that the CCL5/CCR5 axis modulates angiogenesis and metastasis that dictate cancer development in the tumor microenvironment. We identified similarities and differences between LAP+CD4+ T cells and traditional CD4+CD25+ Treg cells. Foxp3, previously identified as important in the differentiation and development of Treg cells[31,32], was expressed at detectable levels in only 4% of LAP+CD4+ T cells. This means that LAP+CD4+ T cells differ from traditional CD4+CD25+ Treg cells in marker expression and their immunosuppressive activity is independent of Foxp3. In contrast, LAP+CD4+ T cells expressed abundant levels of CTLA-4, which is used by CD4+CD25+ Treg cells to modulate immune responses[33]. CTLA-4 on CD4+CD25+ Treg cells has been shown to suppress immune function through several mechanisms[34,35]: increasing numbers of CD4+CD25+ CTLA-4 T cells; inhibiting production of proinflammatory factors such as IFN-γ; increasing production of IL-2, IL-4, IL-10 and TGF-β1; and blocking tryptophan synthesis by antigen-presenting cells[36]. Under normal circumstances, these mechanisms can promote self-tolerance and prevent autoimmune disease and transplant rejection. Our results suggest that the CTLA-4 on LAP+CD4+ T cells help CRC tumors evade the host immune system, and one mechanism may be by inhibiting proliferation of effector T lymphocytes.
Our results reproduce most of those of Mahalingam et al[37], using different procedures. We isolated LAP+CD4+ T cells and LAP-CD4+ T cells using a magnetic cell sorting system and analyzed cell purity by flow cytometry. Our results revealed that, after sorting, the purity of these two cells was > 90%. This is the first time that LAP+CD4+ T cells were isolated using a magnetic cell sorting system. In contrast to Mahalingam et al[37], we found that LAP+CD4+ T cells expressed high levels of IL-10 and TGF-β. These cytokines play key roles in suppressing immune responses in mouse models of cerebral meningitis and allergic inflammation[13,38,39]. The immunoregulatory activity of Treg cells has been linked to several molecules, such as CTLA-4, TGF-β, and IL-10[40,41]. TGF-β has been shown to play an important role in the differentiation, maintenance and function of natural Treg cells[42-45]. However, several studies have revealed the role of IL-10 in Treg cell suppression. It has been demonstrated that IL-10 is required for the homeostatic maintenance of the T cell number by Treg cells[46] and is involved in Treg-cell-mediated suppression in murine models of transplantation, graft-versus-host disease, chronic parasite infection, colitis, and a rat model of type 1 diabetes[47]. Like classical CD4+CD25+ Treg cells, our experiments suggest that the immunosuppressive activity of LAP+CD4+ T cells could be mediated by IL-10 and TGF-β.
In conclusion, we provide evidence that patients with CRC have elevated proportions of LAP+CD4+ T cells in the peripheral blood and tumor microenvironment, and their accumulation at tumor sites correlates with CEA level, TNM stage and distant metastasis. LAP+CD4+ T cells express high levels of IL-10 and TGF-β, which may be involved in tumor immune evasion. Our findings suggest that investigating the functions and regulation of LAP+CD4+ T cells in CRC may improve our understanding of disease progression and treatment.
LAP+CD4+ T cells are a newly identified subset of regulatory T (Treg) cells that express latent-associated peptide (LAP). They function within the latent transforming growth factor (TGF)-β complex to block interaction between TGF-β and receptors on immune cells, of the various Treg cell populations, LAP+CD4+ T cells are endowed with more potent immunosuppressive function than traditional CD4+CD25+Foxp3+ Treg cells, and they have been associated with autoimmune disease progression. However, they are unaware of any studies examining whether LAP+CD4+ T cells contribute to colorectal cancer (CRC) progression. Thus, The authors analyzed the abundance, phenotype and cytokine secretion of LAP+CD4+T cells in the tumor microenvironment in patients with CRC.
This is the first time that LAP+CD4+ T cells were isolated by using magnetic cell sorting system.
The authors found that LAP+CD4+ T cells accumulated in the tumor microenvironment of CRC patients and were involved in immune evasion mediated by interleukin-10 and TGF-β.
These findings suggest that investigating the functions and regulation of LAP+CD4+ T cells in CRC may improve our understanding of disease progression and treatment.
