Published online Nov 28, 2013. doi: 10.3748/wjg.v19.i44.8108
Revised: October 12, 2013
Accepted: October 19, 2013
Published online: November 28, 2013
Processing time: 200 Days and 19.4 Hours
AIM: To determine the effects of RNAi-mediated inhibition of the growth hormone receptor (GHR) gene on tumors and colon cancer cells in vivo.
METHODS: Construction of a eukaryotic vector for human GHR expression, the pcDNA™6.2-GW/EmGFP-small interfering RNAs (siRNAs)-GHR plasmid, was used to inhibit GHR expression. Thirty-six BALB/c nude mice were randomly divided into groups and treated with normal saline (NS), recombinant plasmid (G2), growth hormone (GH), 5-fluorouracil (FU), G2+FU or G2+FU+GH. Each nude mouse was subcutaneously inoculated with 1×107 human colon cancer SW480 cells; the nude mice were weighed before inoculation and on the 2nd, 5th, 8th, 11th, 14th and 17th day after inoculation. All nude mice were sacrificed after 17 d. Each subcutaneous tumor was removed and studied. Tumor volume was measured on the 5th, 8th, 11th, 14th and 17th day after inoculation. The expression of GHR protein in the tumor tissue was detected by Western blotting analysis, and the differences in GHR mRNA expression in the tumor tissue were detected by real-time quantitative reverse transcription-polymerase chain reaction.
RESULTS: Compared to the control group, the weights of the inoculated nude mice on the 17th day after inoculation were: G2: 21.60 ± 0.71 g, GH: 21.64 ± 0.45 g, FU: 18.94 ± 0.47 g, FU+G2: 19.40 ± 0.60 g, G2+FU+GH: 21.04 ± 0.78 g vs NS: 20.68 ± 0.66 g, P < 0.05; the tumor volumes after the subcutaneous inoculation were: G2: 9.71 ± 3.82 mm3, FU: 11.54 ± 2.42 mm3, FU+G2: 11.42 ± 1.11 mm3, G2+FU+GH: 10.47 ± 1.02 mm3vs NS: 116.81 ± 10.61 mm3, P < 0.05. Compared to the GH group, the tumor volumes were significantly decreased in the experimental groups. The GHR protein expression (G2: 0.39 ± 0.02, FU: 0.40 ± 0.02, FU+G2: 0.38 ± 0.01, G2+FU+GH: 0.39 ± 0.01 vs NS: 0.94 ± 0.02, P < 0.05) and the GHR mRNA expression (G2: 14.12 ± 0.10, FU: 15.15 ± 0.44, FU+G2: 16.46 ± 0.27, G2+FU+GH: 15.37 ± 0.57 vs NS: 12.63 ± 0.14, P < 0.05) were significantly decreased and increased, respectively, in the experimental groups.
CONCLUSION: Inhibition of GHR in human colon cancer SW480 cells resulted in anti-tumor effects in nude mice.
Core tip: Human growth hormone receptor (GHR) is highly expressed in colon cancer tissues. GH/GHR plays an important role in colon cancer emergence and development. After specific binding of GH to GHR in tumor tissues, the JAK-STAT signaling pathway is activated, resulting in improved cell growth and proliferation. small interfering RNAs (siRNAs)-targeted inhibition of the human GHR gene was used to investigate its impact on the emergence and development of colon cancer and to determine how human colon cancer cells respond to GHR suppression. The siRNA-containing plasmid could suppress GHR expression in colon cancer cells and exhibited anti-tumor effects in nude mice.
