BPG is committed to discovery and dissemination of knowledge
Brief Article Open Access
©2013 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Aug 14, 2013; 19(30): 4935-4943
Published online Aug 14, 2013. doi: 10.3748/wjg.v19.i30.4935
Analysis of single nucleotide polymorphisms in the region of CLDN2-MORC4 in relation to inflammatory bowel disease
Jan Söderman, Elisabeth Norén, Malin Christiansson, Hanna Bragde, Division of Medical Diagnostics, Ryhov County Hospital, 55185 Jönköping, Sweden
Elisabeth Norén, Department of Clinical and Experimental Medicine, Linköping University, 58183 Linköping, Sweden
Raphaele Thiébaut, Jean-Pierre Hugot, INSERM, U843, Université Paris Diderot, Hôpital Robert Debré, 75019 Paris, France
Raphaele Thiébaut, Jean-Pierre Hugot, Université Paris-Diderot Sorbonne Paris-Cité, UMR843, 75018 Paris, France
Jean-Pierre Hugot, Assistance Publique-Hopitaux de Paris, Hopital Robert Debré, 75019 Paris, France
Curt Tysk, Division of Gastroenterology, Department of Medicine, University Hospital, School of Health and Medical Sciences, Örebro University, 70185 Örebro, Sweden
Curt Tysk, School of Health and Medical Sciences, Örebro University, 70185 Örebro, Sweden
Colm A O’Morain, Department of Gastroenterology, Adelaide and Meath Hospital, Tallaght, Dublin 24, Ireland
Colm A O’Morain, Trinity College Dublin, College Green, Dublin 2, Ireland
Miquel Gassull, Health Sciences Research Institute, Germans Trias i Pujol, 08916 Badalona, Spain
Yigael Finkel, Department of Gastroenterology, Sachs’ Children’s Hospital, Södersjukhuset, 11861 Stockholm, Sweden
Jean-Frédéric Colombel, EPIMAD group, Registre EPIMAD, Service d’Epidémiologie et de Santé Publique, Hôpital Calmette, Centre Hospitalier Universitaire de Lille, 59037 Lille, France
Jean-Frédéric Colombel, Icahn School of Medicine at Mount Sinai, New York, NY 10029, United States
Marc Lémann, GETAID group, Groupe d’Etude Thérapeutiques des Affections Inflammatoires Digestives, Service de gastroentérologie, Hôpital Saint Louis, 75010 Paris, France
Sven Almer, Department of Clinical and Experimental Medicine, Linköping University, 58183 Linköping, Sweden
Sven Almer, Department of Gastroenterology UHL, County Council of Östergötland, 58185 Linköping, Sweden
Sven Almer, Division of Gastroenterology, Karolinska Institutet, Department of Gastroenterology and Hepatology, Karolinska university hospital, 14186 Stockholm, Sweden
Author contributions: Söderman J and Norén E contributed equally to this work; Söderman J and Almer S conceived of the study; Söderman J, Norén E and Almer S designed the study, contributed to data analysis and interpretation, and drafted the manuscript; Söderman J, Norén E, Christiansson M and Bragde H contributed to genotyping and sequencing; Hugot JP, Tysk C, O’Morain CA, Gassull M, Finkel Y, Colombel JF, Lémann M (deceased) and Almer S provided blood samples and patient data; Söderman J, Norén E and Thiébaut R performed the statistical analysis; Hugot JP participated in study design and coordination; all authors read and approved the final manuscript.
Supported by Grants from Futurum - the academy of healthcare, County council of Jönköping; the Swedish Society of Medicine; the Research Council of South-East Sweden (FORSS) and the County Council of Östergötland (ALF-Grants)
Correspondence to: Elisabeth Norén, BSc, Division of Medical Diagnostics, Ryhov County Hospital, Sjukhusgatan, 55185 Jönköping, Sweden. elisabeth.noren@lj.se
Telephone: +46-36-322302 Fax: +46-36-180073
Received: December 23, 2012
Revised: April 24, 2013
Accepted: June 5, 2013
Published online: August 14, 2013
Processing time: 235 Days and 19.7 Hours

Abstract

AIM: To investigate a possible genetic influence of claudin (CLDN)1, CLDN2 and CLDN4 in the etiology of inflammatory bowel disease.