LAP+CD4+ T cells are a newly identified subset of Treg cells that express LAP, and function within the latent TGF-β complex to block interaction between TGF-β and receptors on immune cells. CRC progression is a complex process involving interactions between host cellular immunity factors and the tumor, which take place in the so-called tumor microenvironment.
"The role of LAP+CD4+ T cells in the tumor microenvironment of colorectal cancer" from Zhong et al is a decent and interesting manuscript, and worthy to be published.
| 1. | Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin. 2014;64:9-29. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 8498] [Cited by in RCA: 9337] [Article Influence: 778.1] [Reference Citation Analysis (8)] |
| 2. | Siegel R, Desantis C, Jemal A. Colorectal cancer statistics, 2014. CA Cancer J Clin. 2014;64:104-117. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1811] [Cited by in RCA: 2026] [Article Influence: 168.8] [Reference Citation Analysis (9)] |
| 3. | Sautès-Fridman C, Cherfils-Vicini J, Damotte D, Fisson S, Fridman WH, Cremer I, Dieu-Nosjean MC. Tumor microenvironment is multifaceted. Cancer Metastasis Rev. 2011;30:13-25. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 98] [Cited by in RCA: 92] [Article Influence: 6.1] [Reference Citation Analysis (0)] |
| 4. | Pickup MW, Mouw JK, Weaver VM. The extracellular matrix modulates the hallmarks of cancer. EMBO Rep. 2014;15:1243-1253. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1682] [Cited by in RCA: 1484] [Article Influence: 123.7] [Reference Citation Analysis (4)] |
| 5. | Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144:646-674. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 55210] [Cited by in RCA: 49244] [Article Influence: 3282.9] [Reference Citation Analysis (22)] |
| 6. | Fridman WH, Dieu-Nosjean MC, Pagès F, Cremer I, Damotte D, Sautès-Fridman C, Galon J. The immune microenvironment of human tumors: general significance and clinical impact. Cancer Microenviron. 2013;6:117-122. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 101] [Cited by in RCA: 104] [Article Influence: 8.0] [Reference Citation Analysis (0)] |
| 7. | Chen Z, Meng Z, Jia L, Cui R. The tumor microenvironment and cancer. Biomed Res Int. 2014;2014:573947. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 4] [Cited by in RCA: 5] [Article Influence: 0.4] [Reference Citation Analysis (0)] |
| 8. | Chen C, Chen D, Zhang Y, Chen Z, Zhu W, Zhang B, Wang Z, Le H. Changes of CD4+CD25+FOXP3+ and CD8+CD28- regulatory T cells in non-small cell lung cancer patients undergoing surgery. Int Immunopharmacol. 2014;18:255-261. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 70] [Cited by in RCA: 69] [Article Influence: 5.8] [Reference Citation Analysis (0)] |
| 9. | Han Y, Wu J, Bi L, Xiong S, Gao S, Yin L, Jiang L, Chen C, Yu K, Zhang S. Malignant B cells induce the conversion of CD4+CD25- T cells to regulatory T cells in B-cell non-Hodgkin lymphoma. PLoS One. 2011;6:e28649. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 29] [Cited by in RCA: 28] [Article Influence: 1.9] [Reference Citation Analysis (0)] |
| 10. | Clarke SL, Betts GJ, Plant A, Wright KL, El-Shanawany TM, Harrop R, Torkington J, Rees BI, Williams GT, Gallimore AM. CD4+CD25+FOXP3+ regulatory T cells suppress anti-tumor immune responses in patients with colorectal cancer. PLoS One. 2006;1:e129. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 174] [Cited by in RCA: 176] [Article Influence: 8.8] [Reference Citation Analysis (0)] |
| 11. | Schabowsky RH, Madireddi S, Sharma R, Yolcu ES, Shirwan H. Targeting CD4+CD25+FoxP3+ regulatory T-cells for the augmentation of cancer immunotherapy. Curr Opin Investig Drugs. 2007;8:1002-1008. [PubMed] |
