BPG is committed to discovery and dissemination of knowledge
Brief Article Open Access
©2013 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Sep 14, 2013; 19(34): 5685-5692
Published online Sep 14, 2013. doi: 10.3748/wjg.v19.i34.5685
Diversity of Helicobacter pylori genotypes in Iranian patients with different gastroduodenal disorders
Farzam Vaziri, Shahin Najar Peerayeh, Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran 14115-331, Iran
Masoud Alebouyeh, Tabassom Mirzaei, Mohammad Reza Zali, Gastroenterology and Liver Diseases Research Center, Shahid Beheshti University of Medical Sciences, Tehran 19835-187, Iran
Yoshio Yamaoka, Department of Environmental and Preventive Medicine, Oita University Faculty of Medicine, Oita 879-5593, Japan
Yoshio Yamaoka, Department of Medicine-Gastroenterology, Baylor College of Medicine, Houston, TX 77030, United States
Mahsa Molaei, Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Shahid Beheshti University of Medical Sciences, Tehran 19835-187, Iran
Nader Maghsoudi, Neuroscience Research Center (NRC), Shahid Beheshti University of Medical Sciences, Tehran 19615-1178, Iran
Author contributions: Najar Peerayeh S, Alebouyeh M and Yamaoka Y contributed equally to this work; Vaziri F performed the research and wrote the paper; Alebouyeh M and Vaziri F designed the research and analyzed the data; Mirzaei T collected the biopsy samples and cultured the bacteria; Molaei M helped this project as a pathologist; Alebouyeh M, Najar Peerayeh S, Maghsoudi N, Yamaoka Y and Zali MR supervised the research; Yamaoka Y edited the manuscript.
Supported by Gastroenterology and Liver Diseases Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran; Iran National Science Foundation, INSF; and a PhD grant from the Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran; Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan, No. 22390085, 22659087, 24406015 and 24659200; Special Coordination Funds for Promoting Science and Technology from the MEXT of Japan, and a Research Fund at the Discretion of the President, Oita University
Correspondence to: Shahin Najar Peerayeh, PhD, Associate Professor, Department of Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran 14115-331, Iran. najarp_s@modares.ac.ir
Telephone: +98-21-82883870 Fax: +98-21-82884555
Received: August 19, 2012
Revised: September 11, 2012
Accepted: November 14, 2012
Published online: September 14, 2013
Processing time: 389 Days and 19 Hours

Abstract

AIM: To investigate the diversity of Helicobacter pylori (H. pylori) genotypes and correlations with disease outcomes in an Iranian population with different gastroduodenal disorders.

METHODS: Isolates of H. pylori from patients with different gastroduodenal disorders were analyzed after culture and identification by phenotypic and genotypic methods. Genomic DNA was extracted with the QIAamp DNA mini kit (Qiagen, Germany). After DNA extraction, genotyping was done for cagA, vacA (s and m regions), iceA (iceA1, iceA2) and babA with specific primers for each allele using polymerase chain reaction (PCR). All patients’ pathologic and clinical data and their relation with known genotypes were analyzed by using SPSS version 19.0 software. χ2 test and Fisher’s exact test were used to assess relationships between categorical variables. The level of statistical significance was set at P < 0.05.

RESULTS: A total of 71 isolates from 177 patients with different gastroduodenal disorders were obtained. Based on analysis of the cagA gene (positive or negative), vacA s-region (s1 or s2), vacA m-region (m1 or m2), iceA allelic type (iceA1 and iceA2) and babA gene (positive or negative), twenty different genotypic combinations were recognized. The prevalence of cagA, vacA s1, vacA s2, vacA m1, vacA m2, iceA1, iceA2, iceA1+iceA2 and babA were 62%, 78.9%, 19.7%, 21.1%, 78.9%, 15.5%, 22.5%, 40.8% and 95.8%, respectively. Interestingly, evaluation of PCR results for cagA in 6 patients showed simultaneous existence of cagA variants according to their size diversities that proposed mixed infection in these patients. The most prevalent genotype in cagA-positive isolates was cagA+/vacAs1m2/iceA1+A2/babA+ and in cagA-negative isolates was cagA-/vacAs1m2/iceA-/babA+. There were no relationships between the studied genes and histopathological findings (H. pylori density, neutrophil activity, lymphoid aggregation in lamina propria and glandular atrophy). The strains which carry cagA, vacAs1/m1, iceA2 and babA genes showed significant associations with severe active chronic gastritis (P = 0.011, 0.025, 0.020 and 0.031, respectively). The vacAs1 genotype had significant correlation with the presence of the cagA gene (P = 0.013). Also, babA genotype showed associations with cagA (P = 0.024). In the combined genotypes, only cagA+/vacAs1m1/iceA2/babA+ genotype showed correlation with severe active chronic gastritis (P = 0.025).