- Citation: Zhou D, Yang J, Huang WD, Wang J, Zhang Q. siRNA-targeted inhibition of growth hormone receptor in human colon cancer SW480 cells. World J Gastroenterol 2013; 19(44): 8108-8113
- URL: https://www.wjgnet.com/1007-9327/full/v19/i44/8108.htm
- DOI: https://dx.doi.org/10.3748/wjg.v19.i44.8108
Core tip: Human growth hormone receptor (GHR) is highly expressed in colon cancer tissues. GH/GHR plays an important role in colon cancer emergence and development. After specific binding of GH to GHR in tumor tissues, the JAK-STAT signaling pathway is activated, resulting in improved cell growth and proliferation. small interfering RNAs (siRNAs)-targeted inhibition of the human GHR gene was used to investigate its impact on the emergence and development of colon cancer and to determine how human colon cancer cells respond to GHR suppression. The siRNA-containing plasmid could suppress GHR expression in colon cancer cells and exhibited anti-tumor effects in nude mice.
As shown previously by our team, human growth hormone receptor (GHR) is highly expressed in colon cancer tissues. Additionally, less differentiated tumor tissues have higher levels of GHR expression. During tumor development, the expression of GHR demonstrates an upward tendency[1,2]. Some researchers[3-6] believe that the expression of GHR in tumor tissue is linked with the vegetative state of the tumor and that GH and GHR play important roles in the emergence and development of colon cancer. After specific binding of GH to GHR in tumor tissues, the JAK-STAT signal transduction pathway is activated, resulting in improved cell growth and proliferation[7-10]. Signal transduction therapy is a commonly used chemotherapy strategy, and currently, treatment often involves the use of small interfering RNAs (siRNAs) that target different signal transduction pathways[11-13].
In this study, siRNA targeting the human GHR gene was used to investigate the impact that GHR has on the emergence and development of colon cancer and to determine how human colon cancer cells respond to the suppression of GHR expression.
Thirty-six 8-wk old, female BALB/c nude mice, weighing between 20 and 22 g, were purchased from Vital River Laboratories (VRL) with license No. SCXK (Jing) 2006-0009. The mice were kept in the SPF environment of the animal experiment center in Kunming Medical University. The human colon cancer cell line SW480 was obtained from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Science.
The HQ high purity plasmid extraction kit was purchased from Invitrogen (Invitrogen, Carlsbad city, California, United States). The BCA protein concentration kit (Tiangen Biology and Chemistry) and the molecular mass albumin standard were purchased from Tiangen Biology and Chemistry (Fermentas Company). The mouse monoclonal anti-human GHR antibody was obtained from R and D Company (MAB1210), and the goat secondary anti-mouse IgG-HRP antibody was purchased from Abmart Company. RNase H was obtained from Invitrogen, and the Golden Taq PCR kit was purchased from Tiangen Biology and Chemistry. SYBR Green-Real Master Mix was purchased from Tiangen Biology and Chemistry, and all primers used in the study were obtained from Invitrogen.
Colon cancer SW480 cells were cultivated in RPMI 1640 nutrient solution supplemented with 10% fetal calf serum (FCS), 10.0 × 103 U/L penicillin, and 100 mg/L streptomycin in a 37 °C incubator with 50 mL/L CO2. This is an adherent cell line. Cells in the exponential growth phase were harvested using 0.25% trypsin, and the cells were resuspended using a machine. The cells were then centrifuged at 2000 rpm for 5 min. Then, the supernatant was removed, and the cells were resuspended in physiological saline at a concentration of 1 × 107 cells/mL. Trypan blue staining was used to ensure that cell viability was above 95%; after resuspension the cells were stored in an ice bath.
