BPG is committed to discovery and dissemination of knowledge
Evidence-Based Medicine Open Access
©2014 Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Jun 7, 2014; 20(21): 6560-6572
Published online Jun 7, 2014. doi: 10.3748/wjg.v20.i21.6560
Colon cancer-associated B2 Escherichia coli colonize gut mucosa and promote cell proliferation
Jennifer Raisch, Emmanuel Buc, Mathilde Bonnet, Pierre Sauvanet, Emilie Vazeille, Amélie de Vallée, Denis Pezet, Richard Bonnet, Marie-Agnès Bringer, Arlette Darfeuille-Michaud, Clermont Université, UMR1071 Inserm/Université d’Auvergne and INRA USC2018, 63000 Clermont-Ferrand, France
Emmanuel Buc, Pierre Sauvanet, Emilie Vazeille, Pierre Déchelotte, Claude Darcha, Denis Pezet, Richard Bonnet, Centre Hospitalier Universitaire, 63000 Clermont-Ferrand, France
Author contributions: Raisch J, Buc E, Bringer MA and Darfeuille-Michaud A conceived and designed the study, analysed data and drafted the manuscript; Bringer MA and Darfeuille-Michaud A contributed equally to the design and data analyses of this study; Raisch J, Buc E, Bonnet M, Vazeille E and Bringer MA performed experiments; Raisch J and Buc E contributed equally to this study; Buc E, Sauvanet P, de Vallée A, Pezet D and Bonnet R carried out the sample collection and the sample processing; Déchelotte P and Darcha C performed immunohistology analyses.
Supported by Ministère de l’Enseignement supérieur et de la Recherche, Inserm and Université d’Auvergne (UMR1071), INRA (USC-2018); and Grants from the Association F. Aupetit (AFA) and Ligue contre le cancer
Correspondence to: Marie-Agnès Bringer, PhD, Clermont Université, UMR1071 Inserm/Université d’Auvergne and INRA USC2018, 63000 Clermont-Ferrand, France. m-agnes.bringer@udamail.fr
Telephone: +33-4-7317 8371 Fax: +33-4-7317 8371
Received: October 25, 2013
Revised: February 10, 2014
Accepted: March 8, 2014
Published online: June 7, 2014
Processing time: 223 Days and 22.7 Hours

Abstract

AIM: To provide further insight into the characterization of mucosa-associated Escherichia coli (E. coli) isolated from the colonic mucosa of cancer patients.

METHODS: Phylogroups and the presence of cyclomodulin-encoding genes of mucosa-associated E. coli from colon cancer and diverticulosis specimens were determined by PCR. Adhesion and invasion experiments were performed with I-407 intestinal epithelial cells using gentamicin protection assay. Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) expression in T84 intestinal epithelial cells was measured by enzyme-linked immunosorbent assay and by Western Blot. Gut colonization, inflammation and pro-carcinogenic potential were assessed in a chronic infection model using CEABAC10 transgenic mice. Cell proliferation was analyzed by real-time mRNA quantification of PCNA and immunohistochemistry staining of Ki67.

RESULTS: Analysis of mucosa-associated E. coli from colon cancer and diverticulosis specimens showed that whatever the origin of the E. coli strains, 86% of cyclomodulin-positive E. coli belonged to B2 phylogroup and most harbored polyketide synthase (pks) island, which encodes colibactin, and/or cytotoxic necrotizing factor (cnf) genes. In vitro assays using I-407 intestinal epithelial cells revealed that mucosa-associated B2 E. coli strains were poorly adherent and invasive. However, mucosa-associated B2 E. coli similarly to Crohn’s disease-associated E. coli are able to induce CEACAM6 expression in T84 intestinal epithelial cells. In addition, in vivo experiments using a chronic infection model of CEACAM6 expressing mice showed that B2 E. coli strain 11G5 isolated from colon cancer is able to highly persist in the gut, and to induce colon inflammation, epithelial damages and cell proliferation.

CONCLUSION: In conclusion, these data bring new insights into the ability of E. coli isolated from patients with colon cancer to establish persistent colonization, exacerbate inflammation and trigger carcinogenesis.

Key Words: B2 Escherichia coli; Carcinoembryonic antigen-related cell adhesion molecule 6; Cell proliferation; Colon cancer; Polyketide synthase genomic island

Core tip: Tumors and mucosa of patients with colon cancer are abnormally colonized by Escherichia coli (E. coli) belonging to B2 phylogroup. The aim of the present study was to provide further insight into the characterization of colon cancer-associated E. coli. Despite their poor ability to adhere to and to invade intestinal epithelial cells in vitro, we showed that colon cancer-associated E. coli induce carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) expression, a receptor involved in adhesion of pathogenic E. coli. These bacteria were also able to persist and promote low grade inflammation and cell proliferation, in a chronic infection model of CEACAM6 expressing mice, highlighting their oncogenic potential.



Core tip: Tumors and mucosa of patients with colon cancer are abnormally colonized by Escherichia coli (E. coli) belonging to B2 phylogroup. The aim of the present study was to provide further insight into the characterization of colon cancer-associated E. coli. Despite their poor ability to adhere to and to invade intestinal epithelial cells in vitro, we showed that colon cancer-associated E. coli induce carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) expression, a receptor involved in adhesion of pathogenic E. coli. These bacteria were also able to persist and promote low grade inflammation and cell proliferation, in a chronic infection model of CEACAM6 expressing mice, highlighting their oncogenic potential.


INTRODUCTION

Colorectal cancer (CRC) is the fourth leading cause of cancer death and is responsible for about 610000 deaths per year worldwide[1]. Although many etiologic genetic changes are associated with progression from adenomatous lesions to invasive carcinoma[2], the specific causative factors in the development of sporadic CRC remain unclear. Accumulating evidence supports that inflammation and gut microbial communities influence the development of colorectal carcinoma[3-5]. Two theories have emerged to explain the contribution of bacteria in CRC: (1) the “alpha bug” concept, wherein select members of a microbial community with virulence and pro-carcinogenic features are capable of remodeling the microbiome as a whole to drive pro-inflammatory immune responses and colonic epithelial cell transformation leading to cancer[6]; and (2) the “driver-passenger” concept, wherein certain indigenous intestinal bacteria, termed “bacteria drivers”, initiate CRC by inducing epithelial DNA damages: the resulting tumorigenesis induces intestinal niche alterations that promote the proliferation of passenger opportunistic bacteria with a growth advantage in the tumour microenvironment[7].

Dysbiosis of the intestinal microbiota has been observed in CRC patients. Recent pyrosequencing data of CRC-associated bacterial microbiota have revealed, in particular, over-representation of some bacteria such as Bacteroides/Prevotella, Faecalibacterium and Fusobacterium[8,9]. In addition, independent studies show that colonic adenomas, carcinomas and the mucosa of CRC patients are abnormally colonized by high numbers of adherent Escherichia coli (E. coli) compared to controls[10-12]. It has been suggested that the role of E. coli in CRC promotion and development is related to chronic inflammation. Inflammation can result from bacterial infection, via its effects on both the host and the microbiota, in particular by promoting the expansion of E. coli, which actively contribute to the accumulation of mutations resulting from DNA damages induced by genotoxins, or by downregulating host DNA mismatch repair proteins[3,11,13]. In particular, E. coli strains harboring the polyketide synthase (pks) genotoxic island, which are found in a significantly high percentage of inflammatory bowel disease (IBD) and CRC patients, can promote invasive carcinoma in monocolonized azoxymethane (AOM)-treated Il10-/- mice[3]. In addition, certain pathogenic bacteria can also be involved in cancer development, like, for example enterotoxigenic Bacteroides fragilis (ETBF), a common human commensal bacterium that is associated with colon cancer[14]. ETBF-induced chronic inflammation and tumorigenesis in ApcMin/+ mice (a mouse model of familial adenomatous polyposis) involve the induction of the polyamine catabolic enzyme spermine oxidase, which causes DNA damages and uncontrolled cell proliferation in intestinal epithelial cells[15].