CONCLUSION: This genotyping panel can be a useful tool for detection of virulent H. pylori isolates and can provide valuable guidance for prediction of the clinical outcomes.

Key Words: Helicobacter pylori; cagA; vacA; iceA; babA



INTRODUCTION

Infection with Helicobacter pylori (H. pylori) causes different clinical disorders such as persistent gastritis, peptic ulcers and mucosa associated lymphoid tissue (MALT) lymphoma. Current studies suggest that H. pylori infection may be a crucial risk factor in the development of gastric cancer[1,2]. In this regard, this pathogen has been categorized as a group I carcinogen by the International Agency for Research on Cancer[3]. The detailed reasons for these different clinical outcomes are unknown, but they may be related to host genetic factors, exposure to environmental factors (e.g., diet, drug usage, acidity of the stomach and smoking) and to the bacterial genotypes[4]. H. pylori shows extensive genetic diversity and this variability has a crucial role in pathogenesis of this bacterium[5]. Several H. pylori virulence factor genes related to the risk of gastroduodenal disorders, including cagA, vacA, babA and iceA, have been proposed[6]. A tremendous number of studies have proved that CagA and VacA producing strains are related to severe clinical outcomes[7]. In addition to cagA and vacA, the other H. pylori virulence factors, such as iceA and babA, also showed such associations in some studies[8,9]. Beyond the role of these factors in progression of the disease, there are several papers which reported a relationship between failure of H. pylori eradication therapy and the strains’ virulence factor genotypes[10]. Analysis of genetic structure of virulence factors among the isolates from different geographic regions will provide new insights regarding the pathogenesis and treatment of H. pylori infection. H. pylori genotyping may have multiple roles including impact on the cure rates of eradication therapy[10], determination of clinical outcomes[11], tracking human migration[12,13] and recently, the prediction of progression of gastric preneoplastic lesions[14]. The distribution pattern of H. pylori genotypes and its correlation with disease outcome shows geographic differences. The aim of this study was to assess the diversity of H. pylori genotypes in an Iranian population to determine genotypically the H. pylori isolates more associated with different gastroduodenal disorders.

MATERIALS AND METHODS
Clinical specimens

Three gastric biopsies (two were used for histological examination and one for culture) were obtained from 177 adult patients undergoing routine diagnostic endoscopy referred to the Endoscopy Centre of Taleghani Hospital of Tehran, Iran, after obtaining informed consent. All subjects answered questionnaires related to age, sex, gastric or duodenal peptic ulcer diseases upon endoscopy.

Culture

Antral or body biopsy specimens from each patient were kept in transport medium consisting of thioglycolate with 1.3 g/L agar (Merck) and 3% yeast extract (Oxoid). The endoscopic biopsy specimens were cut into small pieces, homogenized with a sterile scalpel and were smeared on the surface of Brucella agar plates supplemented with 7% horse blood and Campylobacter selective supplement (vancomycin 2.0 mg, polymyxin 0.05 mg, trimethoprim 1.0 mg) and amphotericin B (2.5 mg/L). Incubation was performed in microaerophilic conditions at 37 °C for 5-7 d. Identification of H. pylori isolates was performed by analyzing colony morphology, Gram staining, oxidase, catalase and urease activities and H. pylori-specific polymerase chain reaction (PCR) (glmM). The isolates were preserved in BHI broth containing 20% glycerol and 10% fetal calf serum and stored at -70 °C.

DNA extraction

Genomic DNA was extracted with the QIAamp DNA mini kit (Qiagen, Germany) according to the manufacturer’s instructions. The DNA was stored at -20 °C until used for molecular studies.

H. pylori genotyping

After DNA extraction, polymerase chain reactions (PCR) were performed in a volume of 25 μL containing 1 × PCR buffer, 1 μmol/L of each primer, 1 μL of genomic DNA (approximately 150 ng), 200 μmol/L of dNTPs mix, 2 mmol/L of MgCl2, and 0.05 U/μL Taq DNA polymerase. PCR amplifications were performed in an automated thermal cycler (AG 22331; Eppendorf, Hamburg, Germany) under the following conditions: for vacA s/m: 33 cycles of 1 min at 94 °C, 33 s at 55 °C, and 1 min at 72 °C; for cagA: 33 cycles of 1 min at 94 °C, 1 min at 59 °C, and 1 min at 72 °C; for iceA1/A2: 33 cycles of 1 min at 94 °C, 40 s at 58 °C, and 1 min at 72 °C, and for babA: 35 cycles of 1 min at 94 °C, 40 s at 58 °C and 1 min at 72 °C. The amplified genes were detected by electrophoresis in a 1.2% agarose gel with ethidium bromide. Table 1 summarizes the primer sequences, annealing temperatures and the expected size of the PCR products.