siRNA oligonucleotides were designed against the mRNA sequence of human GHR found in GenBank, which had a total length of 4414 bp (Accession No.: X06562, GI: 31737). We used the RNAi Designer website (http://bioinfo.clontech.com/rnaidesigner) to design the siRNA that targeted the hGHR mRNA (527-547: GTCAGTTTAACTGGGATTCAT). Using the BLAST search program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to search the EST database, we found that the siRNA was not homologous to another gene and would be an effective siRNA sequence. The complementary single strand primer was incubated at 94 °C in annealing buffer solution for 3 min, and the oligonucleotides were annealed at 37 °C for 1 h. The annealed oligonucleotides were then phosphorylated at 37 °C for 30 min with T4 DNA-PNK. The oligonucleotides were then ligated into the linearized (BamHI/HindIII) pcDNA™6.2-GW/EmGFP-GHR-siRNA plasmid using T4 DNA ligase. The final product was transformed in competent E. coli DH5α cells, and the transformants were spread on transformation plates containing 50 μg/mL spectinomycin dihydrochloride (Sigma, Catalog No. S4014). The plates weres kept in a 37 °C incubator overnight, and three coenobium clones were picked from each plate and subcultured. The plasmids were extracted using plasmid extraction kits, and the plasmids were confirmed by restriction enzyme digestion with EcoR I, Sac I and Sal I. The transformation liquid was also sequenced to ensure that recombination had not occurred in the insert fragments during the cloning process. Finally, the pcDNA™6.2-GW/EmGFP-GHR-siRNA plasmids were constructed successfully and are referred to as G2 throughout the paper. Additionally, the plasmids were extracted and diluted in DMEM as a precaution.
We subcutaneously injected 1 × 107 human colon cancer SW480 cells into BALB/c nude mice. On the first day after the injection, the mice were divided into six groups and administered the indicated drug and dose. (1) Normal saline (NS): 10 μL of NS was injected into the abdominal cavity of each mouse; (2) Plasmid (G2): 10 μg of the G2 eukaryotic expression plasmid was injected subcutaneously into each mouse; (3) Growth hormone (GH): 2 IU/kg rhGH, a physiological dose of GH, was hypodermically injected into each mouse; (4) 5-fluorouracil (FU): 20 mg/kg 5-FU was injected into the abdominal cavity of each mouse; (5) 5-FU+plasmid (FU+G2): 20 mg/kg 5-FU and 10 μg of the G2 plasmid were injected into the abdominal cavity of each mouse; (6) 5-FU+GH+plasmid (FU+GH+G2): 20 mg/kg 5-FU, 10 μg of the G2 plasmid, and 2 IU/kg rhGH were injected into the abdominal cavity of each mouse; and (7) Each of the above groups was treated every 5 d for three rounds of treatment.
Observation of weight and tumor volume of nude mice: The weight of the nude mice was recorded before injection of the SW480 cells and on the 2nd, 5th, 8th, 11th, 14th and 17th day after injection. The length and the minimum diameter of the tumors were recorded, and the tumor volume was calculated on the 5th, 8th, 11th, 14th and 17th day after hypodermic injection of human colon cancer SW480 cells The following equation was used to calculated the tumor volume: V = (A × B2)/2, where A represents the major diameter and B represents the minimum diameter.
A sample of each tumor was removed from the nude mice and cut into pieces. Cleanser lysate solution containing PMSF (400 μL) was added to the tumor sample in a homogenizer. After the cells were lysed for 30 min, the homogenate was centrifuged at 12000 rpm for 5 min at 4 °C. The supernatant was removed, placed in 0.5 mL centrifuge tubes, and stored at -20 °C. Then, 20 μL of the lysate sample was separated and analyzed using SDS-PAGE; the proteins were electrotransferred onto nitrocellulose membranes and detected using a chemiluminescent detection system. Beta-actin was used as a loading control. The images were analyzed using the BandScan5.0 program. The ratio of GHR expression to beta-actin expression was analyzed using the integral optical density value (RV) of the band in the same sample. The results are shown as the expression of GHR relative to beta-actin, and the results were measured as, mean ± SD.