| 12. | Dudley ME, Yang JC, Sherry R, Hughes MS, Royal R, Kammula U, Robbins PF, Huang J, Citrin DE, Leitman SF. Adoptive cell therapy for patients with metastatic melanoma: evaluation of intensive myeloablative chemoradiation preparative regimens. J Clin Oncol. 2008;26:5233-5239. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1131] [Cited by in RCA: 1077] [Article Influence: 59.8] [Reference Citation Analysis (0)] |
| 13. | Oida T, Zhang X, Goto M, Hachimura S, Totsuka M, Kaminogawa S, Weiner HL. CD4+CD25- T cells that express latency-associated peptide on the surface suppress CD4+CD45RBhigh-induced colitis by a TGF-beta-dependent mechanism. J Immunol. 2003;170:2516-2522. [PubMed] |
| 14. | Gandhi R, Farez MF, Wang Y, Kozoriz D, Quintana FJ, Weiner HL. Cutting edge: human latency-associated peptide+ T cells: a novel regulatory T cell subset. J Immunol. 2010;184:4620-4624. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 84] [Cited by in RCA: 86] [Article Influence: 5.4] [Reference Citation Analysis (0)] |
| 15. | Slobodin G, Kaly L, Peri R, Kessel A, Rosner I, Toubi E, Rimar D, Boulman N, Rozenbaum M, Odeh M. Higher expression of latency-associated peptide on the surface of peripheral blood monocytes in patients with rheumatoid arthritis may be protective against articular erosions. Inflammation. 2013;36:1075-1078. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 5] [Cited by in RCA: 6] [Article Influence: 0.5] [Reference Citation Analysis (0)] |
| 16. | Wu HY, Quintana FJ, Weiner HL. Nasal anti-CD3 antibody ameliorates lupus by inducing an IL-10-secreting CD4+ CD25- LAP+ regulatory T cell and is associated with down-regulation of IL-17+ CD4+ ICOS+ CXCR5+ follicular helper T cells. J Immunol. 2008;181:6038-6050. [PubMed] |
| 17. | Ishikawa H, Ochi H, Chen ML, Frenkel D, Maron R, Weiner HL. Inhibition of autoimmune diabetes by oral administration of anti-CD3 monoclonal antibody. Diabetes. 2007;56:2103-2109. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 94] [Cited by in RCA: 91] [Article Influence: 4.8] [Reference Citation Analysis (0)] |
| 18. | Whiteside TL, Miescher S, MacDonald HR, Von Fliedner V. Separation of tumor-infiltrating lymphocytes from tumor cells in human solid tumors. A comparison between velocity sedimentation and discontinuous density gradients. J Immunol Methods. 1986;90:221-233. [PubMed] |
| 19. | Frey DM, Droeser RA, Viehl CT, Zlobec I, Lugli A, Zingg U, Oertli D, Kettelhack C, Terracciano L, Tornillo L. High frequency of tumor-infiltrating FOXP3(+) regulatory T cells predicts improved survival in mismatch repair-proficient colorectal cancer patients. Int J Cancer. 2010;126:2635-2643. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 289] [Cited by in RCA: 206] [Article Influence: 12.9] [Reference Citation Analysis (5)] |
| 20. | Haas M, Dimmler A, Hohenberger W, Grabenbauer GG, Niedobitek G, Distel LV. Stromal regulatory T-cells are associated with a favourable prognosis in gastric cancer of the cardia. BMC Gastroenterol. 2009;9:65. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 126] [Cited by in RCA: 131] [Article Influence: 7.7] [Reference Citation Analysis (3)] |
| 21. | Lee JJ, Chang YL, Lai WL, Ko JY, Kuo MY, Chiang CP, Azuma M, Chen CW, Chia JS. Increased prevalence of interleukin-17-producing CD4(+) tumor infiltrating lymphocytes in human oral squamous cell carcinoma. Head Neck. 2011;33:1301-1308. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 31] [Cited by in RCA: 40] [Article Influence: 2.7] [Reference Citation Analysis (0)] |
| 22. | Whiteside TL. What are regulatory T cells (Treg) regulating in cancer and why? Semin Cancer Biol. 2012;22:327-334. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 235] [Cited by in RCA: 227] [Article Influence: 16.2] [Reference Citation Analysis (4)] |
| 23. | Scurr M, Ladell K, Besneux M, Christian A, Hockey T, Smart K, Bridgeman H, Hargest R, Phillips S, Davies M. Highly prevalent colorectal cancer-infiltrating LAP+ Foxp3- T cells exhibit more potent immunosuppressive activity than Foxp3+ regulatory T cells. Mucosal Immunol. 2014;7:428-439. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 113] [Cited by in RCA: 113] [Article Influence: 9.4] [Reference Citation Analysis (0)] |
