BPG is committed to discovery and dissemination of knowledge
Brief Article Open Access
©2014 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Jan 7, 2014; 20(1): 219-227
Published online Jan 7, 2014. doi: 10.3748/wjg.v20.i1.219
Susceptibility to ulcerative colitis in Hungarian patients determined by gene-gene interactions
Patricia Sarlos, 1st Department of Internal Medicine, University of Pecs, 7623 Pecs, Hungary
Dalma Varszegi, Department of Dermatology, Venereology and Oncodermatology, University of Pecs, 7624 Pecs, Hungary
Veronika Csongei, Department of Immunology and Biotechnology, University of Pecs, 7624 Pecs, Hungary
Lili Magyari, Luca Jaromi, Bela Melegh, Department of Medical Genetics, University of Pecs, 7624 Pecs, Hungary
Veronika Csongei, Lili Magyari, Luca Jaromi, Bela Melegh, Szentagothai Research Centre, 7624 Pecs, Hungary
Lajos Nagy, Institute of Family Medicine, University of Pecs, 7632 Pecs, Hungary
Author contributions: Sarlos P, Varszegi D, Csongei V, Magyari L, Jaromi L, Nagy L and Melegh B contributed equally to this work; Sarlos P, and Nagy L wrote the manuscript; Sarlos P, Csongei V, and Jaromi L performed the statistical analyses; Varszegi D, Magyari L and Melegh B carried out the experiments.
Supported by The Grant of the Hungarian Science Foundation Nos. OTKA K103983 and T73430
Correspondence to: Bela Melegh, MD, PhD, DSc, Department of Medical Genetics, University of Pecs, Szigeti 12, 7624 Pecs, Hungary. bela.melegh@aok.pte.hu
Telephone: +36-72-536427 Fax: +36-72-536427
Received: August 28, 2013
Revised: September 29, 2013
Accepted: December 13, 2013
Published online: January 7, 2014
Processing time: 144 Days and 18.9 Hours

Abstract

AIM: To study the inflammatory bowel disease-5 locus (IBD5) and interleukin-23 receptor (IL23R) gene variants in UC patients and test for gene-gene interaction.

METHODS: The study population (n = 625) was comprised of 320 unrelated ulcerative colitis (UC) patients with Caucasian origin and 316 age- and gender-matched, healthy controls. Five variants in the IBD5 locus (IGR2198a_1 rs11739135, IGR2096a_1 rs12521868, IGR2230a_1 rs17622208, SLC22A4 rs1050152 and SLC22A5 rs2631367) and two of the IL23R gene (rs1004819, rs2201841) were analysed. PCR and restriction fragment length polymorphism methods were used for genotyping, the SLC22A4 rs1050152 genotypes were determined by direct sequencing. Interactions and specific genotype combinations of the seven variants were tested by binary logistic regression analysis. The IL23R genotypes were stratified by IBD5 genotypes for further interaction analyses.

RESULTS: For the IL23R rs1004819 A allele we found significantly higher allele frequency (P = 0.032) in UC patients compared to control subjects. The SNP rs1004819 showed significant association with UC risk for carriers (P = 0.004, OR = 1.606; 95%CI: 1.160-2.223) and the SNP rs2201841 for homozygotes (P = 0.030, OR = 1.983; 95%CI: 1.069-3.678). Individually none of the IBD5 markers conferred risk to UC development. There was no evidence for statistical interaction either between IBD5 loci and IL23R genes using logistic regression analysis. After genotype stratification, we could detect a positive association on the background of rs1004819 A allele for SLC22A4 T, SLC22A5 C, IGR2198a_1 C or IGR2096a_1 T allele, the highest OR was calculated in the presence of SLC22A4 T allele (P = 0.005, OR = 2.015; 95%CI: 1.230-3.300). There was no association with UC for any combinations of rs1004819 and IGR2230a_1. The IL23R rs2201841 homozygous genotype and IBD5 carrier status together did not confer susceptibility for UC.

CONCLUSION: The present study has shown that UC susceptibility genes are likely to act in a complex interactive manner similar to CD.

Key Words: Gene-gene interaction; Interleukin-23 receptor gene; Inflammatory bowel disease-5 locus; Ulcerative colitis; Inflammatory bowel disease

Core tip: Most of the identified inflammatory bowel disease genes individually have only modest effects on inflammatory bowel disease susceptibility, suggesting that complex interactions are more important. The authors investigated the gene-gene interactions of the inflammatory bowel disease-5 loci and IL23R susceptibility alleles in a Hungarian ulcerative colitis cohort. The exploration of high risk genotype combinations could further add to our knowledge about the development of ulcerative colitis and could facilitate the diagnosis of high-risk patients.



Core tip: Most of the identified inflammatory bowel disease genes individually have only modest effects on inflammatory bowel disease susceptibility, suggesting that complex interactions are more important. The authors investigated the gene-gene interactions of the inflammatory bowel disease-5 loci and IL23R susceptibility alleles in a Hungarian ulcerative colitis cohort. The exploration of high risk genotype combinations could further add to our knowledge about the development of ulcerative colitis and could facilitate the diagnosis of high-risk patients.


INTRODUCTION

Inflammatory bowel disease (IBD)-clinically classified as Crohn’s disease (CD; MIM 26600) or ulcerative colitis (UC; MIM 191390)-is a common chronic, relapsing inflammatory disorder of the gastrointestinal tract[1]. According to the consensus hypothesis, in genetically predisposed individuals the commensal luminal flora trigger an inappropriate, overactive mucosal immune response causing intestinal tissue damage that is further modified by specific environmental factors (e.g., smoking)[2]. Interestingly, the heritability of CD may be higher than that of UC[3].

Genome-wide association studies (GWAS) have resulted in the identification of many novel loci for CD initially and latterly for UC[4,5] which is thought to be more genetically heterogeneous than CD. To date, the number of known risk loci has expanded to 163[6]. The IBD-associated loci encode for genes involved in innate pattern recognition (NOD2/CARD15), autophagy (ATG16L1, IRGM), differentiation of Th17- T lymphocytes (IL23R), maintenance of epithelial barrier integrity (IBD5 locus), and coordination of adaptive immune responses (HLA-region)[7].