Twenty microliters of the lysate sample was centrifuged at 5000 rpm for 10 min. Prechilled PBS was used to wash the cells, and total RNA was extracted using the Trizol reagent in a one-step method. For first strand synthesis, 1 μg of total RNA was combined with 1 μL of 0.5 μg/μL oligo primer and 12 μL of deionized water. The mixture was then incubated at 70 °C for 5 min. Then, the samples were quenched in a bath of ice water and centrifuged at 5000 rpm for 4 s. Next, 4 μL of 5 × reaction buffer, 1 μL of 20 U/μL ribonuclease, and 2 μL of 10 μmol/μL dNTPs were added, and the mixture was incubated at 37 °C for 5 min. Then, 1 μL of 200 U/μL reverse transcriptase was added, and the reaction was incubated at 42 °C for 60 min, followed by a 10 min incubation at 70 °C. After the reaction, the cDNA was incubated at 0 °C and was stored at -20 °C. Real time PCR with the SYBR-Green fluorochrome was used to detect the expression of GHR mRNA. For this reaction, 10 μL of cDNA, 2 μL of both forward and reverse primers, 10 μL of buffer solution, 4 μL of ddH2O, and 1 μL of the ROX fluorochrome were incubated at 95 °C for 10 min, followed by 35 cycles of 94 °C for 10 s, 56 °C for 30 s, and 72 °C for 30 s; a final extension time of 5 min at 72 °C ended the reaction. GAPDH was used as a negative control. The following primers were used in this experiment: GHR forward: GCAGCTATCCTTAGCAGAGCAC; GHR reverse: AAGTCTCTCGCTCAGGTGAACG; GAPDH forward: GGTCTCCTCTGACTTCAACA; and GAPDH reverse: GAGGGTCTCTCTCTTCCT. The levels of GHR mRNA in the transfection group and the control group were determined by quantitative PCR, and the △CT value of the GHR mRNA was determined between the two groups. It was demonstrated that a higher △CT value represented a larger inhibition of GHR mRNA.
Data were expressed as the mean ± SD. Univariate or multivariate data were analyzed using variance analysis and pairwise comparison q test by SPSS 18.0 statistical software package. Statistical significance was considered at P≤ 0.05.
At the end of the experiment, all 36 tumor-bearing mice survived from inoculation 2 to 17 d, except for the NS group. After injection, there was a statistically significant difference (P < 0.05) in the weight of the mice compared with their weight before injection. The weight of the GH group increased after inoculation with SW480 cells, while the other groups decreased in weight (P < 0.05). The weight of the G2, FU, and G2+FU groups noticeably decreased (P < 0.05) compared with the NS group. The weight of the FU and G2+FU groups decreased compared with the G2 group; however, this change was not significant. After the addition of GH, the weight of the G2+GH+FU group increased compared with the FU group in the same period (P < 0.05; Table 1).
| Weight (g, mean ± SD) | ||||||
| Time | NS | G2 | GH | FU | FU+G2 | G2+FU+GH |
| Pre-operation | 20.69 ± 0.67 | 21.92 ± 0.70 | 20.67 ± 0.57 | 21.93 ± 0.58 | 21.86 ± 0.73 | 21.25 ± 0.79 |
| Inoculation 2 d | 20.64 ± 0.60 | 21.86 ± 0.79 | 20.82 ± 0.56 | 20.89 ± 0.661 | 20.09 ± 0.5513 | 20.41 ± 0.8513 |
| Inoculation 5 d | 20.65 ± 0.49 | 21.56 ± 0.81 | 20.96 ± 0.541 | 20.94 ± 0.671 | 19.92 ± 0.58135 | 20.42 ± 0.761 |
| Inoculation 8 d | 20.65 ± 0.65 | 21.53 ± 0.561 | 21.18 ± 0.441 | 20.41 ± 0.7313 | 19.92 ± 0.521235 | 20.53 ± 0.7013 |
| Inoculation 11 d | 20.67 ± 0.63 | 21.53 ± 0.731 | 21.27 ± 0.5314 | 19.86 ± 0.5713 | 20.06 ± 0.521235 | 20.63 ± 0.8115 |
| Inoculation 14 d | 20.61 ± 0.62 | 21.60 ± 0.6812 | 21.51 ± 0.4414 | 9.46 ± 0.52123 | 19.86 ± 0.9212 | 20.86 ± 0.7214 |
| Inoculation 17 d | 20.68 ± 0.66 | 21.60 ± 0.711 | 21.64 ± 0.45124 | 18.94 ± 0.47123 | 19.40 ± 0.60123 | 21.04 ± 0.7814 |
By the end of the experiment, the tumor volume of the mice in all groups increased compared to the fifth day after inoculation. The tumor volume of the GH group had the most dramatic increase, followed by the NS group. The tumor volumes of the G2, FU, G2+FU, and G2+GH+FU groups only slightly increased. Compared with the NS group in the same period, the tumor volume of the experimental group obviously decreased, whereas that of the GH group significantly increased (P < 0.05). Compared with the G2 group, the G2+FU group had a more pronounced tumor inhibition (P < 0.05). There was no obvious difference in the tumor volume of the G2+GH+FU group compared with the G2, FU, and G2+FU groups in the same period (Table 2).