Table 1 Primers used in this study.
GenePrimers (5’→3’)PCR product (bp)Annealing temperature (°C)Ref.
vacA (s1/s2)VA1F: ATGGAAATACAACAAACACAc259-28655[6]
VA1R: CTGCTTGAATGCGCCAAAC
vacA (m1/m2)VACm1m2F: CAATCTGTCCAATCAAGCGAG567-64255[15]
VACm1m2R: GCGTCAAAATAATTCCAAGG
cagACagAF: AATACACCAACGCCTCCAAG40059[16]
CagAR: TTGTTGCCGCTTTTGCTCTC
iceA1iceA1F: TATTTCTGGAACTTGCGCAACCTGATapproximately 90058[17]
M.Hpy1R: GGCCTACAACCGCATGGATAT
iceA2iceA2 F: CGGCTGTAGGCACTAAAGCTAapproximately 80058[17]
iceA2 R: TCAATCCTATGTGAAACAATGATCGTT
babAbabAF: CCAAACGAAACAAAAAGCGT27158[18]
babAR: GCTTGTGTAAAAGCCGTCGT
glmMGlmM2-F GGATAAGCTTTTAGGGGTGTTAGGGG29652[19]
GlmM1-R GCTTACTTTCTAACACTAACGCGC
Histopathological evaluation

Sections were stained with hematoxylin and eosin for analysis of H. pylori-related histology by an expert pathologist. Then the grade of gastritis was scored based on the updated Sydney System.

Statistical analysis

Data were analyzed by using SPSS version 19.0.0 software (IBM, IL, United States). χ2 test and Fisher’s exact test were used to assess relationships between categorical variables. The level of statistical significance was set at P < 0.05.

RESULTS
Infection rates and clinical disorders

A total of 71 isolates from 177 patients (parenthesis approximately 40%) with different gastroduodenal disorders were obtained. The H. pylori-positive patients consisted of 24 males and 47 females, with their ages ranging between 19 and 85 years (mean age, 66 years). All of the isolates showed positive results for the common identification test and H. pylori-specific PCR (glmM). Most of the infected patients suffered from chronic gastritis (84.6%), while the others showed duodenitis (9.8%), intestinal metaplasia (2.8%), hyperplasia (1.4%) and gastric cancer diseases (1.4%) (Table 2).

Table 2 Association of combined genotypes with pathological conditions in Helicobacter pylori isolates.
Combination of genotypesSCGSACG2MACGMiACGMCGHMGCDTotalP value1
cagA+/vacAs1m2/iceA1+iceA2/babA+112200010117
cagA+/vacAs1m1/iceA2/babA+03000000140.0252
cagA+/vacAs1m2/iceA1/babA+0310001027
cagA+/vacAs1m1/iceA1+iceA2/babA+0610100008
cagA+/vacAs2m2/iceA1+iceA2/babA+0110000002
cagA+/vacAs0m2/iceA2/babA+0000000011
cagA+/vacAs1m2/iceA2/babA+0100000102
cagA+/vacAs2m2/iceA1/babA+0010000001
cagA+/vacAs2m2/iceA-/babA+0100000001
cagA+/vacAs1m2/iceA-/babA+0100000001
cagA-/vacAs1m2/iceA-/babA+0320100017
cagA-/vacAs1m1/iceA-/babA+0100100002
cagA-/vacAs2m2/iceA2/babA+1000200003
cagA-/vacAs1m2/iceA2/babA+0220010005
cagA-/vacAs2m2/iceA1/babA+0100000001
cagA-/vacAs1m1/iceA2/babA+0010000001
cagA-/vacAs2m2/iceA-/babA+0310000004
cagA-/vacAs1m2/iceA1+iceA2/babA+0100000001
cagA-/vacAs1m2/iceA1+iceA2/babA-0001000001
cagA-/vacAs2m2/iceA1/babA-0010000012
Total23913151217 71
Allelic diversities in main putative virulence markers

cagA genotyping: The 400-bp PCR product indicating the presence of the cagA gene was obtained in 44 isolates (62%) and 27 (38%) were negative. Interestingly, evaluation of PCR results for cagA in 6 patients showed simultaneous existence of cagA variants according to their size diversities.

vacA genotyping: The frequency of vacA s1, vacA s2, vacA m1 and vacA m2 were 78.9%, 19.7%, 21.1% and 78.9%, respectively. Only one isolate was vacA s0m2 (with no PCR product for s region).

iceA genotyping: Sole existence of iceA1 genotype was detected in 15.5% and iceA2 genotype in 22.5% of the colonized patients. Interestingly, out of the total studied samples, 40.8% were infected with both iceA1 and iceA2 genotypes and 21.1% were negative for these genes.

babA genotyping:babA was found in 68 of the patients (95.8%); however, three patients (4.2%) did not show this allelic variant (Figure 1).