The most studied SNPs (SLC22A4, SLC22A5, IGR2096_a, IGR2198_a, IGR2230_a) on inflammatory bowel disease-5 (IBD5) locus (chromosome 5q31) have been reported to confer susceptibility to CD[8-11]. In some studies, including a GWAS meta-analysis[12], association with UC has also been established[13-16]. The interleukin-23 receptor (IL23R) gene was originally described as a CD susceptibility gene[17], but recently the association with UC has been also confirmed in three separate GWA studies[18-20].

Most of the identified genes individually have only modest effects on IBD susceptibility, suggesting that complex interactions are more important[21,22]. Epistasis, defined generally as gene-gene interactions, has become a hot topic in complex disease genetics in recent years[23] and can explain the lack of replication of single-locus results.

In previous single-locus association studies, the IBD5 loci[24,25] and IL23R[26,27] SNPs were examined in Hungarian IBD patients. The aim of our current work was to study the IL23R rs2201841 and rs1004819 SNPs in Hungarian UC population and to test for possible statistical interaction, stratifying the IL23R genotypes by IBD5 genotypes.

MATERIALS AND METHODS
Study subjects

The study population (n = 625) was comprised of 320 UC patients (men 42.8%, women 57.2%, age: 41.9 ± 14.3 years) and 316 healthy, unrelated controls (men 53.5%, women 46.5%, age: 46.52 ± 16.02 years). All patients and controls were Caucasian and of Hungarian origin. Sample collection started in 2003 in collaboration of the following participating Hungarian centers: 1st and 3rd Department of Internal Medicine, University of Pecs; Department of Medicine and Gastroenterology, Markusovszky Hospital, Szombathely; Department of Medicine and Gastroenterology, Rethy Pal Hospital, Bekescsaba; 2nd Department of Medicine, Semmelweis University, Budapest. The diagnosis of UC was determined according to established guidelines based on clinical, endoscopic, radiological and histopathological criteria[28]. Patients with indeterminate colitis were excluded from the study.

The control subjects were healthy blood donors and did not have any gastrointestinal or other autoimmune disorders. The origin of DNA samples was the central Biobank governed by the University of Pecs, as part of the National Biobank Network of Hungary (http://www.biobank.hu), which belongs also to the pan-European Biobanking and Biomolecular Resources Research Infrastructure (BBMRI) preparatory phase project (http://bbmri.eu/bbmri/).

Ethics statement

The study design was approved by the National Ethics Committee (ETT TUKEB) and adhered to the Ethical Principles for Medical Research Involving Human Subjects of the Helsinki Declaration (1975). Written, informed consent was obtained from all participants.

Genotyping

Genomic DNA was isolated from peripheral blood leukocytes with routine salting out method. For genotyping the variants of IBD5 locus [IGR2198a_1 (rs11739135), IGR2096a_1 (rs12521868), IGR2230a_1 (rs17622208) and SLC22A5 (rs2631367)] and IL23R (rs1004819, rs2201841) gene PCR-RFLP (restriction fragment length polymorphism) methods were applied, for the SLC22A4 (rs1050152) direct DNA sequencing was used by BigDye Terminator labeling with ABI 3100 automatic sequencer (Foster City, CA, United States). The primers designed and used are given in Table 1.

Table 1 Primer sequences for the analysed variants.
GeneSNPPrimers (5’-3’)
IL23Rrs1004819Forward: GCATTCTAGGACCGTTTTGG
Reverse: ATCTGGTGGAAATATGTGAAACCTA
IL23Rrs2201841Forward: GGCAAAAGGGAATTGAGAGG
Reverse: GGCCTATGATTATGCTTTTTCCTG1
SLC22A4rs1050152Forward: AGAGAGTCCTCCTATCTGATTG
Reverse: TCCTAGCTATTCTTCCATGC
SLC22A5rs2631367Forward: GCCGCTCTGCCTGCCAGC
Reverse: GGTCGCTATCAGGAACACGGAGGA
IGR2230a_1rs17622208 Forward: CAGAAGAATGCCCTTGATGTG
 Reverse: TCAGAAGCTGTCCATCCCAC
IGR2198a_1rs11739135 Forward: AGACACTGGGACATCATCTGTCTG
Reverse: GGGCAATTCTATGAGGACATTTAGA
IGR2096a_1rs12521868 Forward: CAAGATTTCTGCCATAGCCTCCT
Reverse: GGAGGGTGGTGTAGCCAGAGTAG

The PCR amplifications were performed on MJ Research PTC-200 thermal cyclers (Bio-Rad, Hercules, CA, United States). Amplification included an initial denaturation step (96 °C for 2 min) followed by 35 cycles of denaturation (95 °C for 30 s), annealing for 45 s at 54 °C (rs1004819, rs17622208, rs1050152), 55 °C (rs2201841), 58 °C (rs11739135, rs12521868, rs2631367), primer extension at 72 °C for 45 s and final extension at 72 °C for 5 min. Each polymerase chain reaction contained 200 μmol/L of each dNTP, 1 unit of Taq polymerase, 5 μL of reaction buffer (100 mmol/L Tris HCl, pH = 9.0; containing 500 mmol/L KCl, 15 mM MgCl2), 0.2 μmol/L of each primer and 1 μL DNA to be amplified in a final volume of 50 μL. The amplicons were digested by allele-specific restriction endonucleases Hin1II (rs11739135), TrulI(rs12521868), Ddel (rs17622208), HpaII (rs2631367), TaaI(rs1004819) and HpyF3I(rs2201841). The amplicon contained an obligate cleavage site of the restriction enzyme for the suitable visual control of the efficacy of the digestion. The restriction fragments were separated by electrophoresis on 3% agarose gels containing ethidium bromide and visualized by UV transillumination.