Patients with IBD have an increased risk of colon cancer and small bowel adenocarcinoma[16,17]. As in colon cancer patients, dysbiosis toward selected micro-organisms and decreased complexity of commensal bacteria have been observed in patients with Crohn’s disease (CD) and ulcerative colitis (UC), but it is not clear whether dysbiosis contributes to the development of IBD or is instead a consequence of the disease. Patients with IBD, compared to healthy controls, have fewer bacteria with anti-inflammatory properties and/or more bacteria with pro-inflammatory properties. Several metagenomic-based studies reported that members of the phyla Bacteroidetes and Firmicutes were reduced in patients with CD or UC[18-20]. Among the Firmicutes, Faecalibacterium prausnitzii has anti-inflammatory properties; its numbers are reduced in patients with CD and associated with a risk of post-resection recurrence of ileal CD[20]. In contrast, a greater relative abundance of Enterobacteriaceae, mostly E. coli belonging to the B2 phylogenetic group, has been reported in CD patients more notably on mucosa-associated microbiota than in fecal samples[10,18,21-24]. Intestinal colonization by E. coli correlates with bacterial adhesion of CD-associated E. coli strains to intestinal epithelial cells[10,25]. CD-associated E. coli share abilities to adhere to and to invade intestinal epithelial cells and to survive within macrophages[26,27] and they are termed accordingly adherent-invasive E. coli (AIEC). The abnormal colonization of CD mucosa by AIEC involves abnormal expression of a host receptor, the carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6)[28]. Interestingly, CEACAM6 is not only abnormally expressed in the ileum of patients with CD[28] but expression of this molecule is also up-regulated in proliferating cells in adenomas and colorectal tumors[29,30]. However, the origin of CEACAM6 surexpression in colon cancer is not yet clearly understood.

The aim of the present study was to provide further insight into the characterization of mucosa-associated E. coli isolated from the colonic mucosa of cancer patients. We determined their ability to interact with intestinal epithelial cells, with a particular focus on biofilm formation and the presence of cyclomodulin-encoding genes, and to induce CEACAM6 expression in intestinal epithelial cells. Finally, using CEABAC10 transgenic mice expressing human CEACAMs, we assessed the effects of long-term chronic infection by the colon cancer-associated E. coli strain 11G5 for its ability to colonize the gut, to potentiate inflammation and to induce cell proliferation.

MATERIALS AND METHODS
Ethical considerations

Ethical approval for the study was granted by the Clermont-Ferrand research ethics committee. This IRB allowed for the waiver of written consent and approved the process of obtaining verbal consent from potential subjects, because the research involved no procedures for which written consent is normally required outside of the research context and presents no risk of harm to subjects. The biological samples were collected from colon resections, which were required for the treatment of patients. The investigators explained the study to the potential subject verbally, providing all pertinent information such as purpose, procedures and putative risks. Following this verbal explanation, the potential subject was provided with a study information sheet. After allowing the potential subject time to read the study information sheet, the investigators answered any additional questions the subject may have. A verbal agreement to participate in the research was obtained for all patients included in the study. The dates of verbal consent were tracked in a non-identifiable manner.

Patients

Eighty-one patients were studied between March 2007 and July 2010 at the University hospital of Clermont-Ferrand, France, 48 with colon cancer (adenocarcinoma), and 33 with diverticulosis. For ethical considerations no surgical specimens from healthy patients were included and diverticulosis specimens were used as non-neoplastic controls. Among patients with diverticulosis, we excluded those with acute or chronic inflammation at the time of surgery, and those with stenosis to avoid potential consequences of inflammation on gut microbiota. Sex ratio (M/F) was 1.22 and 0.74 for CRC and diverticulosis patients respectively. The age range was 35-95 years for cancer patients (median age, 70 years and average age, 67 years) and 34-81 years for controls (median age, 58 years and average age, 60 years). Biopsies were taken on non-involved mucosa near the site of malignant tumors in resected colon. Pathologic analysis confirmed the neoplastic features of the samples. Bowel preparation was by oral sodium picosulfate or oral polyethylene glycol the evening before surgery. All resection patients had received cefoxitin (2 g intravenously) at the time of incision and none had received antibiotics in the 4 wk before sampling. Ethical approval for the study was granted by the Clermont-Ferrand Research Ethics Committee.

Biopsy treatment for determination of associated E. coli numbers

The mucosal biopsy specimens were transported on ice to the laboratory. The samples were weighed (50 to 100 mg each) and washed thoroughly three times in 10 mL PBS to remove most of the fecal bacteria. To determine the number of associated bacteria, samples were crushed (Ultra-Turrax, IKA) and incubated for 15 minutes in the presence of 0.1% Triton X-100. Ten-fold dilutions of the lysates were then plated on Drigalski agar and chromogenic agar chromID CPS3® (bioMérieux), which allow the identification of E. coli isolates. Colony forming units (CFUs) of E. coli isolates were collected after 24 h of incubation at 37 °C and the identification of bacteria was confirmed with the automated Vitek II® (bioMérieux) system. When possible a maximum of 96 E. coli isolates per sample were collected for molecular typing. The bacteria were subcultured for 24 h at 37 °C in 96-well plates in Luria Bertani medium, supplemented with 15% glycerol and then stored at -80 °C.

Molecular phylogenetic grouping and PCR assay for cyclomodulin and adhesin-encoding genes

Ten isolates per sample were typed with molecular methods to identify the E. coli isolates (E. coli genotypes) colonizing the samples. Two genotyping methods were used: an “Enterobacterial Repetitive Intergenic Consensus” sequence (ERIC)-PCR using primer ERIC2 (5’ AAGTAAGTGACTGGGGTGAGCG 3’) and a “Random Amplified Polymorphic DNA” (RAPD)-PCR using primer 1283 (5’ GCGATCCCCA 3’)[31,32]. For each isolate, one representative isolate was subsequently analysed and stored at -80 °C in Luria-Bertani medium supplemented with 15% glycerol. E. coli isolates were then classified according to the E. coli Reference Collection system into phylogenetic groups A, B1, B2, and D using a multiplex PCR technique[33]. Strain RS218, which harbors all the genes targeted by the multiplex PCR, was used as positive control. To investigate the presence of cyclomodulin (pks genomic island, cdt, cnf, and cif)-, adhesin (afa, afa/dr and aaf)-, or intimin (eae)-encoding genes, PCR assays were performed using primers listed in Table 1.