Figure 1
Figure 1 Polymerase chain reaction products of the main putative virulence markers. Lane 1: DNA ladder mix; Lane 2: vacAs1m1 genotype; Lane 3: vacAs1m2 genotype; Lane 4: vacAs2m2 genotype; Lane 5: iceA1+iceA2 genotype; Lane 6: babA genotype; Lane 7: cagA genotype
Correlation of H. pylori genotypes with pathological data, patients’ age and clinical outcome

Combination of genotypes: Based on the analysis of the cagA gene (positive or negative), vacA s-region (s1 or s2), vacA m-region (m1 or m2), iceA allelic types (iceA1 and iceA2) and babA (positive or negative), twenty different genotypic combinations were recognized. The most prevalent genotype in cagA positive isolates was cagA+/vacAs1m2/iceA1+A2+/babA+ and in cagA negative isolates was cagA-/vacAs1m2/iceA-/babA+ (Figure 2).

Figure 2
Figure 2 The frequency of combined genotypes. A: Combined vacA, iceA and babA genotypes in 44 cagA positive isolate; B: Combined vacA, iceA and babA genotypes in 27 cagA negative isolates.

Helicobacter pylori density, neutrophil activity, lymphoid aggregation in lamina propria and glandular atrophy: There was no significant relationship between cagA positivity and H. pylori density, neutrophil activity, lymphoid aggregation in lamina propria and glandular atrophy in the biopsies. Also no relationships were found between other genes and these histopathological findings.

Patients’ age: There was no significant relationship between the genotypes, clinical and pathological data and patients’ age.

Chronic gastritis: The gastritis was scored as severe active chronic gastritis, moderate active chronic gastritis, mild active chronic gastritis, severe chronic gastritis and moderate chronic gastritis. The strains which carried the cagA gene showed significant associations with severe active chronic gastritis (P = 0.011). Also, the strains which carried the vacA s1/m1 gene showed significant associations with severe active chronic gastritis (P = 0.025). babA (P = 0.031) and iceA2 (P = 0.020) also had significant correlation with severe active chronic gastritis. In the combined genotypes this association was observed for cagA+/vacAs1m1/iceA2/babA+ genotype in the case of severe active chronic gastritis (P = 0.025).

Genotype correlation: Interestingly, the vacA s1 genotype had significant correlation with the presence of the cagA gene (P = 0.013). Also babA genotype showed this association in cagA positive isolates (P = 0.024).

DISCUSSION

H. pylori infection is usually present in 60%-80% of gastric and 95% of duodenal ulcers. However, some conditions affect infection rate of this bacterium in different geographic and socioeconomic regions. The prevalence of infection is typically higher in developing countries (greater than 80%) and lower in the developed ones (typically less than 40%)[20]. It has been demonstrated that the prevalence of H. pylori infection in developing countries with low socioeconomic status and poor management of drinking water is much higher (> 80%) than that in developed countries (< 60%)[21]. In our study the recovery rate of H. pylori was 40% which shows the improvement in the living conditions and hygiene in Iran that has also been reported recently[22].

H. pylori can be divided into cagA-positive and cagA-negative strains, and there is increasing evidence that infection with cagA-positive isolates is associated with a greater risk of adverse clinical outcomes than infections with strains lacking this gene. In the current study, the strains which carried the cagA gene showed significant associations with severe active chronic gastritis. Interestingly, the prevalence of the cagA-positive strain differs among different countries, and more than 90% of H. pylori strains are cagA-positive in East Asian countries, irrespective of clinical presentation[23]. Sasaki et al[24] showed that among H. pylori DNA-positive samples, cagA was detected in 45.9% from Ecuador and 20.0% from Panama. In our study the prevalence of cagA-positive isolates is 62% which is less than other Asian countries and more than other countries (e.g., Ecuador, Panama). According to Watada et al[25] study, the prevalence of cagA was 65.5% in Colombia and 100% in Japan, which showed that the prevalence of this gene in our study is similar to the Colombian isolates. In another study conducted in Bulgaria, the prevalence of cagA was 84.9% which is more than our results[26]. Interestingly, we had 6 isolates which had two different sizes of cagA simultaneously, showing the occurrence of mixed infection in these patients.