Statistical analysis

Each genetic marker was tested for Hardy-Weinberg equilibrium in the control population. Statistical analysis was carried out using SPSS 19.0 package for Windows (SPSS Inc, Chicago, IL, United States). Genotype and allele frequency differences between cases and controls were evaluated using Pearson’s χ2-test. Haploview 4.1 was used to test linkage disequilibrium. The r2 values for the tested IBD5 loci (IGR2198a_1, IGR2096a_1, IGR2230a_1, SCL22A4, SCL22A5) and for IL23R (rs1004819 and rs2201841) were below 0.8, for SCL22A4 and IGR2096a_1 the r² value was 0.9.

Binary logistic regression analysis was applied to observe the individual contributions of IBD5 and IL23R, and to test for pairwise statistical interaction. An association was considered significant if a P value of < 0.05 was attained. The IL23R genotypes were stratified by IBD5 genotypes. The odds ratios and confidence intervals for these specific combinations of IBD5 and IL23R were derived from χ2 in 2 × 2 contingency tables.

RESULTS
Single SNP marker association analysis of IBD5 and IL23R

We genotyped 5 candidate SNP variants for the IBD5 locus including the reported functional variants in the SLC22A4 and SLC22A5 transporter genes present on the risk haplotype and two SNP variants for IL23R. All of the investigated SNPs were in Hardy-Weinberg equilibrium in controls. Genotype distributions are shown in Table 2. For the IL23R rs1004819 A allele we found significantly higher allele frequency (P = 0.032) in UC patients compared to control subjects. The SNP rs1004819 showed significant association with UC risk for carriers (heterozygotes and homozygotes together, P = 0.004, OR = 1.606; 95%CI: 1.160-2.223) and the SNP rs2201841 for homozygotes (P = 0.030, OR = 1.983; 95%CI: 1.069-3.678). No significant association for any variants of IBD5 region and UC was observed.

Table 2 Case-control genotypes and allele frequencies of variants in IL23R and inflammatory bowel disease-5 locus n (%).
UC (n = 320)Controls (n = 316)OR (95%CI)1P value
IL23R (rs1004819)
GG126 (39.4)158 (50.0)
GA168 (52.5)134 (42.4)
GA + AA194 (60.6)158 (50.0)1.606 (1.160-2.223)a0.004a
AA26 (8.1)24 (7.6)1.254 (0.696-2.261)0.452
RAF0.3430.2870.032a
IL23R (rs2201841)
TT140 (43.8)155 (49.1)
TC150 (46.9)143 (45.3)
TC + CC180 (56.3)161 (51.0)1.268 (0.920-1.749)0.147
CC30 (9.4)18 (5.7)1.983 (1.069-3.678)a0.030a
RAF0.3280.2830.242
SLC22A4 (rs1050152)
CC93 (29.1)110 (34.8)
CT159 (49.7)148 (46.8)
CT + TT227 (71.0)206 (65.2)1.319 (0.935-1.86)0.115
TT68 (21.3)58 (18.4)1.150 (0.768-1.723)0.498
RAF0.460.4170.120
SLC22A5 (rs2631367)
GG83 (25.9)89 (28.2)
GC163 (50.9)156 (49.4)
GC + CC237 (74.0)227 (71.9)1.138 (0.794-1.631)0.481
CC74 (23.1)71 (22.5)0.982 (0.669-1.440)0.925
RAF0.4850.4710.607
IGR2230a_1 (rs17622208)
GG87 (27.2)90 (28.5)
AG160 (50.0)157 (49.7)
AG + AA233 (72.8)226 (71.5)1.073 (0.751-1.532)0.698
AA73 (22.8)69 (21.8)0.990 (0.673-1.457)0.960
RAF0.4780.4660.685
IGR2198a_1 (rs11739135)
GG105 (32.8)117 (37.0)
GC159 (49.7)150 (47.5)
GC + CC215 (67.2)199 (63.0)1.260 (0.900-1.763)0.179
CC56 (17.5)49 (15.5)1.169 (0.760-1.797)0.477
RAF0.4230.3920.260
IGR2096a_1 (rs12521868)
GG101 (31.6)117 (37.0)
GT164 (51.3)147 (46.5)
GT + TT219 (68.5)199 (63.0)1.256 (0.897-1.760)0.185
TT55 (17.2)52 (16.5)1.045 (0.680-1.608)0.840
RAF0.4280.3970.262
Gene-gene interaction analysis

We analyzed the possible statistical interactions by pairs of IL23R variants and IBD5 with binary logistic regression. No evidence of interactions between these seven markers was found. None of the P values was significant; the lowest P value was 0.084 (Table 3).

Table 3 Pairwise analysis of interactions of IBD5 and IL23R to risk of ulcerative colitis.
ModelOR (95%CI)P value
IL23R rs1004819 * IGR2230a_11.266 (0.627-2.553)0.51
IL23R rs1004819 * IGR2198a_11.383 (0.711-2.690)0.340
IL23R rs1004819 * IGR2096a_10.942 (0.625-1.420)0.776
IL23R rs1004819 * SLC22A41.017 (0.516-2.002)0.962
IL23R rs1004819 * SLC22A51.116 (0.549-2.270)0.761
IL23R rs2201841 Ho* IGR2230a_10.316 (0.080-1.247)0.100
IL23R rs2201841 Ho* IGR2198a_10.388 (0.105-1.430)0.155
IL23R rs2201841 Ho* IGR2096a_10.413 (0.117-1.458)0.169
IL23R rs2201841 Ho* SLC22A40.118 (0.095-1.301)0.352
IL23R rs2201841 Ho* SLC22A50.298 (0.075-1.179)0.084

Next, we stratified the IL23R genotypes by IBD5 genotypes and observed these specific genotype combinations of single markers by pairs, the combined odds ratios are shown in Table 4. The IL23R rs1004819 A variant did not show significant association with UC on the background of all wild type IBD5 genotypes, respectively. We could detect significantly elevated high odds ratios for rs1004819 A variant only in carriers of SLC22A4 T allele, SLC22A5 C, IGR2198a_1 C or IGR2096_a T allele. The combined OR seen in rs1004819 A and SLC22A5 C carriers (P = 0.048, OR = 1.691; 95%CI: 1.003-2.821) and the odds ratio for rs1004819 A in single gene analysis (P = 0.004, OR = 1.606; 95%CI: 1.160-2.223) were nearly equal while in combination with IGR2198a_1 C (P = 0.020, OR = 1.803; 95%CI: 1.096-2.966) and IGR2096_a T (P = 0.010, OR = 1.911; 95%CI: 1.162-3.143) the rs1004819 A variant showed higher disease risk. The highest OR value was calculated in the presence of SLC22A4 T allele (P = 0.005, OR = 2.015; 95%CI: 1.230-3.300). There was no association with UC for any combinations of rs1004819 and IGR2230a_1.