| Subcutaneous tumor volume (mm3, mean ± SD) | ||||||
| Time | NS | G2 | GH | FU | FU+G2 | G2+FU+GH |
| Inoculation 5 d | 7.72 ± 1.61 | 7.93 ± 1.74 | 8.11 ± 1.65 | 7.42 ± 1.51 | 6.51 ± 1.20 | 7.33 ± 1.32 |
| Inoculation 8 d | 20.19 ± 4.9123 | 13.44 ± 4.1213 | 33.28 ± 3.24123 | 17.51 ± 5.753 | 15.12 ± 5.013 | 15.44 ± 4.23 |
| Inoculation 11 d | 106.02 ± 6.6123 | 21.12 ± 4.0413 | 151.90 ± 8.31123 | 21.00 ± 5.0713 | 19.22 ± 4.3313 | 22.97 ± 4.95123 |
| Inoculation 14 d | 133.41 ± 6.4323 | 20.00 ± 4.7513 | 178.93 ± 3.11123 | 16.23 ± 6.5113 | 11.55 ± 4.11123 | 12.12 ± 3.11123 |
| Inoculation 17 d | 116.81 ± 0.6123 | 9.71 ± 3.8213 | 149.01 ± 3.02123 | 11.54 ± 2.4213 | 11.42 ± 1.1113 | 10.47 ± 1.0213 |
The expression levels of GHR protein in the tumors of the GH (0.94 ± 0.02) and NS (0.94 ± 0.02) mice were significantly higher than the GHR levels in the G2 (0.39 ± 0.021), FU (0.40 ± 0.02), G2+FU (0.38 ± 0.01) and G2+FU+GH (0.39 ± 0.01) mice. However, there was no significant difference between the G2 group and the FU, G2+FU, and G2+FU+GH groups (P > 0.05).
Compared with the NS group and the control group that did not have a plasmid, the △CT value of the G2, FU, G2+FU, and G2+FU+GH groups significantly increased (P < 0.05). In the experimental groups, the inhibition ratios of the FU+G2 and FU+G2+GH groups against GHR mRNA were higher than that of the G2 group (P < 0.05; Table 3).
Colon cancer is one of the most common malignant tumors[14-16]. Currently, the treatment for colon cancer is surgery combined with radiotherapy and chemotherapy. However, most patients cannot undergo operation or do not respond to chemotherapeutics, leading to the failure of the therapy. Determining the appropriate tumor target spot related to gene and specific therapy has become a hotspot of research in tumor therapy[17]. Due to its action as an anabolic agent and mitogen, GH has a wide range of functions in substance metabolism and body fluid equilibrium, which can accelerate the use of nitrogen and improve the synthesis of liver and muscle proteins. The nutritional effect of GH has already been shown in cachexia[18]. Because GH can increase the brittleness of chromosomes, which, in turn, can cause malignant transformation of cells, and can increase tumor growth, GH has been excluded as a therapy option for the treatment of tumors[19,20]. It has been demonstrated by many epidemiological researchers that patients who receive long term treatment with growth hormone have an increased risk of colon cancer[3,21], and GHR expression in the colon might relate to the occurrence, development and metastasis of these tumors[1,22]. The presence of GHR in the local tissue is a prerequisite for GH to play its role, which means that when determining whether to use GH as a therapy, it is important to know the expression and distribution of GHR in a specific tumor cell. GHR is highly expressed in colon cancer tissues[1,2], and high GHR expression has been correlated with poor patient prognosis[23].