Variations of vacA are associated with different risks of gastrointestinal disorders. In general, vacA s1 and m1 genotypes produce a large amount of toxin, whereas s2 and m2 genotypes show little or no toxin production[27]. Recently, a third polymorphic determinant of vacuolating activity has been described as located between the s-region and m-region, an intermediate (i) region[28]. The frequency of the vacA s1 and vacA m1 genotypes in the Middle Eastern countries was found to be 71.5% and 32.8%, respectively[11], which is in concordance with our study. We did not detect any vacA s2m1 genotypes in our isolates which has been reported to be rare[23]. The vacA s1 and m1 genotypes have been reported to be associated with H. pylori-related diseases; however vacA s2 and m2 strains are rarely associated with peptic ulcer and gastric cancer because of their low or non-vacuolating activities[23]. Genotyping of vacA will be useful in screening individuals for risk factors associated with gastric cancer and peptic ulcer development. Asrat et al[29] showed that vacAs1m1 genotype was the most common genotype in Ethiopian adult dyspeptic patients, and also vacA- and cagA-positive H. pylori strains were detected to a higher degree in patients with chronic active gastritis. Interestingly, similar to our results, correlation of the vacA s1 genotype with the presence of the cagA gene was reported by Atherton[30]. The vacAs1m2 genotype is more common in our Iranian patients, as previously described in Iran[31]. As reviewed by Suzuki et al[32], the predominant vacA genotypes in Asia, Europe and Africa are vacAs1m1 and their subtypes, which is in contrast to our genotypes in Iranian isolates.

In spite of the low frequency of vacAs1m1 genotypes in our study, isolates which carried the vacAs1m1 gene showed significant associations with severe active chronic gastritis. In a review by Hosseini et al[33], they concluded that in contrast to vacA, there is no correlation between cagA genotype and disease status in the majority of studies conducted in Iran; but results of our study, however, proposed both of these genetic markers as useful indicators for predicting clinical outcomes in the studied population.

The meta-analysis by Shiota et al[8] confirmed the importance of the presence of iceA gene for peptic ulcer, although the significance was controversial. Such different results between the iceA allelic types and clinical disorders could be explained by the difference in geographic regions. In our study we found a significant relationship between iceA2 genotype and clinical outcomes (severe active chronic gastritis), which was also observed by Caner et al[34] in Turkey. As Shiota et al[8] summarized in their meta-analysis, most of the studies showed no association between iceA1 and cagA status, which is in concordance with our study. Interestingly, the prevalence of mixed genotype iceA1 + iceA2 (40.8%) in our study was higher than other studies which had detected this mixed genotype[35-37]. So this high prevalence with mixed genotypes makes it difficult to analyze potential relationships between the presence of each iceA allelic variant and clinical outcomes. babA genotype was frequently found in H. pylori strains in our study (95.8%); this was associated with severe active chronic gastritis. Although this genotype showed significant correlation with the existence of cagA, no significant correlation was observed with other virulence factors such as vacA s1/s2, vacA m1/m2 and iceA1/iceA2. Chomvarin et al[38] detected the babA gene in 92% (103/112) of Thai patients, which is almost similar to our results; while in another study conducted in Cuba the prevalence of babA gene was lower (82.3%)[39]. It is important to mention that this PCR based method for babA genotyping must be confirmed by immunoblotting. Actually isolates were scored as babA-gene positive if the PCR and/or Southern blot analysis yielded a positive result[9].

Regarding the combination of genotypes, we observed twenty different genotypes which showed vast diversities in the H. pylori isolates in our study. Interestingly there was not any significant association between these combined genotypes and clinical outcomes, except for cagA+/vacAs1m1/iceA2/babA+ genotype which showed significant association with severe active chronic gastritis.

Genotypes of H. pylori, especially cagA and vacA, are reported to be crucial factors determining the cure rates. So to select an H. pylori eradication regimen, we need to consider H. pylori genotypes[10]. H. pylori genotype distributions and their correlations with disease outcomes have shown geographical differences. In this regard, Yamaoka et al[7] reviewed that within East Asia, where the incidence of gastric cancer is high, that vacA m1 genotype is dominant; whereas in southern parts where the gastric cancer incidence is low, the m2 genotype, which we observed in our study, is predominant. Dabiri et al[31] showed that there was statistically no association between the vacA, cagA and cagE status and clinical outcomes in Iranian patients, and recommended that other different markers may be more useful for this analysis. In comparison, in the current study, genotyping on the basis of cagA, babA, vacA and iceA was considered as a useful tool for predicting the clinical outcomes. Therefore, analyzing the multiple virulence factors of H. pylori (cagA, vacA, iceA and babA) might enable us to predict the patient’s clinical outcome among Iranian patients. This prediction could be more accurate when accompanied by the impacts of environmental factors and host genetic polymorphisms such as interleukin-1 receptor antagonist gene polymorphism[37]. Nowadays, concurrent genotyping of H. pylori virulence markers and host factors is becoming increasingly crucial in the prediction of the diseases outcomes[40].