METHODS: Allelic association between genetic regions of CLDN1, CLDN2 or CLDN4 and patients with inflammatory bowel disease, Crohn’s disease (CD) or ulcerative colitis were investigated using both a case-control study approach (one case randomly selected from each of 191 Swedish inflammatory bowel disease families and 333 controls) and a family-based study (463 non-Swedish European inflammatory bowel disease -families). A nonsynonymous coding single nucleotide polymorphism in MORC4, located on the same linkage block as CLDN2, was investigated for association, as were two novel CLDN2 single nucleotide polymorphism markers, identified by resequencing.

RESULTS: A single nucleotide polymorphism marker (rs12014762) located in the genetic region of CLDN2 was significantly associated to CD (case-control allelic OR = 1.98, 95%CI: 1.17-3.35, P = 0.007). MORC4 was present on the same linkage block as this CD marker. Using the case-control approach, a significant association (case control allelic OR = 1.61, 95%CI: 1.08-2.41, P = 0.018) was found between CD and a nonsynonymous coding single nucleotide polymorphism (rs6622126) in MORC4. The association between the CLDN2 marker and CD was not replicated in the family-based study. Ulcerative colitis was not associated to any of the single nucleotide polymorphism markers.

CONCLUSION: These findings suggest that a variant of the CLDN2-MORC4 region predisposes to CD in a Swedish population.

Key Words: Crohn’s disease; Genetic predisposition; Inflammatory bowel disease; Single nucleotide polymorphism; Tight junctions

Core tip: Tight junction proteins are key components in the regulation of paracellular permeability and therefore we considered claudin genes as candidate genes in the study. Association was identified between a single nucleotide polymorphism marker (rs12014762) in the CLDN2-MORC4 region and the occurrence of Crohn’s disease (CD) in a Swedish population. Additionally, a nonsynonymous coding single nucleotide polymorphism (rs6622126) in MORC4 was associated to CD. Our findings add further support for a genetically impaired intestinal epithelial barrier as one predisposing factor in the etiology of CD.



Core tip: Tight junction proteins are key components in the regulation of paracellular permeability and therefore we considered claudin genes as candidate genes in the study. Association was identified between a single nucleotide polymorphism marker (rs12014762) in the CLDN2-MORC4 region and the occurrence of Crohn’s disease (CD) in a Swedish population. Additionally, a nonsynonymous coding single nucleotide polymorphism (rs6622126) in MORC4 was associated to CD. Our findings add further support for a genetically impaired intestinal epithelial barrier as one predisposing factor in the etiology of CD.


INTRODUCTION

Chronic inflammatory bowel disease (IBD) encompasses Crohn’s disease (CD), ulcerative colitis (UC) and, in the absence of a confident diagnosis, unclassified colitis (IBD-U). Susceptibility to IBD and the broad spectrum of phenotypic expressions depends on contributions from environmental factors and a genetic predisposition. Several etiological factors have been suggested, including the presence of specific strains of commensal enteric bacteria, defective bacterial killing, aberrant regulation of innate and adaptive immune responses and an impaired intestinal barrier[1]. Consistent with this, several genetic associations in IBD have been described[2-8].

Both CD and UC have been associated with an increase in intestinal permeability[9-11]. Based on findings of an increased intestinal permeability among healthy first-degree relatives to CD patients, a role for a tight junction (TJ) based genetic contribution to permeability changes has been suggested as a predisposing susceptibility factor for CD[12]. This suggestion has been contradicted by other studies[13-15]. However, by defining a normal range of intestinal permeability in healthy controls, a subgroup of healthy first-degree relatives to CD patients with increased intestinal permeability has been identified[16]. An increased permeability response to acetylsalicylic acid has been observed in CD patients and their relatives, indicating hereditary factors underlying this responsiveness[14]. An increased permeability may be primary or a consequence of subclinical intestinal inflammation present as an inherited abnormality in relatives of CD-patients[17]. It is still unknown whether this disturbed permeability is caused by genetic or environmental factors, but several studies provide support for a genetic rather than environmental induced increase[18,19].