Table 1 List of primers used for PCR assays.
Primer nameSequence (5’-3’)Region specific forRef.
afa-fCGGCTTTTCTGCTGAACTGGCAGGCafaC[49]
afa-rCCGTCAGCCCCCACGGCAGACC
afa1GCTGGGCAGCAAACTGATAACTCTCafaBC
afa2CATCAAGCTGTTTGTTCGTCCGCCG
afaE-f1TTAGACCGTACTGTTGTGTTACCCCC
afaE1-rCATCGCCCGTCGCAGAGCCCATafaE1
afaE2-rGTTTCCCAGTAGACTGGAATGAAGCafaE2
afaE3-rCCCTATTGTTGTCGCTGATCAGGAAGafaE3
daaE-rCGGCTAGTCATATATAGATTTGTCGCdaaE
afaE5-fTCAACTCACCCAGTAGCCCCAGafaE5
afaE5-rAGGAAGTGGTAGCACCGGTACG
afaE7-fGCTAAATCAACTGTTGATGTTafaE7
afaE7-rGGACAATCCAAATGGCGAATTA
afaE8-fCTAACTTGCCATGCTGTGACAGTAafaE8
afaE8-rTTATCCCCTGCGTAGTTGTGAATC
aggR1CTAATTGTACAATCGATGTAaggR[50]
aggR2CTGAAGTAATTCTTGAA
pksORF9-10.1KJATTCGATAGCGTCACCCAACclbK-clbJ[51]
pksORF9-10.2KJTAAGCGTCTGGAATGCAGTG
CNF-1sGGGGGAAGTACAGAAGAATTAcnf1[51]
CNF-1asTTGCCGTCCACTCTCACCAGT
CNF-2sTATCATACGGCAGGAGGAAGCACCcnf2
CNF-2asGTCACAATAGACAATAATTTTCCG
CNF3-3DTAACGTAATTAGCAAAGAcnf3
CNF-3asGTCTTCATTACTTACAGT
CDT-s1GAAAGTAAATGGAATATAAATGTCCGcdtB-II, cdtB-III, cdtB-V[51]
CDT-as1AAATCACCAAGAATCATCCAGTTA
CDT-IIas2TTTGTGTTGCCGCCGCTGGTGAAAcdtB-II
CDT-IIIas2TTTGTGTCGGTGCAGCAGGGAAAA
CDT-s2GAAAATAAATGGAACACACATGTCCGcdtB-I, cdtB-IV
CDT-as2AAATCTCCTGCAATCATCCAGTTA
CDT-IsCAATAGTCGCCCACAGGAcdtB-I
CDT-IasATAATCAAGAACACCACCAC
CDT-IVsCCTGATGGTTCAGGAGGCTGGTTCcdtB-IV
CDT-IVasTTGCTCCAGAATCTATACCT
P105GTCAACGAACATTAGATTATcdtC-V
c2767rATGGTCATGCTTTGTTATAT
cif-int-sAACAGATGGCAACAGACTGGcif[51]
cif-int-asAGTCAATGCTTTATGCGTCAT
clbQ-FTTGTATAGTTACACAACTATTTC
clbQ-RCCTGTTAGCTTTCGTTCThis study
MIclbQaadA7-FCATTAAATCATCAAATTAAACGAATTCTATTACACAACAAGGAGTGGGACGCACTGGCATTTAATAACGCGTC
MIClbQaadA7-RGATGATGGAACAGCCATATCTATTGCTCCTTGTATAGTTACACAACTATTTTTAATCACTTTACTTTTATC
Cell culture

The intestinal epithelial cell lines T84 (ATCC, CCL-248) and Intestine-407 (I-407; ATCC, CCL-6) were maintained in an atmosphere containing 5% CO2 at 37 °C in the culture medium recommended by ATCC. For infection assays, cells were seeded in 24-well plates at a density of 2 × 105/cm2.

Adhesion and invasion assays

I-407 cells were infected at a multiplicity of infection (MOI) of 10 bacteria per cell. Adhesion and invasion assays were performed as previously described[27]. For adhesion assays, monolayers were washed five times in PBS after 3 h of incubation at 37 °C. To determine the numbers of intracellular bacteria (invasion assay), cell culture medium containing gentamicin at a concentration of 200 μg/mL was added for 1 h to kill extracellular bacteria. The epithelial cells were then lysed with 1% Triton X-100 in deionized water. This concentration of Triton X-100 had no effect on bacterial viability for at least 30 min. Samples were diluted and plated onto LB agar plates to determine the number of CFU.

Biofilm formation assays

Biofilm formation assays on abiotic surface were performed using a previously described method[34]. Biofilm measurements were calculated using the formula SBF = (AB-CW)/G, in which SBF is the specific biofilm formation, AB the OD570nm of the attached and stained bacteria, CW the OD570nm of the stained control wells containing only bacteria-free medium (to eliminate unspecific or abiotic OD values), and G is the OD630nm of cell growth in broth. Assays were performed in triplicate.

Biofilm formation assays were also performed using PFA-fixed I-407 cells[34]. Briefly, confluent I-407 monolayers were fixed for 15 min in 3.7% PFA-PBS. The fixed cells were washed and infected with bacteria in M63 minimal medium and incubated overnight at 30 ºC without shaking. For visualization, infected epithelial cells were fixed for 15 min in 3.7% PFA-PBS and permeabilized in PBS-0.1% Triton X-100. Coverslides were incubated with goat anti-E. coli polyclonal antibodies (dilution 1/100, AbD serotec) and Alexa 488-labeled anti-goat antibodies (dilution 1/300, Invitrogen). Actin cytoskeleton was stained using TRITC-labelled-phalloidin (Sigma). The slides were examined with a Zeiss LSM 510 Meta confocal microscope (ICCF platform, Clermont-Ferrand, France).

Mouse model infection

CEABAC10 transgenic mice (heterozygote[35] were housed in specific pathogen-free conditions in the animal care facility at Université d’Auvergne, Clermont-Ferrand, France). Mice from the same generation were used for experimentation. Animal protocols were approved by the Committee for Research and Ethical Issues of the International Association for the Study of Pain.

A total of 22 female 10 wk-old CEABAC10 mice were divided into three groups: non-infected control group (n = 6), 11G5-infected group (n = 7) and AIEC LF82-infected group (n = 9). The animals were pretreated once before the first infection cycle by oral administration of the broad-spectrum antibiotic streptomycin (20 mg intragastric per mouse) to disrupt normal resident bacterial flora in the intestinal tract and received a dose of 0.25% (wt/vol) of dextran sulfate sodium (DSS; molecular mass = 36000-50000 daltons; MP Biomedicals) in drinking water 3 d before infection to increase the accessibility of bacteria to the surface of the epithelial layer. The administration of 0.25% DSS did not affect the body weight of mice and did not induce clinical symptoms of colitis[36]. The mice were subjected to 8 consecutive cycles of infection. For each infection cycle, they were orally challenged twice a week by intra-gastric gavage with 2 × 108 bacteria for a 3-wk period. This infection period was followed by a 1-wk recovery period without infection. For each cycle, 5 d after the last oral bacterial infection, fresh fecal pellets (100-200 mg) were collected and suspended in PBS to evaluate colonization. After serial dilution, bacteria were enumerated by plating on LB agar medium containing 50 μg/mL of kanamycin and 50 μg/mL of ampicillin isolate 11G5 bacteria or 100 μg/ml of ampicillin and 20 μg/mL of erythromycin to isolate LF82 bacteria, and incubated at 37 °C overnight.

Histological grading of intestinal inflammation and epithelial damages

After mouse sacrifice, the entire colon was excised and rolls of the proximal colon were fixed in buffered 4% formalin, paraffin-embedded, cut into 5-μm slices, and stained with hematoxylin/eosin/safranin. The histological severity of colitis was graded in a blinded fashion by a GI pathologist. The tissue samples were assessed for the extent and depth of inflammation and the extent of epithelial damages, as presented in Table 2. The histology score corresponds to the sum of each item.

Table 2 Histological grading of intestinal inflammation.
SymptomsCharacteristics
Infiltration of inflammatory cells
0Rare inflammatory cells in the lamina propria
1Increased numbers of inflammatory cells, including neutrophils in the lamina propria
2Confluence of inflammatory cells extending into the submucosa
3Transmural extension of the inflammatory cell infiltrate
Infiltration of epithelium by polynuclear cells
0No infiltration
1Surface
2Inside the crypt
3Cryptic abscess
Severity of epithelial damage
0Absence of mucosal damage
1Lymphoepithelial lesions
2Mucosal erosion/ulceration
3Extensive mucosal damage and extension through deeper structures of the bowel wall
Surface of epithelial damage
0Normal
1Focal
2Wide
Immunohistochemistry

For immunohistochemical staining of mouse Ki-67, heat-induced epitope retrieval was performed using sodium citrate buffer (pH 6.0). Ki-67 antigen was detected using anti-mouse Ki-67 polyclonal antibodies (Leica) and revealed with Vectastain ABC kit (Vector) and DAB detection kit (Invitrogen). The sections were counterstained using Gill’s hematoxylin (Vector).

Real-time mRNA quantification

Total RNAs were extracted from tissue using a Nucleospin® RNA/Protein extraction kit (Macherey-Nagel GmbH & Co). RNA samples were subjected to reverse transcription using High-Capacity cDNA Reverse Transcription Kit and non-specific random hexamer primers (Applied Biosystems) and quantification was performed using FastStart SYBR® Green Master kit (Roche Applied Science). The primer sequences used are given in Table 3. Gene expression values were calculated based on the ΔΔCt method.