In conclusion, our results show that most of the H. pylori isolates were highly virulent on the basis of the main clinically allelic variants in three or four virulence factors they carried. The Iranian isolates predominantly possessed different genotypes which showed vast diversities. Significant association of the noted genotypes with severe active chronic gastritis suggests that this genotyping panel is a suitable tool for detection of virulent H. pylori isolates that could provide valuable guidance for prediction of the clinical outcomes.

ACKNOWLEDGMENTS

The authors would like to thank Leila Shokrzadeh and Ehsan Nazemalhosseini from the Gastroenterology and Liver Diseases Research Center, Shahid Beheshti University of Medical Sciences.

COMMENTS
Background

Infection with Helicobacter pylori (H. pylori) causes diverse clinical outcomes such as persistent gastritis, peptic ulcers, mucosa associated lymphoid tissue lymphoma and gastric cancer. One of the reasons for these different clinical outcomes is genetic diversity of H. pylori; therefore determination of the pattern of H. pylori genotypes and its correlation with disease outcome, which shows geographic differences, is crucial.

Research frontiers

The H. pylori genotyping may have multiple roles including prediction of clinical outcomes, impact on the H. pylori infection therapy, tracking human migration, and recently, the prediction of progression of gastric preneoplastic lesions. Therefore genotyping of H. pylori can be a valuable and multifunctional tool in the clinical field.

Innovations and breakthroughs

In the majority of previous studies, the researchers were not able to detect any significant relationship between their genotyping panels and clinical outcomes for H. pylori infections. Most of these studies had used few genetic markers. In order to overcome this disadvantage, the authors have chosen greater numbers of H. pylori genetic markers for studying this association.

Applications

The genotyping panel which contains eight important genetic markers can serve as a useful tool for typing of H. pylori isolates and, to some extent, predict clinical outcomes.

Peer review

This is an epidemiological paper with statistical analysis, dealing with the important question of association between certain H. pylori genotypes and specific pathologies, and with the problem of predictive value of H. pylori infection genotyping. In the submitted manuscript this issue is dissected in fine detail and uses quite extensive clinical material, thus providing novel and more reliable data.