Table 4 Genotype-specific ulcerative colitis odds ratios (with 95%CI) for combinations of variants in IL23R and IBD5.
SLC22A4
SLC22A5
IGR2230a_1
IGR2198a_1
IGR2096a_1
CCCT + TTGGGC + CCGGAG + AAGGGC + CCGGGT + TT
IL23R rs1004819
GG11.29811.06410.94111.03311.104
(0.782-2.156)(0.623-1.815)(0.556-1.593)(0.623-1.711)(0.666-1.831)
P = 0.313P = 0.821P = 0.822P = 0.900P = 0.702
GA + AA1.52712.0151.42411.6911.3001.5491.26311.8031.28111.911
(0.872-2.673)(1.230-3.300)(0.776-2.614)(1.003-2.821)(0.716-2.359)(0.927-2.588)(0.736-2.166)(1.096-2.966)(0.744-2.206)(1.162-3.143)
P = 0.138P = 0.005P = 0.253P = 0.048P = 0.388P = 0.093P = 0.396P = 0.020P = 0.372P = 0.010
IL23R rs2201841
TT+TC11.32811.25411.18411.29611.385
(0.989-1.927)(0.868-1.812(0.823-1.704)(0.922-1.822)(0.982-1.953)
P = 0.058P = 0.228P = 0.363P = 0.136P = 0.063
CC13.4131.71613.9461.47413.7771.41113.1651.59212.97711.701
(1.169-9.965)(0.788-3.739(1.232-12.645)(0.679-3.200)(1.181-12.084)(0.652-3.056)(1.088-9.206)(0.735-3.449)(1.099-8.066)(0.765-3.784)
P = 0.018P = 0.171P = 0.014P = 0.324P = 0.018P = 0.381P = 0.027P = 0.236P = 0.026P = 0.189

For the combinations of IBD5 loci and IL23R rs2201841 we could detect significantly elevated high odds ratios only in carriers of rs2201841 homozygotes and wild type IBD5 genotypes (P = 0.018, OR = 3.413; 95%CI: 1.169-9.965 for SLC22A4; P = 0.014, OR = 3.946; 95%CI: 1.232-12.645 for SLC22A5; P = 0.018, OR = 3.777; 95%CI: 1.181-12.084 for IGR2230a_1; P = 0.027, OR = 3.165; 95%CI: 1-088-9.206 for IGR2198a_1; P = 0.026, OR = 2.977; 95%CI: 1.099-8.066 for IGR2096a_1 background). The IL23R rs2201841 homozygous genotype and IBD5 carrier status together did not confer susceptibility for UC.

DISCUSSION

Genetic components play an important role in the pathogenesis of IBD. GWAS have shown disease-associated loci on several chromosomes[4-6]. Some loci seem to be specific to either CD or UC, whereas others confer common susceptibility to IBD; approximately 30% of IBD-related genetic loci are shared[29,30]. Both the IBD5 and the IL23R genes have been identified originally as CD susceptibility genes, but their association with UC has also been confirmed[12-14,16,18-20].

Most of the identified IBD genes individually have only modest effects on IBD susceptibility, suggesting that gene-gene interactions as well as gene-environmental interactions play a key role in IBD pathogenesis[21]. Gene-gene interactions often referred to as epistasis, are ubiquitous among common human diseases and that complex interactions are more important than the independent main effects of any single susceptibility gene[21,31]. Therefore, attention of recent studies has focused on multi-locus analysis, especially involving the CARD15[32-34] , IL23R[35-39], ATG16L1[40-42], DLG5 genes and IBD5 locus[43,44].

In CD the interactions between the main susceptibility genes are better characterized, than in UC. Multidimensionality reduction analysis suggested an interaction between IBD5, ATG16L1, and IL23R risk alleles in CD patients from Manitoba IBD Research Registry[32]. Weersma et al[38] observed multiple gene combinations. According to their results an association between the increase in the number of risk alleles (ATG16L1, IL23R, CARD15, IBD5 and DLG5) and an increase risk for the development of CD and a more severe disease course was found. Csongei et al[43] investigated the IL23R, ATG16L1, CARD15 and IBD5 locus interactions. In almost all cases, the combined risk of susceptibility pairs was higher in patients carrying two different risk-associated gene variants together than individuals with just one polymorphism. In contrast with the single gene effects, after genotype stratification, the IGR2198a_1 C and IGR2096a_1 T variants were found to confer susceptibility only in subjects with CTLA4 + 49 AA genotype[44]. The epistasis of the IL23R rs1004819 risk variant with IBD5 (and CARD15) was examined in a German CD population, but no gene-gene interaction was found[36]. In the study of Cummings et al[35] with the exception of rs11209026, IL23R risk polymorphisms showed significant CD association only in the subgroup of persons positive for the IGR2060 variant in IBD5. This result may suggest that the IL23R gene influences CD in tandem with effects of the IBD5 haplotype. Two protective variations of the IL23R gene, the rs7517847 and rs11209026 were also weakly associated with UC, however the gene interaction test related to UC risk were not implied in these analyses[35].