| 24. | Duffy MJ, van Dalen A, Haglund C, Hansson L, Holinski-Feder E, Klapdor R, Lamerz R, Peltomaki P, Sturgeon C, Topolcan O. Tumour markers in colorectal cancer: European Group on Tumour Markers (EGTM) guidelines for clinical use. Eur J Cancer. 2007;43:1348-1360. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 383] [Cited by in RCA: 346] [Article Influence: 18.2] [Reference Citation Analysis (3)] |
| 25. | Locker GY, Hamilton S, Harris J, Jessup JM, Kemeny N, Macdonald JS, Somerfield MR, Hayes DF, Bast RC. ASCO 2006 update of recommendations for the use of tumor markers in gastrointestinal cancer. J Clin Oncol. 2006;24:5313-5327. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1261] [Cited by in RCA: 1120] [Article Influence: 56.0] [Reference Citation Analysis (8)] |
| 26. | Sallusto F, Geginat J, Lanzavecchia A. Central memory and effector memory T cell subsets: function, generation, and maintenance. Annu Rev Immunol. 2004;22:745-763. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2477] [Cited by in RCA: 2373] [Article Influence: 107.9] [Reference Citation Analysis (0)] |
| 27. | Campbell IW. Nateglinide--current and future role in the treatment of patients with type 2 diabetes mellitus. Int J Clin Pract. 2005;59:1218-1228. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 29] [Cited by in RCA: 24] [Article Influence: 1.1] [Reference Citation Analysis (0)] |
| 28. | Lee JH, Cho YS, Lee JY, Kook MC, Park JW, Nam BH, Bae JM. The chemokine receptor CCR4 is expressed and associated with a poor prognosis in patients with gastric cancer. Ann Surg. 2009;249:933-941. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 37] [Cited by in RCA: 38] [Article Influence: 2.2] [Reference Citation Analysis (0)] |
| 29. | Cao L, Hu X, Zhang J, Huang G, Zhang Y. The role of the CCL22-CCR4 axis in the metastasis of gastric cancer cells into omental milky spots. J Transl Med. 2014;12:267. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 40] [Cited by in RCA: 46] [Article Influence: 3.8] [Reference Citation Analysis (1)] |
| 30. | Wang SW, Liu SC, Sun HL, Huang TY, Chan CH, Yang CY, Yeh HI, Huang YL, Chou WY, Lin YM. CCL5/CCR5 axis induces vascular endothelial growth factor-mediated tumor angiogenesis in human osteosarcoma microenvironment. Carcinogenesis. 2015;36:104-114. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 125] [Cited by in RCA: 122] [Article Influence: 11.1] [Reference Citation Analysis (0)] |
| 31. | Xu L, Kitani A, Strober W. Molecular mechanisms regulating TGF-beta-induced Foxp3 expression. Mucosal Immunol. 2010;3:230-238. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 94] [Cited by in RCA: 94] [Article Influence: 5.9] [Reference Citation Analysis (0)] |
| 32. | Fontenot JD, Gavin MA, Rudensky AY. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol. 2003;4:330-336. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 6039] [Cited by in RCA: 5885] [Article Influence: 255.9] [Reference Citation Analysis (3)] |
| 33. | Pai SY, Truitt ML, Ting CN, Leiden JM, Glimcher LH, Ho IC. Critical roles for transcription factor GATA-3 in thymocyte development. Immunity. 2003;19:863-875. [PubMed] |
| 34. | Hazama Y, Matsuhisa M, Ohtoshi K, Gorogawa S, Kato K, Kawamori D, Yoshiuchi K, Nakamura Y, Shiraiwa T, Kaneto H. Beneficial effects of nateglinide on insulin resistance in type 2 diabetes. Diabetes Res Clin Pract. 2006;71:251-255. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 18] [Cited by in RCA: 18] [Article Influence: 0.9] [Reference Citation Analysis (0)] |
| 35. | Chen W, Jin W, Wahl SM. Engagement of cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) induces transforming growth factor beta (TGF-beta) production by murine CD4(+) T cells. J Exp Med. 1998;188:1849-1857. [PubMed] |