References
1.  Hatakeyama M. Helicobacter pylori and gastric carcinogenesis. J Gastroenterol. 2009;44:239-248.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 146]  [Cited by in RCA: 141]  [Article Influence: 8.3]  [Reference Citation Analysis (0)]
2.  Polk DB, Peek RM. Helicobacter pylori: gastric cancer and beyond. Nat Rev Cancer. 2010;10:403-414.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 934]  [Cited by in RCA: 866]  [Article Influence: 54.1]  [Reference Citation Analysis (0)]
3.  Schistosomes , liver flukes and Helicobacter pylori. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Lyon, 7-14 June 1994. IARC Monogr Eval Carcinog Risks Hum. 1994;61:1-241.  [PubMed]  [DOI]
4.  Fuccio L, Eusebi LH, Bazzoli F. Gastric cancer, Helicobacter pylori infection and other risk factors. World J Gastrointest Oncol. 2010;2:342-347.  [PubMed]  [DOI]  [Full Text]
5.  Suerbaum S, Achtman M. Helicobacter pylori: recombination, population structure and human migrations. Int J Med Microbiol. 2004;294:133-139.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 34]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
6.  Atherton JC, Cao P, Peek RM, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270:17771-17777.  [PubMed]  [DOI]
7.  Yamaoka Y, Kato M, Asaka M. Geographic differences in gastric cancer incidence can be explained by differences between Helicobacter pylori strains. Intern Med. 2008;47:1077-1083.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 195]  [Cited by in RCA: 182]  [Article Influence: 10.1]  [Reference Citation Analysis (0)]
8.  Shiota S, Watada M, Matsunari O, Iwatani S, Suzuki R, Yamaoka Y. Helicobacter pylori iceA, clinical outcomes, and correlation with cagA: a meta-analysis. PLoS One. 2012;7:e30354.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 51]  [Cited by in RCA: 44]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
9.  Yamaoka Y. Roles of Helicobacter pylori BabA in gastroduodenal pathogenesis. World J Gastroenterol. 2008;14:4265-4272.  [PubMed]  [DOI]  [Full Text]
10.  Sugimoto M, Yamaoka Y. Virulence factor genotypes of Helicobacter pylori affect cure rates of eradication therapy. Arch Immunol Ther Exp (Warsz). 2009;57:45-56.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 58]  [Cited by in RCA: 58]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
11.  Sugimoto M, Zali MR, Yamaoka Y. The association of vacA genotypes and Helicobacter pylori-related gastroduodenal diseases in the Middle East. Eur J Clin Microbiol Infect Dis. 2009;28:1227-1236.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 62]  [Cited by in RCA: 70]  [Article Influence: 4.1]  [Reference Citation Analysis (0)]
12.  Yamaoka Y. Helicobacter pylori typing as a tool for tracking human migration. Clin Microbiol Infect. 2009;15:829-834.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 82]  [Cited by in RCA: 61]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
13.  Suerbaum S, Josenhans C. Helicobacter pylori evolution and phenotypic diversification in a changing host. Nat Rev Microbiol. 2007;5:441-452.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 312]  [Cited by in RCA: 278]  [Article Influence: 14.6]  [Reference Citation Analysis (0)]
14.  González CA, Figueiredo C, Lic CB, Ferreira RM, Pardo ML, Ruiz Liso JM, Alonso P, Sala N, Capella G, Sanz-Anquela JM. Helicobacter pylori cagA and vacA genotypes as predictors of progression of gastric preneoplastic lesions: a long-term follow-up in a high-risk area in Spain. Am J Gastroenterol. 2011;106:867-874.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 109]  [Cited by in RCA: 96]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
15.  Qiao W, Hu JL, Xiao B, Wu KC, Peng DR, Atherton JC, Xue H. cagA and vacA genotype of Helicobacter pylori associated with gastric diseases in Xi’an area. World J Gastroenterol. 2003;9:1762-1766.  [PubMed]  [DOI]
16.  Russo F, Notarnicola M, Di Matteo G, Leoci C, Caruso ML, Pirrelli M, Caradonna M, Morandi L, Di Leo A. Detection of Helicobacter pylori cagA gene by polymerase chain reaction in faecal samples. Eur J Gastroenterol Hepatol. 1999;11:251-256.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 21]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
17.  Mukhopadhyay AK, Kersulyte D, Jeong JY, Datta S, Ito Y, Chowdhury A, Chowdhury S, Santra A, Bhattacharya SK, Azuma T. Distinctiveness of genotypes of Helicobacter pylori in Calcutta, India. J Bacteriol. 2000;182:3219-3227.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 179]  [Cited by in RCA: 179]  [Article Influence: 6.9]  [Reference Citation Analysis (0)]
18.  Sheu BS, Sheu SM, Yang HB, Huang AH, Wu JJ. Host gastric Lewis expression determines the bacterial density of Helicobacter pylori in babA2 genopositive infection. Gut. 2003;52:927-932.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 124]  [Cited by in RCA: 126]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
19.  Kauser F, Hussain MA, Ahmed I, Ahmad N, Habeeb A, Khan AA, Ahmed N. Comparing genomes of Helicobacter pylori strains from the high-altitude desert of Ladakh, India. J Clin Microbiol. 2005;43:1538-1545.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 43]  [Cited by in RCA: 42]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
20.  Vale FF, Vítor JM. Transmission pathway of Helicobacter pylori: does food play a role in rural and urban areas? Int J Food Microbiol. 2010;138:1-12.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 108]  [Cited by in RCA: 86]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
21.  Salih BA. Helicobacter pylori infection in developing countries: the burden for how long? Saudi J Gastroenterol. 2009;15:201-207.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 170]  [Cited by in RCA: 155]  [Article Influence: 9.1]  [Reference Citation Analysis (0)]