RNAi refers to complementary double-stranded RNAs (dsRNAs) that bind to specific endogenous mRNAs, resulting in the degradation of those mRNAs and the silencing of gene expression. Aiming at the relevant signal of the auxanodifferentiation of tumor cells for transduction and targeting the interference of the expression of crucial proteins in transduction pathways of cell signaling can inhibit the growth of a tumor specifically and highly efficiently[24,25].
In this research, we constructed plasmids containing siRNAs that targeted the expression of GHR in colon cancer cells, thereby decreasing the expression of GHR in the colon cancer tissues and blocking the GHR-induced signal transduction that promotes tumor cell growth. The results demonstrated that, compared to the control group, the tumor volume and the mRNA and protein expression of GHR in the tumor tissue significantly decreased. Additionally, the combination of GHR silencing and 5-FU treatment had an anti-tumor effect. After the siRNA blocked the expression of GHR in the tumor tissue, the addition of GH could bind to the GHR in the normal tissue. As a result, the weight and nutrition of the nude mice may improve, and GH treatment increases the nude mouse tolerance towards chemotherapy and increases the chemosensitivity of the tumor cells[9]. Compared with the other experimental groups, the FU+G2+GH group had no significant difference in its reduced tumor volume or decreased expression of GHR protein and mRNA.
Our research showed that the siRNA-containing plasmid influenced the expression of GHR in the colon cancer cells and played an anti-tumor role in the nude mice.
Human growth hormone receptor (GHR) is highly expressed in colon cancer tissues. In addition, less differentiated tumor tissues have higher levels of GHR expression. During tumor development, the expression of GHR increases. Some researchers believe that the expression of GHR in tumor tissue is linked with the vegetative state of the tumor, and GH/GHR plays an important role in the emergence and development of colon cancer. After specific binding between GH and GHR in tumor tissue, the JAK-STAT signal transduction pathway is activated, leading to improved cell growth and proliferation.
Signal transduction therapy is a commonly used chemotherapy strategy, and currently, treatment often involves the use of small interfering RNAs (siRNAs) that target different signal transduction pathways. RNAi refers to complementary double-stranded RNAs that bind endogenous mRNAs, resulting in the specific degradation of that mRNA, which leads to decreased expression of that gene. Aiming at the relevant signal of the auxanodifferentiation of tumor cells and targeting the interference of the expression of crucial proteins in transduction pathways of cell signaling can inhibit the growth of tumor specifically and highly efficiently.
In this study, siRNA-targeted inhibition of the GHR gene was used to investigate GHR’s impact on the emergence and development of colon cancer and to determine how human colon cancer cells respond to the suppression of GHR gene expression.
The results showed that the siRNA-containing plasmid influenced the expression of GHR in the colon cancer cells and played an anti-tumor role in the nude mice.
The manuscript is well designed and had appropriate methodology.