Table 3 List of primers used for RT qPCR assays.
Primer nameSequence (5’-3’)Region specific forRef.
mmu-26s-FWTGTCATTCGGAACATTGTAGS26This study
mmu-26s-RVGGCTTTGGTGGAGGTC
mmu-PCNA-FWCCACATTGGAGATGCTGTTGPCNA
mmu-PCNA-RVCAGTGGAGTGGCTTTTGTGA
Enzyme-linked immunosorbent assay

T84 colon epithelial cells were infected with bacteria for 6h at a MOI of 100 bacteria per cell. The amount of CEACAM6 on whole cell protein extracts was determined by enzyme-linked immunosorbent assay (ELISA) according to manufacturer’s instructions (R and D systems).

Western immunoblotting

T84 colon epithelial cells were infected for 6h at a MOI of 100 bacteria per cell. Whole-cell protein extracts were prepared by adding NP-40 lysis buffer. Protein concentrations were determined by Bradford assay. Total proteins were subjected to SDS-PAGE on 12% gels.

Proteins were electroblotted onto nitrocellulose membranes (Amersham International), and the membranes were immunoblotted for CEACAM6 (mouse anti-CEACAM6, dilution 1/1.000, Genovac) and GAPDH (rabbit anti-GAPDH; dilution 1/1.000, Cell Signaling). Immunoreactants were detected using horseradish peroxidase-conjugated anti-rabbit or anti-mouse immunoglobulin G antibodies, ECL reagents (Amersham Biosciences) and autoradiography.

Statistical analysis

Where appropriate, nonparametric data were expressed by median value (range). Normally distributed data were expressed as means. Error bars represent SEM. Statistical analysis was done using ANOVA (Histopathological score and RT-qPCR), Mann Whitney (adhesion, invasion and biofilm assays) using GraphPad prism5 software. A P value of 0.05 was considered significant.

RESULTS
Most cyclomodulin-producing E. coli strains associated with colon cancer and diverticulosis belong to B2 phylogroup

The analysis of the presence of cyclomodulin-encoding genes, pks island coding for colibactin, and/or cnf and/or cdt and/or cif genes coding for cytotoxic necrotizing factor (CNF), cytolethal distending toxin (CDT), and cycle-inhibiting factor (Cif) indicated that, whatever the origin of the E. coli strains, either from colon cancer or diverticulosis samples, 86% of cyclomodulin-positive E. coli belonged to B2 phylogroup (Tables 4 and 5). Among E. coli strains isolated from colon cancer specimens, B2 E. coli strains harboring pks, cnf and cdt genes represented 26%, 18% and 11% of the total strains isolated, respectively (Tables 4 and 6). Among E. coli strains isolated from patients with diverticulosis, pks-positive B2 E. coli strains represented 13%, and cnf-positive B2 E. coli strains 9% of the total strains isolated. Although a higher prevalence of B2 E. coli strains harboring pks or cnf genes was observed in colon cancer patients than in patients with diverticulosis, this was not significant (P = 0.06 for both pks and cnf genes). Of interest, all but two cnf positive strains also harbored pks and all cnf- and pks-positive E. coli strains belonged to the B2 phylogroup.

Table 4 Distribution of Escherichia coli strains producing various cyclomodulins according to phylogroups and specimen origins n (%).
PhylogoupsE. coli strains exhibiting cyclomodulin-encoding genes
pkscnfcdtcif
Colon cancer-associated E. coli strains (n = 88)1A (n = 20)0 (0)0 (0)0 (0)2 (2)
B1 (n = 14)0 (0)1 (1)1 (1)1 (1)
B2 (n = 38)23 (26)16 (18)4 (11)0 (0)
D (n = 16)0 (0)1 (1)1 (1)0 (0)
Diverticulosis-associated E. coli strains (n = 46)2A (n = 17)0 (0)0 (0)0 (0)0 (0)
B1 (n = 3)0 (0)0 (0)0 (0)0 (0)
B2 (n = 15)6 (13)4 (9)0 (0)0 (0)
D (n = 11)0 (0)0 (0)0 (0)0 (0)
Table 5 Phylogroup distribution of cyclomodulin-positive Escherichia coli strains according to specimen origins n (%).
Phylogroups
AB1B2D
Cyclomodulin-positive E. coli strains isolated from colon cancer patients2 (6)2 (6)26 (84)1 (3)
Cyclomodulin-positive E. coli strains isolated from patients with diverticulosis0 (0)0 (0)6 (100)0 (0)
Cyclomodulin-positive E. coli strains2 (5)2 (5)32 (86)1 (3)
Table 6 Hemolysin expression and presence of cyclomodulin- and adhesin-encoding genes in B2 phylogroup Escherichia coli strains.
E. coli strainsHaemolytic phenotype1Cyclomodulin-encoding genes
Adhesin-encoding genes
pkscnfcdtBcifafadraaagR
Colon cancer
1C12++cnf1-----
1D2-+------
1F8--------
2D5--------
2F8++cnf1cdtB-IV----
2G2+-------
4A9--------
6A8++cnf1-----
6G8++cnf1-----
6G10---cdtB-IV----
6G11--------
7G1--------
7G2++cnf1-----
8A9++------
8A10--------
8F1+-cnf1-----
8G8--------
9G5++cnf1--+--
10D12-+------
10E9++cnf1-----
11F1--------
11G5-+------
12B1++cnf1-----
13H2++cnf1-----
14H4-+---++ (afaE5)-
15D1+-------
15D3++cnf1-----
16C1-+------
17G3+-cnf1-----
18C3++cnf1-----
18C5--------
18H5-+------
19D12++cnf1-----
19G1-+------
19H2++cnf1cdtB-IV----
20B6++cnf1-----
20C3-+-cdtB-I----
20D5--------
Diverticulosis
1D5--------
4D5++cnf1-----
9D7--------
9F1--------
9F4--------
11D9++cnf1-----
12H1-+------
13D1++cnf1-----
15C1--------
16A4-+------
16A8--------
17C1--------
17F2--------
17E1--------
18E6++cnf1-----
Low level of adhesion and invasion but high ability to form biofilm of B2 E. coli strains isolated from colon cancer or diverticulosis patients

The analysis of the ability of E. coli strains to adhere to and to invade intestinal epithelial cells was restricted to B2 E. coli, which were the main cyclomodulin producers in our study. Of note, due to cytolytic activity of hemolysin on cultured cells, hemolysin-positive E. coli strains were not tested. Results showed that B2 phylogroup E. coli strains isolated from colon cancer and from diverticulosis displayed low levels of adhesion to I-407 intestinal epithelial cells (Figure 1A). Compared to the adhesion level of the AIEC reference strain LF82, for which a mean adhesion index of 53.23 ± 6.63 was observed, the adhesion levels of all E. coli strains isolated from colon cancer (except E. coli strain 14H4, which had a mean adhesion level of 25.76 ± 5.06) or from diverticulosis ranged from 0.15 ± 0.02 to 4.04 ± 1.24 or from 0.10 ± 0.04 to 9.17 ± 3.40, respectively. Microscopy examination after Giemsa staining showed a diffuse adhesion pattern (data not shown), and we therefore searched for adhesive factor-encoding genes associated with diffusely adhering E. coli (DAEC) strains (i.e., Afa and Afa/Dr adhesin-encoding genes). None of the B2 E. coli strains tested was positive for afa or afa/dr genes except the highly adherent E. coli strain 14H4 isolated from colon cancer (Table 6). Of note, none of the B2 E. coli strains tested was positive for eae gene coding for intimin of enteropathogenic E. coli or for aaf gene coding for the adhesive factor AAF of enteroaggregative E. coli, indicating that B2 E. coli strains studied do not belong to these E. coli pathovars. Analysis of the ability of bacteria to invade I-407 cells showed that whatever the origin of the B2 E. coli strains their invasion levels were very low, ranging from 0.02% to 1.49%, except strain 14H4, for which invasion level was similar to that of the AIEC strain LF82 (Figure 1B).