| 36. | Smigiel KS, Srivastava S, Stolley JM, Campbell DJ. Regulatory T-cell homeostasis: steady-state maintenance and modulation during inflammation. Immunol Rev. 2014;259:40-59. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 207] [Cited by in RCA: 187] [Article Influence: 15.6] [Reference Citation Analysis (0)] |
| 37. | Mahalingam J, Lin YC, Chiang JM, Su PJ, Fang JH, Chu YY, Huang CT, Chiu CT, Lin CY. LAP+CD4+ T cells are suppressors accumulated in the tumor sites and associated with the progression of colorectal cancer. Clin Cancer Res. 2012;18:5224-5233. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 15] [Cited by in RCA: 15] [Article Influence: 1.1] [Reference Citation Analysis (0)] |
| 38. | Ochi H, Abraham M, Ishikawa H, Frenkel D, Yang K, Basso AS, Wu H, Chen ML, Gandhi R, Miller A. Oral CD3-specific antibody suppresses autoimmune encephalomyelitis by inducing CD4+ CD25- LAP+ T cells. Nat Med. 2006;12:627-635. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 210] [Cited by in RCA: 201] [Article Influence: 10.1] [Reference Citation Analysis (1)] |
| 39. | Duan W, So T, Mehta AK, Choi H, Croft M. Inducible CD4+LAP+Foxp3- regulatory T cells suppress allergic inflammation. J Immunol. 2011;187:6499-6507. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 55] [Cited by in RCA: 59] [Article Influence: 3.9] [Reference Citation Analysis (0)] |
| 40. | Savage ND, de Boer T, Walburg KV, Joosten SA, van Meijgaarden K, Geluk A, Ottenhoff TH. Human anti-inflammatory macrophages induce Foxp3+ GITR+ CD25+ regulatory T cells, which suppress via membrane-bound TGFbeta-1. J Immunol. 2008;181:2220-2226. [PubMed] |
| 41. | Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S. Stimulation of CD25(+)CD4(+) regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol. 2002;3:135-142. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1279] [Cited by in RCA: 1267] [Article Influence: 52.8] [Reference Citation Analysis (0)] |
| 42. | Coombes JL, Siddiqui KR, Arancibia-Cárcamo CV, Hall J, Sun CM, Belkaid Y, Powrie F. A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism. J Exp Med. 2007;204:1757-1764. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 2319] [Cited by in RCA: 2218] [Article Influence: 116.7] [Reference Citation Analysis (4)] |
| 43. | Fahlén L, Read S, Gorelik L, Hurst SD, Coffman RL, Flavell RA, Powrie F. T cells that cannot respond to TGF-beta escape control by CD4(+)CD25(+) regulatory T cells. J Exp Med. 2005;201:737-746. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 369] [Cited by in RCA: 383] [Article Influence: 18.2] [Reference Citation Analysis (0)] |
| 44. | Gorelik L, Flavell RA. Abrogation of TGFbeta signaling in T cells leads to spontaneous T cell differentiation and autoimmune disease. Immunity. 2000;12:171-181. [PubMed] |
| 45. | Liu Y, Zhang P, Li J, Kulkarni AB, Perruche S, Chen W. A critical function for TGF-beta signaling in the development of natural CD4+CD25+Foxp3+ regulatory T cells. Nat Immunol. 2008;9:632-640. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 473] [Cited by in RCA: 448] [Article Influence: 24.9] [Reference Citation Analysis (0)] |
| 46. | Asseman C, Mauze S, Leach MW, Coffman RL, Powrie F. An essential role for interleukin 10 in the function of regulatory T cells that inhibit intestinal inflammation. J Exp Med. 1999;190:995-1004. [PubMed] |
| 47. | Hori S, Takahashi T, Sakaguchi S. Control of autoimmunity by naturally arising regulatory CD4+ T cells. Adv Immunol. 2003;81:331-371. [PubMed] |
Manuscript source: Unsolicited manuscript
Specialty type: Gastroenterology and hepatology
Country of origin: China
Peer-review report classification
Grade A (Excellent): 0
Grade B (Very good): B
Grade C (Good): 0
Grade D (Fair): 0
Grade E (Poor): 0
Open-Access: This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
P- Reviewer: Sokol L S- Editor: Gong ZM L- Editor: A E- Editor: Wang CH