| 1. | Lincoln DT, Kaiser HE, Raju GP, Waters MJ. Growth hormone and colorectal carcinoma: localization of receptors. In Vivo. 2000;14:41-49. [PubMed] |
| 2. | Brown RJ, Adams JJ, Pelekanos RA, Wan Y, McKinstry WJ, Palethorpe K, Seeber RM, Monks TA, Eidne KA, Parker MW. Model for growth hormone receptor activation based on subunit rotation within a receptor dimer. Nat Struct Mol Biol. 2005;12:814-821. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 305] [Cited by in RCA: 268] [Article Influence: 12.8] [Reference Citation Analysis (0)] |
| 3. | Swerdlow AJ, Higgins CD, Adlard P, Preece MA. Risk of cancer in patients treated with human pituitary growth hormone in the UK, 1959-85: a cohort study. Lancet. 2002;360:273-277. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 215] [Cited by in RCA: 171] [Article Influence: 7.1] [Reference Citation Analysis (0)] |
| 4. | Pantel J, Grulich-Henn J, Bettendorf M, Strasburger CJ, Heinrich U, Amselem S. Heterozygous nonsense mutation in exon 3 of the growth hormone receptor (GHR) in severe GH insensitivity (Laron syndrome) and the issue of the origin and function of the GHRd3 isoform. J Clin Endocrinol Metab. 2003;88:1705-1710. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 28] [Cited by in RCA: 26] [Article Influence: 1.1] [Reference Citation Analysis (1)] |
| 5. | Sandhu MS, Dunger DB, Giovannucci EL. Insulin, insulin-like growth factor-I (IGF-I), IGF binding proteins, their biologic interactions, and colorectal cancer. J Natl Cancer Inst. 2002;94:972-980. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 381] [Cited by in RCA: 348] [Article Influence: 14.5] [Reference Citation Analysis (2)] |
| 6. | Nysom K, Holm K, Michaelsen KF, Hertz H, Müller J, Mølgaard C. Degree of fatness after treatment of malignant lymphoma in childhood. Med Pediatr Oncol. 2003;40:239-243. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 21] [Cited by in RCA: 18] [Article Influence: 0.8] [Reference Citation Analysis (0)] |
| 7. | Herrington J, Smit LS, Schwartz J, Carter-Su C. The role of STAT proteins in growth hormone signaling. Oncogene. 2000;19:2585-2597. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 222] [Cited by in RCA: 198] [Article Influence: 7.6] [Reference Citation Analysis (0)] |
| 8. | Waters MJ, Hoang HN, Fairlie DP, Pelekanos RA, Brown RJ. New insights into growth hormone action. J Mol Endocrinol. 2006;36:1-7. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 146] [Cited by in RCA: 134] [Article Influence: 6.7] [Reference Citation Analysis (0)] |
| 9. | Banerjee I, Clayton PE. Growth hormone treatment and cancer risk. Endocrinol Metab Clin North Am. 2007;36:247-263. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 22] [Cited by in RCA: 14] [Article Influence: 0.7] [Reference Citation Analysis (0)] |
| 10. | Jeay S, Sonenshein GE, Postel-Vinay MC, Kelly PA, Baixeras E. Growth hormone can act as a cytokine controlling survival and proliferation of immune cells: new insights into signaling pathways. Mol Cell Endocrinol. 2002;188:1-7. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 97] [Cited by in RCA: 84] [Article Influence: 3.5] [Reference Citation Analysis (0)] |
| 11. | Divisova J, Kuiatse I, Lazard Z, Weiss H, Vreeland F, Hadsell DL, Schiff R, Osborne CK, Lee AV. The growth hormone receptor antagonist pegvisomant blocks both mammary gland development and MCF-7 breast cancer xenograft growth. Breast Cancer Res Treat. 2006;98:315-327. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 78] [Cited by in RCA: 80] [Article Influence: 4.0] [Reference Citation Analysis (0)] |
| 12. | Borkhardt A. Blocking oncogenes in malignant cells by RNA interference--new hope for a highly specific cancer treatment? Cancer Cell. 2002;2:167-168. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 43] [Cited by in RCA: 42] [Article Influence: 1.8] [Reference Citation Analysis (0)] |
| 13. | Lassus P, Rodriguez J, Lazebnik Y. Confirming specificity of RNAi in mammalian cells. Sci STKE. 2002;2002:pl13. [PubMed] [DOI] [Full Text] |