Figure 1
Figure 1 Adhesion, invasion and ability to induce carcinoembryonic antigen-related cell adhesion molecule 6 expression of B2 Escherichia coli strains. A and B: Ability of colon cancer- and diverticulosis-associated B2 Escherichia coli (E. coli) strains and AIEC strain LF82 to adhere to and to invade I-407 intestinal epithelial cells. A: Adhesion. Results are expressed as number of associated bacteria per cell after 3 h of infection; B: Invasion. Results are expressed as percentage of inoculum surviving after 3 h of infection and 1 h of gentamicin treatment; C and D: Induction of carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) expression in colon epithelial T84 cells infected for 6h with colon cancer- and diverticulosis-associated B2 E. coli strains and AIEC strain LF82. C: Quantitative dosage of CEACAM6 by ELISA. Results are expressed as amounts of CEACAM6 in stimulated or infected cells relative to untreated cells. aP≤ 0.05 vs diverticulosis associated E. coli. D: CEACAM6 expression analysis by Western Blot. E. coli strains 11G5 and 14H4 were isolated from colon cancer patients and E. coli strains 9F1 and 15C1 from patients with diverticulosis.

We also investigated the ability of B2 E. coli isolated from colon cancer to induce CEACAM6 expression as abnormal CEACAM6 expression was shown to promote gut colonization by AIEC[36] and AIEC bacteria were reported to be able to induce increased CEACAM6 expression in intestinal epithelial cells[28]. A quantitative analysis of the level of CEACAM6 expression by T84 intestinal epithelial cells in response to B2 E. coli infection was determined by ELISA (Figure 1C) and Western blot (Figure 1D). Interestingly, we observed that most of B2 E. coli strains isolated from colon cancer induced increased expression of CEACAM6 to a level similar to that of AIEC strain LF82. Of note, B2 E. coli strains isolated from diverticulosis induced no or very low expression of CEACAM6 in T84 cells.

Another important bacterial trait involved in the colonization of the intestinal mucosa by gut resident bacteria is their ability to form biofilm. This property was investigated both on abiotic and on fixed intestinal epithelial cells. The level of biofilm formation on abiotic surface was evaluated by calculating the specific biofilm formation index (SBF). An SBF index of 3.13 ± 0.23 was obtained for AIEC strain LF82 compared to 0.99 ± 0.22 for the non-pathogenic K-12 E. coli strain C600 (Figure 2A). We observed that 7/19 (37%) B2 E. coli strains isolated from colon cancer and 2/8 (25%) B2 E. coli strains isolated from diverticulosis harbored SBF index similar to that of the biofilm producer AIEC strain LF82 (P≥ 0.05). Biofilm formation on fixed I-407 intestinal epithelial cells was evaluated by confocal microscopy (Figure 2B), which confirmed that 6/9 B2 E. coli strains having a high SBF index on abiotic surface were able to form a strong biofilm on fixed I-407 cultured cells. Combining the two methods of biofilm formation assessment, 16/27 B2 E. coli strains tested were able to form biofilm. This shows that even B2 E. coli strains have a low ability to adhere to intestinal epithelial cells, at least half of them were able to form biofilm to a level similar to that of CD-associated E. coli strain LF82 known to form a strong biofilm and no difference was observed between B2 E. coli strains isolated from colon cancer patients or from patients with diverticulosis.

Figure 2
Figure 2 Ability of B2 Escherichia coli strains to form biofilm. Biofilm formation of colon cancer-associated and diverticulosis-associated B2 Escherichia coli (E. coli) were compared to that of the non-pathogenic K-12 E. coli strain C600 and the biofilm producer AIEC strain LF82. A: Biofilm formation on abiotic surface. Results are expressed as specific biofilm formation (SBF) index; B: Biofilm formation on human I-407 intestinal epithelial cells. E. coli strain 11G5 was isolated from a patient with colon cancer and E. coli strain 12H1 from a patient with diverticulosis. Bacteria were stained using goat anti-E. coli polyclonal antibodies (green) and I-407 cells were labeled for actin cytoskeleton using TRITC-labeled phalloidin (red). Y- and Z-stack projections are presented.

Colonization of colon mucosa in CEACAM-expressing mice by colon cancer-associated B2 E. coli strain 11G5: induction of inflammation and enhanced epithelial intestinal cell proliferation

CEABAC10 mice harboring a bacterial artificial chromosome that contains part of the human CEA family gene cluster including the CEACAM6 gene were infected with AIEC reference strain LF82 or B2 E. coli strain 11G5 isolated from colon cancer patient. To assess bacterial colonization, the levels of bacteria in the stools were determined 5 d after the last infection of each cycle, over the 8 consecutive cycles of infection. Analysis of the number of bacteria recovered in the stools at cycle 4 and cycle 8 revealed similar (P = 0.78) colonization levels for mice infected with AIEC LF82 and colon cancer-associated 11G5 bacteria (Figure 3A).

Figure 3
Figure 3 Impact of CEABAC10 mice colonization by B2 Escherichia coli strain on inflammation and cell proliferation. CEABAC10 mice transgenic for human CEACAMs, including CEACAM6, were subjected to 8 consecutive cycles of infection with AIEC LF82 or B2 phylogroup Escherichia coli (E. coli) strain 11G5. Control mice received PBS. A: Quantification of the number of bacteria in the feces of mice at cycle 4 and cycle 8; B: Histopathological scoring for several parameters of inflammation and epithelial damages (see Table 2) was performed at the end of the 8th cycle. aP≤ 0.05 vs control; P = NS vs LF82; C: Hematoxylin/eosin/safran (HES) staining of colonic tissue sections; D: Total RNAs from colons were extracted at the end of the 8th cycle. PCNA and S26 mRNA levels were measured by RT-qPCR. PCNA amount relative to S26 is presented. aP≤ 0.05 vs control; cP≤ 0.05 vs LF82; E: Immunohistochemistry examination of Ki67 on colonic tissue sections. NS: Not significant.

On macroscopic examination, no sign of tumor development such as neoplasia or polyp was observed in the colon of mice infected with AIEC strain LF82 or colon cancer-associated 11G5 E. coli strain. Histological analysis showed a similar colonic histological score for inflammation and epithelial damages for mice infected with AIEC strain LF82 and E. coli strain 11G5 (P≥ 0.05) (Figure 3B). Mice infected with E. coli strains LF82 and 11G5 exhibited infiltration of polynuclear cells in crypts, larger numbers of crypt abscesses and large and multifocal erosion plates (Figure 3C).

The level of proliferating cell nuclear antigen (PCNA) mRNA was measured in the colonic mucosa of infected mice to determine the proliferative index (Figure 3D). Significant (P≤ 0.05) 2.5-fold and 2.9-fold increases in PCNA mRNA levels were observed in the colonic mucosa of mice infected with the E. coli strain 11G5 compared to those of control mice or mice infected with AIEC strain LF82, respectively. This finding was confirmed by Ki67 immunostaining on colonic mucosa tissue. 11G5-infected mice had higher numbers of proliferative epithelial cells in crypts than control mice and mice infected with AIEC strain LF82 (Figure 3E). This indicates that colonic mucosa cells undergo accelerated proliferation in response to infection by B2 E. coli strain 11G5 associated with colon cancer.

DISCUSSION

Accumulating evidence supports the involvement of infectious agents in the development of cancer, especially in organs that are continuously exposed to microorganisms such as the colon. Remodeling of the colonic microbiota due to environmental changes is thought to contribute to the pathogenesis of colon cancer by suppressing the growth of cancer-protective bacterial species and allowing the emergence or expansion of bacterial species with oncogenic potential. It has been suggested that the role of E. coli in CRC promotion and development is linked to chronic inflammation, which can result from bacterial infection via its effects on both the host and the microbiota, in particular that of promoting the expansion of certain bacteria, such as pro-inflammatory E. coli[37] or ETBF[38,39]. In parallel, two different studies have reported that between 71% and 82% of patients with colonic adenoma or carcinoma[10,12] are highly colonized by mucosa-associated E. coli compared to controls. The aim of the present study was to provide further insight into the characterization of the E. coli colonizing the mucosa of colon cancer patients.