In previous Hungarian single-locus association studies our research group found no significant differences in the allele frequencies of SLC22A4 and SLC22A5 genes either in CD in pediatric and adult patients[45] or in UC[24]. The TC haplotype was not associated with a higher risk of CD[46] and UC[24] in the Hungarian population. IGR2096_a and IGR2198_a on IBD5 locus were found to confer susceptibility to CD but not for UC[25]. The distribution of IGR2230_a was not significantly different in the CD or the UC group compared with the controls[47]. We observed an increased prevalence of the IL23R rs2201841 and rs1004819 in CD in previous Hungarian studies[43,48]. In our recent work, besides confirming the negative association for IBD5 loci in UC[24,25,47] we could detect significantly higher allele frequency for the IL23R rs1004819 and increased prevalence of the homozygous rs2201841 CC genotypes in UC patients compared to controls in Hungarian population.

In the next step, we analyzed the possible statistical interactions by pairs of risk-conferring IL23R variants and IBD5 using binary logistic regression. No evidence of interaction was found between these seven markers, suggesting that all the examined loci are independent factors.

Since the IBD5 loci were not found to confer risk for UC in the Hungarian population, we performed a combined genetic analysis, stratifying two other UC susceptibility gene variants, IL23R rs2201841 and rs10004819 by the IBD5 markers (SLC22A4, SLC22A5, IGR 2096_a, IGR2198_a, IGR2230_a). The IBD5 carrier status itself did not confer risk for UC in the presence of IL23R rs1004819 wild type but we could detect a positive association on the background of rs1004819 A allele for SLC22A4 T allele, SLC22A5 C, IGR2198a_1 C or IGR2096_a T allele. There was no association with UC for any combinations of rs1004819 and IGR2230a_1. The IL23R rs1004819 A variant did not show significant association with UC on the background of all wild type IBD5 genotypes, respectively. The IBD5 carrier status did not confer susceptibility for UC either in the presence of IL23R rs2201841 TT + TC or CC genotypes. For the combinations of IBD5 loci and IL23R rs2201841 we could detect significant association only in carriers of rs2201841 CC homozygote alleles and wild type IBD5 genotypes.

In summary, we identified the IL23R rs1004819 as susceptibility factor for UC in Hungarian patients and could detect increased prevalence of the homozygous rs2201841 CC genotypes in UC patients compared to controls in Hungarian population. The combined gene-gene analysis reveals that the IL23R rs2201841 CC variant confers risk for UC only on a wild-type IBD5 background and the rs1004819 A allele in combination with IBD5 carrier status except of IGR2230_a. We found no statistical evidence of interaction with the UC susceptibility genes IL23R and IBD5. However, this study has shown that UC susceptibility genes are likely to act in a complex interactive manner similar to CD. Our results play an important role in the understanding of the pathogenesis of UC and areas of overlap with CD but further studies are needed to confirm them.

COMMENTS
Background

Crohn’s disease (CD) and ulcerative colitis (UC) are the two main types of inflammatory bowel diseases (IBD). Their precise etiology is still unknown but genetic factors play an important role in their pathogenesis. Genome-wide association studies have resulted in the identification of many novel susceptibility loci on several chromosomes for CD initially and latterly for UC, including the inflammatory bowel disease-5 (IBD5) locus and interleukin-23 receptor (IL23R) gene.

Research frontiers

An increasing number of studies suggested the association between UC susceptibility and the IBD5 SNPs and IL23R gene variants, individually. The lack of replication of single-locus results in IBD studies is presumed to be related to epistasic gene effects. Therefore multiple SNPs are required to be investigated simultaneously in UC patients to understand both the individual effect of single genes and gene-gene interactions. In the present study two SNPs of the IL23R gene and five variants in the IBD5 locus were genotyped and involved in interaction analysis in Hungarian UC population.

Innovations and breakthroughs

In the recent work, we could detect significantly higher allele frequency for the IL23R rs1004819 A variant and increased prevalence of the homozygous rs2201841 CC genotype in Hungarian UC patients relative to controls. All the analysed IBD5 variants were found to have neutral effect on UC pathogenesis. The statistical analysis of pairwise interactions between IL23R and IBD5 loci confirmed the independence of these genes, while specific combinations by pair showed further correlations. The IL23R rs1004819 A variant increased the risk of disease development only in the presence of IBD5 polymorphisms. Although the IL23R rs2201841 CC genotype conferred risk on wild type IBD5 background, in the presence of IBD5 polymorphisms lack of association was detected. The present study has shown that UC susceptibility genes are likely to act in a complex interactive manner.

Applications

The results play an important role in the understanding of the pathogenesis of UC but further studies investigating gene-gene and gene-environmental interactions are necessary as well. These studies are of high importance since the clarification of interactions between specific IBD genetic polymorphisms could facilitate the differential diagnosis and optimize treatment efficacy of high-risk patients.

Terminology

IBD is a common chronic, remitting-relapsing inflammatory disease of the gastrointestinal tract. UC causes continuous mucosal inflammation of the colon without granulomas, affecting the rectum and a variable extent of the colon, while CD can affect discontinuously and transmurally any part of the gastrointestinal tract. Gene-gene interactions often referred to as epistasis, may play role in the mechanisms of complex diseases such as IBD. Besides the independent main effects of any single susceptibility gene, complex interactions are of great importance as well.

Peer review

This study addresses the possible interactions between very popular genes associated with IBD in determining an increased risk ratio for ulcerative colitis in a relatively large of population of ulcerative colitis patients and controls from Hungary. The study is reasonably sized to possibly give some hints for the complex study of genetics in IBD.