| 14. | Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin. 2009;59:225-249. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 7458] [Cited by in RCA: 7750] [Article Influence: 455.9] [Reference Citation Analysis (9)] |
| 15. | Nordlinger B, Sorbye H, Glimelius B, Poston GJ, Schlag PM, Rougier P, Bechstein WO, Primrose JN, Walpole ET, Finch-Jones M. Perioperative chemotherapy with FOLFOX4 and surgery versus surgery alone for resectable liver metastases from colorectal cancer (EORTC Intergroup trial 40983): a randomised controlled trial. Lancet. 2008;371:1007-1016. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1588] [Cited by in RCA: 1417] [Article Influence: 78.7] [Reference Citation Analysis (5)] |
| 16. | Tschoep K, Kohlmann A, Schlemmer M, Haferlach T, Issels RD. Gene expression profiling in sarcomas. Crit Rev Oncol Hematol. 2007;63:111-124. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 57] [Cited by in RCA: 45] [Article Influence: 2.4] [Reference Citation Analysis (0)] |
| 17. | Seguy D, Vahedi K, Kapel N, Souberbielle JC, Messing B. Low-dose growth hormone in adult home parenteral nutrition-dependent short bowel syndrome patients: a positive study. Gastroenterology. 2003;124:293-302. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 191] [Cited by in RCA: 142] [Article Influence: 6.2] [Reference Citation Analysis (1)] |
| 18. | Yin D, Vreeland F, Schaaf LJ, Millham R, Duncan BA, Sharma A. Clinical pharmacodynamic effects of the growth hormone receptor antagonist pegvisomant: implications for cancer therapy. Clin Cancer Res. 2007;13:1000-1009. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 53] [Cited by in RCA: 47] [Article Influence: 2.5] [Reference Citation Analysis (0)] |
| 19. | Jenkins PJ, Mukherjee A, Shalet SM. Does growth hormone cause cancer? Clin Endocrinol (Oxf). 2006;64:115-121. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 131] [Cited by in RCA: 117] [Article Influence: 5.9] [Reference Citation Analysis (0)] |
| 20. | Yi HK, Hwang PH, Yang DH, Kang CW, Lee DY. Expression of the insulin-like growth factors (IGFs) and the IGF-binding proteins (IGFBPs) in human gastric cancer cells. Eur J Cancer. 2001;37:2257-2263. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 81] [Cited by in RCA: 77] [Article Influence: 3.1] [Reference Citation Analysis (0)] |
| 21. | Wu X, Wan M, Li G, Xu Z, Chen C, Liu F, Li J. Growth hormone receptor overexpression predicts response of rectal cancers to pre-operative radiotherapy. Eur J Cancer. 2006;42:888-894. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 22] [Cited by in RCA: 21] [Article Influence: 1.1] [Reference Citation Analysis (0)] |
| 22. | Conway-Campbell BL, Wooh JW, Brooks AJ, Gordon D, Brown RJ, Lichanska AM, Chin HS, Barton CL, Boyle GM, Parsons PG. Nuclear targeting of the growth hormone receptor results in dysregulation of cell proliferation and tumorigenesis. Proc Natl Acad Sci USA. 2007;104:13331-13336. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 94] [Cited by in RCA: 85] [Article Influence: 4.5] [Reference Citation Analysis (0)] |
| 23. | Reinmuth N, Fan F, Liu W, Parikh AA, Stoeltzing O, Jung YD, Bucana CD, Radinsky R, Gallick GE, Ellis LM. Impact of insulin-like growth factor receptor-I function on angiogenesis, growth, and metastasis of colon cancer. Lab Invest. 2002;82:1377-1389. [PubMed] |
| 24. | Matsui K, Sasaki Y, Komatsu T, Mukai M, Kikuchi J, Aoyama Y. RNAi gene silencing using cerasome as a viral-size siRNA-carrier free from fusion and cross-linking. Bioorg Med Chem Lett. 2007;17:3935-3938. [PubMed] [DOI] [Full Text] |
| 25. | Heidenreich O, Krauter J, Riehle H, Hadwiger P, John M, Heil G, Vornlocher HP, Nordheim A. AML1/MTG8 oncogene suppression by small interfering RNAs supports myeloid differentiation of t (8; 21) -positive leukemic cells. Blood. 2003;101:3157-3163. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 140] [Cited by in RCA: 130] [Article Influence: 5.7] [Reference Citation Analysis (0)] |
P- Reviewers: Lee FYJ, Maric I S- Editor: Wen LL L- Editor: Logan S E- Editor: Liu XM