It is well documented that B2 E. coli harbors genes coding for cyclomodulins such as colibactin, which is encoded by the pks genomic island, CDT, CNF or Cif, which can act as genotoxic agents and/or can modulate cellular differentiation, apoptosis, and proliferation[13,40,41]. In the present study, we observed that 86% of cyclomodulin-positive E. coli isolated from colon cancer and diverticulosis specimens belonged to B2 phylogroup. Of interest, all but two cnf positive strains also harbored pks and all cnf- and pks-positive E. coli strains belonged to the B2 phylogroup. Our results are in good agreement with those reported by Arthur et al[3], who observed that 66.7% of patients with CRC and 20.8% of controls harbored pks-positive E. coli.

E. coli strains belonging to B2 phylogroup have a greater ability to colonize the human gut, due, at least in part, to accumulation of genes encoding fitness factors such as pili and adhesins[42,43]. In addition, an increased proportion of mucosa-associated E. coli expressing hemagglutinins was observed in CD patients (39%) and colon cancer patients (38%) compared to controls (4%), in correlation with the ability of bacteria to adhere to I-407 and HT-29 intestinal epithelial cells[10]. However in our study, analysis of the adhesive abilities of B2 E. coli isolated from colon cancer or diverticulosis revealed that the strains were poorly adherent to I-407, even if the majority of them were able to form biofilm. However some B2 E. coli strains isolated from colon cancer induced increased expression of CEACAM6 to a level similar to that of AIEC strain LF82 associated with CD, indicating that colon cancer-associated E. coli could influence carcinogenesis, since CEACAM6 has been implicated in cellular adhesiveness, invasiveness, and metastatic behavior of tumor cells[30,44]. In addition, this result indicates that, in agreement with what we previously reported for AIEC strains isolated from CD patients[28], colon cancer-associated E. coli strains could have the ability to promote their own colonisation since CEACAM6 serves as a receptor for mediating adherence and/or cell entry of pathogenic bacteria such as Neisseria bacteria[45], diffusely-adhering E. coli (DAEC)[46] or AIEC[28].

Experiments of long-term colonization of CEABAC10 mice revealed that an E. coli strain isolated from colon cancer (strain 11G5) was able to persist in the gut of CEABAC10 transgenic mice expressing human CEACAMs, including CEACAM6 and to exacerbate colonic inflammation. Whether colonisation of the intestinal mucosa of colon cancer patients by B2 E. coli is a cause or a consequence of malignant transformation is a question that has yet to be addressed. We show here that B2 phylogroup E. coli isolated from colon cancer increased the proliferative index of epithelial cells in crypts in the chronic infection model of CEABAC10 mice. This indicates that colonic mucosa cells undergo accelerated proliferation in response to infection by B2 E. coli. The ability to induce cell proliferation is a common trait of various pathogens involved in carcinogenesis. Indeed, Bacteroides fragilis enterotoxin induces c-myc transcription and translation and persistent cellular proliferation ensues, mediated in part by β-catenin/T-cell factor-dependent transcriptional activation[47]. Another example is Helicobacter pylori (H. pylori), which increases the proliferation of gastric cancer cells. This process is dependent on the LPS-TLR4 pathway since H. pylori LPS induces the proliferation of gastric cancer cells and the use of neutralizing antibody against TLR4 almost completely abrogates the proliferative activities of cancer cells[48]. Some cyclomodulins, such as CNF, which are mostly produced by B2 E. coli, induce epithelial cell proliferation[40]. In our study the B2 E. coli strain 11G5 did not harbor the cnf genes and was able to promote cell proliferation as observed in infected CEABAC10 mice. This effect could be related to E. coli-derived LPS, which was previously reported to have a more remarkable cancer proliferative activity than H. pylori-derived LPS[48]. Because E. coli inhabits the host colon as normal intestinal flora, owing to host tolerance toward E. coli, it is likely that E. coli LPS stimulates the host cellular immune response to prevent cancer progression. However, we can hypothesize that when too great a load of E. coli colonize the colonic mucosa, as observed in 11G5-infected CEABAC10 mice, potent tumor proliferative activity is no longer effectively repressed. The cell proliferation observed in 11G5-infected CEABAC10 mice could also result from the presence of colibactin. Colibactin with its genotoxic activity promotes DNA damages, which leads to carcinogenesis and cell proliferation.

In conclusion, B2 E. coli abnormally colonized the mucosa of colon cancer patients, indicating that microbiota remodeling had occurred promoting their expansion. Together with previous findings reported by Arthur et al[3], this study on a larger cohort of patients confirms the high prevalence of B2 pks-positive or pks-cnf-positive E. coli in colon cancer patients. The study also indicates that, these bacteria can promote low grade inflammation and cell proliferation, as shown in the CEABAC10 infected mouse model. Analyses to determine whether these bacteria take advantage of the tumor microenvironment to colonize the gut or promote their own colonization may be an important step in understanding their role in carcinogenesis and in the development of therapeutic strategies.

ACKNOWLEDGMENTS

We thank Emmanuel Bourgeois for his help in immunohistochemical staining and Cécile Charpy for her help in their interpretation. We thank ICCF platforms from Université d’Auvergne for confocal microscopy.

COMMENTS
Background

Colorectal cancer (CRC) is one of the most prevalent cancers worldwide, and is the fourth leading cause of cancer death worldwide. Inflammation and changes in composition and function of gut microbial communities are suspected to be causative factors in the development of sporadic CRC.

Research frontiers

The authors and other researchers have reported abnormal colonization of tumors and mucosa of colon cancer patients by Escherichia coli (E. coli) belonging to B2 phylogroup.

Innovations and breakthroughs

To date, there has been a limited number of studies analyzing interaction of colon cancer-associated E. coli to intestinal epithelial cells. The authors showed that colon cancer-associated E. coli induce expression of the carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) receptor in intestinal epithelial cells, and that these bacteria were able to persist in a chronic infection model of CEACAM6 expressing mice and had oncogenic potential.

Applications

The authors have analyzed the ability of colon cancer-associated E. coli to colonize gut mucosa and influence carcinogenesis. Analyses to determine whether these bacteria take advantage of the tumor microenvironment to colonize the gut or promote their own colonization may be an important step in understanding their role in carcinogenesis and in the development of therapeutic strategies.

Terminology

CEACAM6 molecule serves as a receptor for mediating mucosa colonization by pathogenic bacteria.

Peer review

This study provides evidence supporting the hypothesis that colon cancer-associated E. coli are able to colonize gut mucosa and to induce cell proliferation in a mouse model with overexpression of human CEACAM6.