References
1.  Podolsky DK. Inflammatory bowel disease. N Engl J Med. 2002;347:417-429.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2940]  [Cited by in RCA: 2732]  [Article Influence: 113.8]  [Reference Citation Analysis (10)]
2.  Van Limbergen J, Russell RK, Nimmo ER, Ho GT, Arnott ID, Wilson DC, Satsangi J. Genetics of the innate immune response in inflammatory bowel disease. Inflamm Bowel Dis. 2007;13:338-355.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 59]  [Cited by in RCA: 49]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
3.  Cho JH, Weaver CT. The genetics of inflammatory bowel disease. Gastroenterology. 2007;133:1327-1339.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 138]  [Cited by in RCA: 117]  [Article Influence: 6.2]  [Reference Citation Analysis (0)]
4.  Anderson CA, Boucher G, Lees CW, Franke A, D'Amato M, Taylor KD, Lee JC, Goyette P, Imielinski M, Latiano A. Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nat Genet. 2011;43:246-252.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1132]  [Cited by in RCA: 1058]  [Article Influence: 70.5]  [Reference Citation Analysis (7)]
5.  Franke A, McGovern DP, Barrett JC, Wang K, Radford-Smith GL, Ahmad T, Lees CW, Balschun T, Lee J, Roberts R. Genome-wide meta-analysis increases to 71 the number of confirmed Crohn’s disease susceptibility loci. Nat Genet. 2010;42:1118-1125.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2176]  [Cited by in RCA: 2024]  [Article Influence: 126.5]  [Reference Citation Analysis (7)]
6.  Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee JC, Schumm LP, Sharma Y, Anderson CA, Essers J, Mitrovic M, Ning K, Cleynen I, Theatre E, Spain SL, Raychaudhuri S, Goyette P, Wei Z, Abraham C, Achkar JP, Ahmad T, Amininejad L, Ananthakrishnan AN, Andersen V, Andrews JM, Baidoo L, Balschun T, Bampton PA, Bitton A, Boucher G, Brand S, Büning C, Cohain A, Cichon S, D'Amato M, De Jong D, Devaney KL, Dubinsky M, Edwards C, Ellinghaus D, Ferguson LR, Franchimont D, Fransen K, Gearry R, Georges M, Gieger C, Glas J, Haritunians T, Hart A, Hawkey C, Hedl M, Hu X, Karlsen TH, Kupcinskas L, Kugathasan S, Latiano A, Laukens D, Lawrance IC, Lees CW, Louis E, Mahy G, Mansfield J, Morgan AR, Mowat C, Newman W, Palmieri O, Ponsioen CY, Potocnik U, Prescott NJ, Regueiro M, Rotter JI, Russell RK, Sanderson JD, Sans M, Satsangi J, Schreiber S, Simms LA, Sventoraityte J, Targan SR, Taylor KD, Tremelling M, Verspaget HW, De Vos M, Wijmenga C, Wilson DC, Winkelmann J, Xavier RJ, Zeissig S, Zhang B, Zhang CK, Zhao H; International IBD Genetics Consortium (IIBDGC), Silverberg MS, Annese V, Hakonarson H, Brant SR, Radford-Smith G, Mathew CG, Rioux JD, Schadt EE, Daly MJ, Franke A, Parkes M, Vermeire S, Barrett JC, Cho JH. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature. 2012;491:119-124.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4202]  [Cited by in RCA: 3781]  [Article Influence: 270.1]  [Reference Citation Analysis (4)]
7.  Van Limbergen J, Wilson DC, Satsangi J. The genetics of Crohn’s disease. Annu Rev Genomics Hum Genet. 2009;10:89-116.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 206]  [Cited by in RCA: 195]  [Article Influence: 11.5]  [Reference Citation Analysis (0)]
8.  Rioux JD, Daly MJ, Silverberg MS, Lindblad K, Steinhart H, Cohen Z, Delmonte T, Kocher K, Miller K, Guschwan S. Genetic variation in the 5q31 cytokine gene cluster confers susceptibility to Crohn disease. Nat Genet. 2001;29:223-228.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 600]  [Cited by in RCA: 547]  [Article Influence: 21.9]  [Reference Citation Analysis (1)]
9.  Peltekova VD, Wintle RF, Rubin LA, Amos CI, Huang Q, Gu X, Newman B, Van Oene M, Cescon D, Greenberg G. Functional variants of OCTN cation transporter genes are associated with Crohn disease. Nat Genet. 2004;36:471-475.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 640]  [Cited by in RCA: 561]  [Article Influence: 25.5]  [Reference Citation Analysis (4)]
10.  Silverberg MS, Duerr RH, Brant SR, Bromfield G, Datta LW, Jani N, Kane SV, Rotter JI, Philip Schumm L, Hillary Steinhart A. Refined genomic localization and ethnic differences observed for the IBD5 association with Crohn’s disease. Eur J Hum Genet. 2007;15:328-335.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 61]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
11.  Xuan C, Zhang BB, Yang T, Deng KF, Li M, Tian RJ. Association between OCTN1/2 gene polymorphisms (1672C-T, 207G-C) and susceptibility of Crohn’s disease: a meta-analysis. Int J Colorectal Dis. 2012;27:11-19.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 27]  [Article Influence: 1.9]  [Reference Citation Analysis (1)]
12.  McGovern DP, Gardet A, Törkvist L, Goyette P, Essers J, Taylor KD, Neale BM, Ong RT, Lagacé C, Li C. Genome-wide association identifies multiple ulcerative colitis susceptibility loci. Nat Genet. 2010;42:332-337.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 543]  [Cited by in RCA: 529]  [Article Influence: 33.1]  [Reference Citation Analysis (7)]
13.  Giallourakis C, Stoll M, Miller K, Hampe J, Lander ES, Daly MJ, Schreiber S, Rioux JD. IBD5 is a general risk factor for inflammatory bowel disease: replication of association with Crohn disease and identification of a novel association with ulcerative colitis. Am J Hum Genet. 2003;73:205-211.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 124]  [Cited by in RCA: 118]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
14.  McGovern DP, Van Heel DA, Negoro K, Ahmad T, Jewell DP. Further evidence of IBD5/CARD15 (NOD2) epistasis in the susceptibility to ulcerative colitis. Am J Hum Genet. 2003;73:1465-1466.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 45]  [Cited by in RCA: 49]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
15.  Waller S, Tremelling M, Bredin F, Godfrey L, Howson J, Parkes M. Evidence for association of OCTN genes and IBD5 with ulcerative colitis. Gut. 2006;55:809-814.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 78]  [Cited by in RCA: 79]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