22.  Farshad S, Japoni A, Alborzi A, Zarenezhad M, Ranjbar R. Changing prevalence of Helicobacter pylori in south of Iran. IJCID. 2010;5:65-69.  [PubMed]  [DOI]
23.  Yamaoka Y, Orito E, Mizokami M, Gutierrez O, Saitou N, Kodama T, Osato MS, Kim JG, Ramirez FC, Mahachai V. Helicobacter pylori in North and South America before Columbus. FEBS Lett. 2002;517:180-184.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 155]  [Cited by in RCA: 150]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
24.  Sasaki T, Hirai I, Izurieta R, Kwa BH, Estevez E, Saldana A, Calzada J, Fujimoto S, Yamamoto Y. Analysis of Helicobacter pylori Genotype in Stool Specimens of Asymptomatic People. Lab Med. 2009;40:412-414.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 6]  [Article Influence: 0.4]  [Reference Citation Analysis (0)]
25.  Watada M, Shiota S, Matsunari O, Suzuki R, Murakami K, Fujioka T, Yamaoka Y. Association between Helicobacter pylori cagA-related genes and clinical outcomes in Colombia and Japan. BMC Gastroenterol. 2011;11:141.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 10]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
26.  Boyanova L, Yordanov D, Gergova G, Markovska R, Mitov I. Benefits of Helicobacter pylori cagE genotyping in addition to cagA genotyping: a Bulgarian study. Antonie Van Leeuwenhoek. 2011;100:529-535.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 9]  [Article Influence: 0.6]  [Reference Citation Analysis (0)]
27.  Letley DP, Atherton JC. Natural diversity in the N terminus of the mature vacuolating cytotoxin of Helicobacter pylori determines cytotoxin activity. J Bacteriol. 2000;182:3278-3280.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 65]  [Cited by in RCA: 58]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
28.  Rhead JL, Letley DP, Mohammadi M, Hussein N, Mohagheghi MA, Eshagh Hosseini M, Atherton JC. A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer. Gastroenterology. 2007;133:926-936.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 335]  [Cited by in RCA: 295]  [Article Influence: 15.5]  [Reference Citation Analysis (0)]
29.  Asrat D, Nilsson I, Mengistu Y, Kassa E, Ashenafi S, Ayenew K, Wadström T, Abu-Al-Soud W. Prevalence of Helicobacter pylori vacA and cagA genotypes in Ethiopian dyspeptic patients. J Clin Microbiol. 2004;42:2682-2684.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 21]  [Cited by in RCA: 19]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
30.  Atherton JC. The pathogenesis of Helicobacter pylori-induced gastro-duodenal diseases. Annu Rev Pathol. 2006;1:63-96.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 444]  [Cited by in RCA: 396]  [Article Influence: 19.8]  [Reference Citation Analysis (0)]
31.  Dabiri H, Bolfion M, Mirsalehian A, Rezadehbashi M, Jafari F, Shokrzadeh L, Sahebekhtiari N, Zojaji H, Yamaoka Y, Mirsattari D. Analysis of Helicobacter pylori genotypes in Afghani and Iranian isolates. Pol J Microbiol. 2010;59:61-66.  [PubMed]  [DOI]
32.  Suzuki R, Shiota S, Yamaoka Y. Molecular epidemiology, population genetics, and pathogenic role of Helicobacter pylori. Infect Genet Evol. 2012;12:203-213.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 117]  [Cited by in RCA: 102]  [Article Influence: 7.3]  [Reference Citation Analysis (0)]
33.  Hosseini E, Poursina F, van de Wiele T, Ghasemian Safaei H, Adibi P. Helicobacter pylori in Iran: A systematic review on the association of genotypes and gastroduodenal diseases. J Res Med Sci. 2012;17.  [PubMed]  [DOI]
34.  Caner V, Yilmaz M, Yonetci N, Zencir S, Karagenc N, Kaleli I, Bagci H. H pylori iceA alleles are disease-specific virulence factors. World J Gastroenterol. 2007;13:2581-2585.  [PubMed]  [DOI]
35.  Figueiredo C, Van Doorn LJ, Nogueira C, Soares JM, Pinho C, Figueira P, Quint WG, Carneiro F. Helicobacter pylori genotypes are associated with clinical outcome in Portuguese patients and show a high prevalence of infections with multiple strains. Scand J Gastroenterol. 2001;36:128-135.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 90]  [Cited by in RCA: 86]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
36.  Ben Mansour K, Fendri C, Zribi M, Masmoudi A, Labbene M, Fillali A, Ben Mami N, Najjar T, Meherzi A, Sfar T. Prevalence of Helicobacter pylori vacA, cagA, iceA and oipA genotypes in Tunisian patients. Ann Clin Microbiol Antimicrob. 2010;9:10.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 49]  [Cited by in RCA: 56]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
37.  Pachathundikandi SK, Kumar A, Zacharias P, Madassery J. Analysis of CagA, VacA and IceA genotypes of colonized Helicobacter pylori and Interleukin-1 receptor antagonist (IL-1RN) gene polymorphism among dyspepsia patients. J Med Med Sci. 2011;2:1060-1066.  [PubMed]  [DOI]
38.  Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, Tor-Udom S, Vilaichone RK. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis. 2008;12:30-36.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 111]  [Cited by in RCA: 110]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
39.  Torres LE, Melián K, Moreno A, Alonso J, Sabatier CA, Hernández M, Bermúdez L, Rodríguez BL. Prevalence of vacA, cagA and babA2 genes in Cuban Helicobacter pylori isolates. World J Gastroenterol. 2009;15:204-210.  [PubMed]  [DOI]  [Full Text]
40.  Ryberg A, Borch K, Sun YQ, Monstein HJ. Concurrent genotyping of Helicobacter pylori virulence genes and human cytokine SNP sites using whole genome amplified DNA derived from minute amounts of gastric biopsy specimen DNA. BMC Microbiol. 2008;8:175.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 17]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
Footnotes

P- Reviewers Klimovich AV, Takeuchi H S- Editor Jiang L L- Editor Logan S E- Editor Ma S

Write to the Help Desk