References
1.  World Health Organization World WHO Global Malaria Programme. Switzerland: World Health Organization 2011;  Available from: http://www.who.int/malaria/world_malaria_report_2011/9789241564403_eng.pdf.  [PubMed]  [DOI]
2.  Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, Nakamura Y, White R, Smits AM, Bos JL. Genetic alterations during colorectal-tumor development. N Engl J Med. 1988;319:525-532.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4998]  [Cited by in RCA: 4418]  [Article Influence: 116.3]  [Reference Citation Analysis (5)]
3.  Arthur JC, Perez-Chanona E, Mühlbauer M, Tomkovich S, Uronis JM, Fan TJ, Campbell BJ, Abujamel T, Dogan B, Rogers AB. Intestinal inflammation targets cancer-inducing activity of the microbiota. Science. 2012;338:120-123.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1978]  [Cited by in RCA: 1767]  [Article Influence: 126.2]  [Reference Citation Analysis (18)]
4.  Mantovani A, Allavena P, Sica A, Balkwill F. Cancer-related inflammation. Nature. 2008;454:436-444.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9061]  [Cited by in RCA: 8571]  [Article Influence: 476.2]  [Reference Citation Analysis (7)]
5.  Uronis JM, Jobin C. Microbes and colorectal cancer: is there a relationship? Curr Oncol. 2009;16:22-24.  [PubMed]  [DOI]
6.  Sears CL, Pardoll DM. Perspective: alpha-bugs, their microbial partners, and the link to colon cancer. J Infect Dis. 2011;203:306-311.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 211]  [Cited by in RCA: 196]  [Article Influence: 13.1]  [Reference Citation Analysis (6)]
7.  Tjalsma H, Boleij A, Marchesi JR, Dutilh BE. A bacterial driver-passenger model for colorectal cancer: beyond the usual suspects. Nat Rev Microbiol. 2012;10:575-582.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 759]  [Cited by in RCA: 713]  [Article Influence: 50.9]  [Reference Citation Analysis (5)]
8.  Sobhani I, Tap J, Roudot-Thoraval F, Roperch JP, Letulle S, Langella P, Corthier G, Tran Van Nhieu J, Furet JP. Microbial dysbiosis in colorectal cancer (CRC) patients. PLoS One. 2011;6:e16393.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 698]  [Cited by in RCA: 624]  [Article Influence: 41.6]  [Reference Citation Analysis (11)]
9.  Kostic AD, Gevers D, Pedamallu CS, Michaud M, Duke F, Earl AM, Ojesina AI, Jung J, Bass AJ, Tabernero J. Genomic analysis identifies association of Fusobacterium with colorectal carcinoma. Genome Res. 2012;22:292-298.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1728]  [Cited by in RCA: 1564]  [Article Influence: 111.7]  [Reference Citation Analysis (10)]
10.  Martin HM, Campbell BJ, Hart CA, Mpofu C, Nayar M, Singh R, Englyst H, Williams HF, Rhodes JM. Enhanced Escherichia coli adherence and invasion in Crohn’s disease and colon cancer. Gastroenterology. 2004;127:80-93.  [PubMed]  [DOI]
11.  Maddocks OD, Short AJ, Donnenberg MS, Bader S, Harrison DJ. Attaching and effacing Escherichia coli downregulate DNA mismatch repair protein in vitro and are associated with colorectal adenocarcinomas in humans. PLoS One. 2009;4:e5517.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 120]  [Cited by in RCA: 107]  [Article Influence: 6.3]  [Reference Citation Analysis (11)]
12.  Swidsinski A, Khilkin M, Kerjaschki D, Schreiber S, Ortner M, Weber J, Lochs H. Association between intraepithelial Escherichia coli and colorectal cancer. Gastroenterology. 1998;115:281-286.  [PubMed]  [DOI]
13.  Nougayrède JP, Homburg S, Taieb F, Boury M, Brzuszkiewicz E, Gottschalk G, Buchrieser C, Hacker J, Dobrindt U, Oswald E. Escherichia coli induces DNA double-strand breaks in eukaryotic cells. Science. 2006;313:848-851.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1028]  [Cited by in RCA: 908]  [Article Influence: 45.4]  [Reference Citation Analysis (8)]
14.  Wu S, Rhee KJ, Albesiano E, Rabizadeh S, Wu X, Yen HR, Huso DL, Brancati FL, Wick E, McAllister F. A human colonic commensal promotes colon tumorigenesis via activation of T helper type 17 T cell responses. Nat Med. 2009;15:1016-1022.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1513]  [Cited by in RCA: 1392]  [Article Influence: 81.9]  [Reference Citation Analysis (9)]
15.  Goodwin AC, Destefano Shields CE, Wu S, Huso DL, Wu X, Murray-Stewart TR, Hacker-Prietz A, Rabizadeh S, Woster PM, Sears CL. Polyamine catabolism contributes to enterotoxigenic Bacteroides fragilis-induced colon tumorigenesis. Proc Natl Acad Sci USA. 2011;108:15354-15359.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 553]  [Cited by in RCA: 481]  [Article Influence: 32.1]  [Reference Citation Analysis (31)]
16.  Bernstein CN, Blanchard JF, Kliewer E, Wajda A. Cancer risk in patients with inflammatory bowel disease: a population-based study. Cancer. 2001;91:854-862.  [PubMed]  [DOI]
17.  Ullman TA, Itzkowitz SH. Intestinal inflammation and cancer. Gastroenterology. 2011;140:1807-1816.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 943]  [Cited by in RCA: 889]  [Article Influence: 59.3]  [Reference Citation Analysis (6)]
18.  Martinez-Medina M, Aldeguer X, Gonzalez-Huix F, Acero D, Garcia-Gil LJ. Abnormal microbiota composition in the ileocolonic mucosa of Crohn’s disease patients as revealed by polymerase chain reaction-denaturing gradient gel electrophoresis. Inflamm Bowel Dis. 2006;12:1136-1145.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 212]  [Cited by in RCA: 194]  [Article Influence: 9.7]  [Reference Citation Analysis (1)]
19.  Frank DN, St Amand AL, Feldman RA, Boedeker EC, Harpaz N, Pace NR. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc Natl Acad Sci USA. 2007;104:13780-13785.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3891]  [Cited by in RCA: 3483]  [Article Influence: 183.3]  [Reference Citation Analysis (7)]
20.  Sokol H, Pigneur B, Watterlot L, Lakhdari O, Bermúdez-Humarán LG, Gratadoux JJ, Blugeon S, Bridonneau C, Furet JP, Corthier G. Faecalibacterium prausnitzii is an anti-inflammatory commensal bacterium identified by gut microbiota analysis of Crohn disease patients. Proc Natl Acad Sci USA. 2008;105:16731-16736.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3775]  [Cited by in RCA: 3384]  [Article Influence: 188.0]  [Reference Citation Analysis (7)]
21.  Swidsinski A, Ladhoff A, Pernthaler A, Swidsinski S, Loening-Baucke V, Ortner M, Weber J, Hoffmann U, Schreiber S, Dietel M. Mucosal flora in inflammatory bowel disease. Gastroenterology. 2002;122:44-54.  [PubMed]  [DOI]
22.  Mylonaki M, Rayment NB, Rampton DS, Hudspith BN, Brostoff J. Molecular characterization of rectal mucosa-associated bacterial flora in inflammatory bowel disease. Inflamm Bowel Dis. 2005;11:481-487.  [PubMed]  [DOI]
23.  Baumgart M, Dogan B, Rishniw M, Weitzman G, Bosworth B, Yantiss R, Orsi RH, Wiedmann M, McDonough P, Kim SG. Culture independent analysis of ileal mucosa reveals a selective increase in invasive Escherichia coli of novel phylogeny relative to depletion of Clostridiales in Crohn’s disease involving the ileum. ISME J. 2007;1:403-418.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 535]  [Cited by in RCA: 491]  [Article Influence: 25.8]  [Reference Citation Analysis (2)]
24.  Kotlowski R, Bernstein CN, Sepehri S, Krause DO. High prevalence of Escherichia coli belonging to the B2+D phylogenetic group in inflammatory bowel disease. Gut. 2007;56:669-675.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 344]  [Cited by in RCA: 324]  [Article Influence: 17.1]  [Reference Citation Analysis (3)]
25.  Darfeuille-Michaud A, Neut C, Barnich N, Lederman E, Di Martino P, Desreumaux P, Gambiez L, Joly B, Cortot A, Colombel JF. Presence of adherent Escherichia coli strains in ileal mucosa of patients with Crohn’s disease. Gastroenterology. 1998;115:1405-1413.  [PubMed]  [DOI]
26.  Boudeau J, Glasser AL, Masseret E, Joly B, Darfeuille-Michaud A. Invasive ability of an Escherichia coli strain isolated from the ileal mucosa of a patient with Crohn’s disease. Infect Immun. 1999;67:4499-4509.  [PubMed]  [DOI]