16.  Palmieri O, Latiano A, Valvano R, D’Incà R, Vecchi M, Sturniolo GC, Saibeni S, Peyvandi F, Bossa F, Zagaria C. Variants of OCTN1-2 cation transporter genes are associated with both Crohn’s disease and ulcerative colitis. Aliment Pharmacol Ther. 2006;23:497-506.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 49]  [Cited by in RCA: 44]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
17.  Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly MJ, Steinhart AH, Abraham C, Regueiro M, Griffiths A. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 2006;314:1461-1463.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2523]  [Cited by in RCA: 2333]  [Article Influence: 116.7]  [Reference Citation Analysis (9)]
18.  Fisher SA, Tremelling M, Anderson CA, Gwilliam R, Bumpstead S, Prescott NJ, Nimmo ER, Massey D, Berzuini C, Johnson C. Genetic determinants of ulcerative colitis include the ECM1 locus and five loci implicated in Crohn’s disease. Nat Genet. 2008;40:710-712.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 344]  [Cited by in RCA: 334]  [Article Influence: 18.6]  [Reference Citation Analysis (0)]
19.  Franke A, Balschun T, Karlsen TH, Hedderich J, May S, Lu T, Schuldt D, Nikolaus S, Rosenstiel P, Krawczak M. Replication of signals from recent studies of Crohn’s disease identifies previously unknown disease loci for ulcerative colitis. Nat Genet. 2008;40:713-715.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 287]  [Cited by in RCA: 283]  [Article Influence: 15.7]  [Reference Citation Analysis (3)]
20.  Silverberg MS, Cho JH, Rioux JD, McGovern DP, Wu J, Annese V, Achkar JP, Goyette P, Scott R, Xu W. Ulcerative colitis-risk loci on chromosomes 1p36 and 12q15 found by genome-wide association study. Nat Genet. 2009;41:216-220.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 332]  [Cited by in RCA: 326]  [Article Influence: 19.2]  [Reference Citation Analysis (5)]
21.  Achkar JP, Fiocchi C. Gene-gene interactions in inflammatory bowel disease: biological and clinical implications. Am J Gastroenterol. 2009;104:1734-1736.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 10]  [Article Influence: 0.6]  [Reference Citation Analysis (1)]
22.  Moore JH. A global view of epistasis. Nat Genet. 2005;37:13-14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 160]  [Cited by in RCA: 160]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
23.  Cordell HJ. Epistasis: what it means, what it doesn’t mean, and statistical methods to detect it in humans. Hum Mol Genet. 2002;11:2463-2468.  [PubMed]  [DOI]  [Full Text]
24.  Magyari L, Bene J, Komlósi K, Talián G, Faragó B, Csöngei V, Járomi L, Sáfrány E, Sipeky C, Lakner L. Prevalence of SLC22A4 1672T and SLC22A5 -207C combination defined TC haplotype in Hungarian ulcerative colitis patients. Pathol Oncol Res. 2007;13:53-56.  [PubMed]  [DOI]
25.  Lakner L, Csöngei V, Sarlós P, Járomi L, Sáfrány E, Varga M, Orosz P, Magyari L, Bene J, Miheller P. IGR2096a_1 T and IGR2198a_1 C alleles on IBD5 locus of chromosome 5q31 region confer risk for Crohn’s disease in Hungarian patients. Int J Colorectal Dis. 2009;24:503-507.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 11]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
26.  Safrany E, Szabo M, Szell M, Kemeny L, Sumegi K, Melegh BI, Magyari L, Matyas P, Figler M, Weber A. Difference of interleukin-23 receptor gene haplotype variants in ulcerative colitis compared to Crohn’s disease and psoriasis. Inflamm Res. 2013;62:195-200.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 30]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
27.  Szabo M, Safrany E, Pazar B, Melegh BI, Kisfali P, Poor G, Figler M, Szekanecz Z, Czirjak L, Melegh B. Marked diversity of IL23R gene haplotype variants in rheumatoid arthritis comparing with Crohn’s disease and ankylosing spondylitis. Mol Biol Rep. 2013;40:359-363.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 18]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
28.  Silverberg MS, Satsangi J, Ahmad T, Arnott ID, Bernstein CN, Brant SR, Caprilli R, Colombel JF, Gasche C, Geboes K. Toward an integrated clinical, molecular and serological classification of inflammatory bowel disease: report of a Working Party of the 2005 Montreal World Congress of Gastroenterology. Can J Gastroenterol. 2005;19 Suppl A:5A-36A.  [PubMed]  [DOI]
29.  Thompson AI, Lees CW. Genetics of ulcerative colitis. Inflamm Bowel Dis. 2011;17:831-848.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 116]  [Cited by in RCA: 110]  [Article Influence: 7.3]  [Reference Citation Analysis (4)]
30.  Khor B, Gardet A, Xavier RJ. Genetics and pathogenesis of inflammatory bowel disease. Nature. 2011;474:307-317.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2207]  [Cited by in RCA: 2037]  [Article Influence: 135.8]  [Reference Citation Analysis (8)]
31.  Moore JH. The ubiquitous nature of epistasis in determining susceptibility to common human diseases. Hum Hered. 2003;56:73-82.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 504]  [Cited by in RCA: 504]  [Article Influence: 22.9]  [Reference Citation Analysis (0)]
32.  Okazaki T, Wang MH, Rawsthorne P, Sargent M, Datta LW, Shugart YY, Bernstein CN, Brant SR. Contributions of IBD5, IL23R, ATG16L1, and NOD2 to Crohn’s disease risk in a population-based case-control study: evidence of gene-gene interactions. Inflamm Bowel Dis. 2008;14:1528-1541.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 55]  [Cited by in RCA: 65]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
33.  Petermann I, Huebner C, Browning BL, Gearry RB, Barclay ML, Kennedy M, Roberts R, Shelling AN, Philpott M, Han DY. Interactions among genes influencing bacterial recognition increase IBD risk in a population-based New Zealand cohort. Hum Immunol. 2009;70:440-446.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 20]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
34.  Márquez A, Varadé J, Robledo G, Martínez A, Mendoza JL, Taxonera C, Fernández-Arquero M, Díaz-Rubio M, Gómez-García M, López-Nevot MA. Specific association of a CLEC16A/KIAA0350 polymorphism with NOD2/CARD15(-) Crohn’s disease patients. Eur J Hum Genet. 2009;17:1304-1308.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 42]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
35.  Cummings JR, Ahmad T, Geremia A, Beckly J, Cooney R, Hancock L, Pathan S, Guo C, Cardon LR, Jewell DP. Contribution of the novel inflammatory bowel disease gene IL23R to disease susceptibility and phenotype. Inflamm Bowel Dis. 2007;13:1063-1068.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 74]  [Cited by in RCA: 73]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
36.  Glas J, Seiderer J, Wetzke M, Konrad A, Török HP, Schmechel S, Tonenchi L, Grassl C, Dambacher J, Pfennig S. rs1004819 is the main disease-associated IL23R variant in German Crohn’s disease patients: combined analysis of IL23R, CARD15, and OCTN1/2 variants. PLoS One. 2007;2:e819.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 107]  [Cited by in RCA: 113]  [Article Influence: 5.9]  [Reference Citation Analysis (0)]
37.  Latiano A, Palmieri O, Valvano MR, D’Incà R, Cucchiara S, Riegler G, Staiano AM, Ardizzone S, Accomando S, de Angelis GL. Replication of interleukin 23 receptor and autophagy-related 16-like 1 association in adult- and pediatric-onset inflammatory bowel disease in Italy. World J Gastroenterol. 2008;14:4643-4651.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 48]  [Cited by in RCA: 53]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
38.  Weersma RK, Stokkers PC, van Bodegraven AA, van Hogezand RA, Verspaget HW, de Jong DJ, van der Woude CJ, Oldenburg B, Linskens RK, Festen EA. Molecular prediction of disease risk and severity in a large Dutch Crohn’s disease cohort. Gut. 2009;58:388-395.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 142]  [Cited by in RCA: 130]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
39.  McGovern DP, Rotter JI, Mei L, Haritunians T, Landers C, Derkowski C, Dutridge D, Dubinsky M, Ippoliti A, Vasiliauskas E. Genetic epistasis of IL23/IL17 pathway genes in Crohn’s disease. Inflamm Bowel Dis. 2009;15:883-889.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 58]  [Cited by in RCA: 62]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
40.  Prescott NJ, Fisher SA, Franke A, Hampe J, Onnie CM, Soars D, Bagnall R, Mirza MM, Sanderson J, Forbes A. A nonsynonymous SNP in ATG16L1 predisposes to ileal Crohn’s disease and is independent of CARD15 and IBD5. Gastroenterology. 2007;132:1665-1671.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 240]  [Cited by in RCA: 226]  [Article Influence: 11.9]  [Reference Citation Analysis (0)]
41.  Glas J, Konrad A, Schmechel S, Dambacher J, Seiderer J, Schroff F, Wetzke M, Roeske D, Török HP, Tonenchi L. The ATG16L1 gene variants rs2241879 and rs2241880 (T300A) are strongly associated with susceptibility to Crohn’s disease in the German population. Am J Gastroenterol. 2008;103:682-691.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 76]  [Cited by in RCA: 89]  [Article Influence: 4.9]  [Reference Citation Analysis (0)]
42.  Roberts RL, Gearry RB, Hollis-Moffatt JE, Miller AL, Reid J, Abkevich V, Timms KM, Gutin A, Lanchbury JS, Merriman TR. IL23R R381Q and ATG16L1 T300A are strongly associated with Crohn’s disease in a study of New Zealand Caucasians with inflammatory bowel disease. Am J Gastroenterol. 2007;102:2754-2761.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 93]  [Cited by in RCA: 96]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
43.  Csöngei V, Járomi L, Sáfrány E, Sipeky C, Magyari L, Faragó B, Bene J, Polgár N, Lakner L, Sarlós P. Interaction of the major inflammatory bowel disease susceptibility alleles in Crohn’s disease patients. World J Gastroenterol. 2010;16:176-183.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 37]  [Cited by in RCA: 44]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
44.  Csöngei V, Járomi L, Sáfrány E, Sipeky C, Magyari L, Polgár N, Bene J, Sarlós P, Lakner L, Baricza E. Interaction between CTLA4 gene and IBD5 locus in Hungarian Crohn’s disease patients. Int J Colorectal Dis. 2011;26:1119-1125.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 2]  [Article Influence: 0.1]  [Reference Citation Analysis (0)]
45.  Bene J, Komlósi K, Magyari L, Talián G, Horváth K, Gasztonyi B, Miheller P, Figler M, Mózsik G, Tulassay Z. Plasma carnitine ester profiles in Crohn’s disease patients characterized for SLC22A4 C1672T and SLC22A5 G-207C genotypes. Br J Nutr. 2007;98:345-350.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 25]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
46.  Bene J, Magyari L, Talián G, Komlósi K, Gasztonyi B, Tari B, Várkonyi A, Mózsik G, Melegh B. Prevalence of SLC22A4, SLC22A5 and CARD15 gene mutations in Hungarian pediatric patients with Crohn’s disease. World J Gastroenterol. 2006;12:5550-5553.  [PubMed]  [DOI]
47.  Talián G, Lakner L, Bene J, Komlósi K, Horváth K, Gasztonyi B, Miheller P, Figler M, Mózsik G, Tulassay Z. Plasma carnitine ester profiles in Crohn’s disease and ulcerative colitis patients with different IGR2230a_1 genotypes. Int J Immunogenet. 2009;36:329-335.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 7]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
48.  Faragó B, Magyari L, Sáfrány E, Csöngei V, Járomi L, Horvatovich K, Sipeky C, Maász A, Radics J, Gyetvai A. Functional variants of interleukin-23 receptor gene confer risk for rheumatoid arthritis but not for systemic sclerosis. Ann Rheum Dis. 2008;67:248-250.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 106]  [Cited by in RCA: 103]  [Article Influence: 5.7]  [Reference Citation Analysis (1)]
Footnotes

P- Reviewers: Jonaitis L, Manes G, Taesung P, Vecchi M S- Editor: Cui XM L- Editor: A E- Editor: Liu XM

Write to the Help Desk