27.  Darfeuille-Michaud A, Boudeau J, Bulois P, Neut C, Glasser AL, Barnich N, Bringer MA, Swidsinski A, Beaugerie L, Colombel JF. High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohn’s disease. Gastroenterology. 2004;127:412-421.  [PubMed]  [DOI]
28.  Barnich N, Carvalho FA, Glasser AL, Darcha C, Jantscheff P, Allez M, Peeters H, Bommelaer G, Desreumaux P, Colombel JF. CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease. J Clin Invest. 2007;117:1566-1574.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 473]  [Cited by in RCA: 446]  [Article Influence: 23.5]  [Reference Citation Analysis (4)]
29.  Schölzel S, Zimmermann W, Schwarzkopf G, Grunert F, Rogaczewski B, Thompson J. Carcinoembryonic antigen family members CEACAM6 and CEACAM7 are differentially expressed in normal tissues and oppositely deregulated in hyperplastic colorectal polyps and early adenomas. Am J Pathol. 2000;156:595-605.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 128]  [Cited by in RCA: 152]  [Article Influence: 5.8]  [Reference Citation Analysis (1)]
30.  Kim KS, Kim JT, Lee SJ, Kang MA, Choe IS, Kang YH, Kim SY, Yeom YI, Lee YH, Kim JH. Overexpression and clinical significance of carcinoembryonic antigen-related cell adhesion molecule 6 in colorectal cancer. Clin Chim Acta. 2013;415:12-19.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 45]  [Cited by in RCA: 51]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
31.  Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 1991;19:6823-6831.  [PubMed]  [DOI]
32.  Wang G, Whittam TS, Berg CM, Berg DE. RAPD (arbitrary primer) PCR is more sensitive than multilocus enzyme electrophoresis for distinguishing related bacterial strains. Nucleic Acids Res. 1993;21:5930-5933.  [PubMed]  [DOI]
33.  Bidet P, Metais A, Mahjoub-Messai F, Durand L, Dehem M, Aujard Y, Bingen E, Nassif X, Bonacorsi S. Detection and identification by PCR of a highly virulent phylogenetic subgroup among extraintestinal pathogenic Escherichia coli B2 strains. Appl Environ Microbiol. 2007;73:2373-2377.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 39]  [Cited by in RCA: 43]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
34.  Chassaing B, Darfeuille-Michaud A. The σE pathway is involved in biofilm formation by Crohn’s disease-associated adherent-invasive Escherichia coli. J Bacteriol. 2013;195:76-84.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 30]  [Article Influence: 2.3]  [Reference Citation Analysis (1)]
35.  Chan CH, Stanners CP. Novel mouse model for carcinoembryonic antigen-based therapy. Mol Ther. 2004;9:775-785.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 71]  [Article Influence: 3.4]  [Reference Citation Analysis (1)]
36.  Carvalho FA, Barnich N, Sivignon A, Darcha C, Chan CH, Stanners CP, Darfeuille-Michaud A. Crohn’s disease adherent-invasive Escherichia coli colonize and induce strong gut inflammation in transgenic mice expressing human CEACAM. J Exp Med. 2009;206:2179-2189.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 264]  [Cited by in RCA: 257]  [Article Influence: 15.1]  [Reference Citation Analysis (8)]
37.  Mukhopadhya I, Hansen R, El-Omar EM, Hold GL. IBD-what role do Proteobacteria play? Nat Rev Gastroenterol Hepatol. 2012;9:219-230.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 709]  [Cited by in RCA: 620]  [Article Influence: 44.3]  [Reference Citation Analysis (0)]
38.  Sears CL. Enterotoxigenic Bacteroides fragilis: a rogue among symbiotes. Clin Microbiol Rev. 2009;22:349-369, Table of Contents.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 364]  [Cited by in RCA: 327]  [Article Influence: 19.2]  [Reference Citation Analysis (7)]
39.  Toprak NU, Yagci A, Gulluoglu BM, Akin ML, Demirkalem P, Celenk T, Soyletir G. A possible role of Bacteroides fragilis enterotoxin in the aetiology of colorectal cancer. Clin Microbiol Infect. 2006;12:782-786.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 381]  [Cited by in RCA: 332]  [Article Influence: 16.6]  [Reference Citation Analysis (7)]
40.  Nougayrède JP, Taieb F, De Rycke J, Oswald E. Cyclomodulins: bacterial effectors that modulate the eukaryotic cell cycle. Trends Microbiol. 2005;13:103-110.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 161]  [Cited by in RCA: 176]  [Article Influence: 8.4]  [Reference Citation Analysis (10)]
41.  Collins D, Hogan AM, Winter DC. Microbial and viral pathogens in colorectal cancer. Lancet Oncol. 2011;12:504-512.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 98]  [Cited by in RCA: 134]  [Article Influence: 8.9]  [Reference Citation Analysis (1)]
42.  Picard B, Garcia JS, Gouriou S, Duriez P, Brahimi N, Bingen E, Elion J, Denamur E. The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect Immun. 1999;67:546-553.  [PubMed]  [DOI]
43.  Nowrouzian FL, Adlerberth I, Wold AE. Enhanced persistence in the colonic microbiota of Escherichia coli strains belonging to phylogenetic group B2: role of virulence factors and adherence to colonic cells. Microbes Infect. 2006;8:834-840.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 139]  [Cited by in RCA: 124]  [Article Influence: 6.2]  [Reference Citation Analysis (0)]
44.  Ilantzis C, DeMarte L, Screaton RA, Stanners CP. Deregulated expression of the human tumor marker CEA and CEA family member CEACAM6 disrupts tissue architecture and blocks colonocyte differentiation. Neoplasia. 2002;4:151-163.  [PubMed]  [DOI]  [Full Text]
45.  Bos MP, Grunert F, Belland RJ. Differential recognition of members of the carcinoembryonic antigen family by Opa variants of Neisseria gonorrhoeae. Infect Immun. 1997;65:2353-2361.  [PubMed]  [DOI]
46.  Guignot J, Hudault S, Kansau I, Chau I, Servin AL. Human decay-accelerating factor and CEACAM receptor-mediated internalization and intracellular lifestyle of Afa/Dr diffusely adhering Escherichia coli in epithelial cells. Infect Immun. 2009;77:517-531.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 21]  [Cited by in RCA: 23]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
47.  Wu S, Morin PJ, Maouyo D, Sears CL. Bacteroides fragilis enterotoxin induces c-Myc expression and cellular proliferation. Gastroenterology. 2003;124:392-400.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 338]  [Cited by in RCA: 314]  [Article Influence: 13.7]  [Reference Citation Analysis (11)]
48.  Chochi K, Ichikura T, Kinoshita M, Majima T, Shinomiya N, Tsujimoto H, Kawabata T, Sugasawa H, Ono S, Seki S. Helicobacter pylori augments growth of gastric cancers via the lipopolysaccharide-toll-like receptor 4 pathway whereas its lipopolysaccharide attenuates antitumor activities of human mononuclear cells. Clin Cancer Res. 2008;14:2909-2917.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 80]  [Cited by in RCA: 76]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
49.  Le Bouguénec C, Lalioui L, du Merle L, Jouve M, Courcoux P, Bouzari S, Selvarangan R, Nowicki BJ, Germani Y, Andremont A. Characterization of AfaE adhesins produced by extraintestinal and intestinal human Escherichia coli isolates: PCR assays for detection of Afa adhesins that do or do not recognize Dr blood group antigens. J Clin Microbiol. 2001;39:1738-1745.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 80]  [Cited by in RCA: 75]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
50.  Bernier C, Gounon P, Le Bouguénec C. Identification of an aggregative adhesion fimbria (AAF) type III-encoding operon in enteroaggregative Escherichia coli as a sensitive probe for detecting the AAF-encoding operon family. Infect Immun. 2002;70:4302-4311.  [PubMed]  [DOI]
51.  Dubois D, Delmas J, Cady A, Robin F, Sivignon A, Oswald E, Bonnet R. Cyclomodulins in urosepsis strains of Escherichia coli. J Clin Microbiol. 2010;48:2122-2129.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 65]  [Article Influence: 4.1]  [Reference Citation Analysis (0)]
Footnotes

P- Reviewers: Bommireddy R, De Nardi P, Kurniali PC, Lee KY S- Editor: Ma YJ L- Editor: A E- Editor: Wang CH

Write to the Help Desk