The barrier of epithelial cells, with their apical TJ-structure, is critical for the permeability properties of the intestine. The TJ-structure is a multicomponent protein complex that serves to seal and regulate permeability across the paracellular space between adjacent epithelial cells, with the family of membrane-spanning claudin-proteins as the major determinants[20,21]. Claudin-1 and claudin-4 have been associated with a tight TJ-structure whereas claudin-2 expression results in a more leaky epithelial layer[22-24]. Expressions of claudins, and other TJ-proteins, are subject to regulation by different cytokines[20]. Claudin-4 seems to be preferentially expressed in M-cells[25] and the dome area of the follicle-associated epithelium[26], which has been suggested to be the site of initial inflammation in ileal CD[27].

Our aim was to elucidate a possible genetic influence of tight junction-components to IBD-susceptibility and therefore we conducted genetic association studies using single nucleotide polymorphism (SNP) markers of the genetic regions of claudin 1 (CLDN1, chromosome 3q28-q29), claudin 2 (CLDN2, chromosome Xq22.3-q23) and claudin 4 (CLDN4, chromosome 7q11.23). Furthermore, in order to identify putative functional sequence variants of CLDN2, the promoter region, exon-intron boundaries and exons harbouring the 5’ untranslated region and protein coding region were amplified and resequenced.

MATERIALS AND METHODS
Study subjects

The IBD-families in this study originated from the large European collaboration that lead to the discovery of NOD2/CARD15 as a CD susceptibility gene[5,28]. Swedish IBD-patients were selected for inclusion in a case-control study, whereas the remaining non-Swedish families were used in a family based genetic association study (Table 1). Samples from an anonymized regional DNA bank consisting of randomly selected individuals (n = 800) living in the southeastern part of Sweden were used as controls in the case-control studies. The study was conducted under approval by the ethics committees of Linköping University (DNR 97271) and Karolinska Institutet (DNR 97-327).

Table 1 General study outline.
Study design1Cohort and diseaseNumber of familiesNumber of individualsWomen
Case control studyHealthy unrelated controls333162
Swedish IBD families191
IBD347157
CD15069
UC16671
IBD-U3117
Family based approachNon-Swedish families463
IBD715398
CD528297
UC15183
IBD-U3618
SNP selection for genetic association studies

Linkage blocks were defined using SNP data from the HapMap CEPH collection and the SNPbrowser software version 3.5 (Applied Biosystems, Foster City, CA, United States) and a default value of 0.3 linkage disequilibrium units (LDU)[29]. SNP markers were selected for CLDN1, CLDN2 and CLDN4 (Table 2). A distance less than 1 LDU has been considered useful for allelic association[30]. SNP markers were also chosen from adjacent linkage blocks.

Table 2 Single nucleotide polymorphism markers in the genetic regions of Claudin-1, Claudin-2 and Claudin-4.
Candidate geneSNP rs number1MAF2Assay ID3Position in kbp relative candidate gene and location4Coverage5
CLDN1rs14919910.25C_7550365_10-66.3 (5’-flanking region)CLDN16
rs37329230.41C_27509271_105.5 (intron 1)CLDN1 (from promoter until first two thirds of intron 1)
rs37329240.29C_8528578_105.6 (intron 1)CLDN1 (from promoter until first two thirds of intron 1)
rs98482830.49C_2057729_106.4 (intron 1)CLDN1 (from promoter until first two thirds of intron 1)
rs126291660.47C_2057718_1013.8 (intron 3)CLDN1 (from second intron until 3’-flanking region)
rs76201660.41C_8528273_1045.9 (3’-flanking region)CLDN1 (from second intron until 3’-flanking region)
rs5674080.42C_1587588_1094.5 (3’-flanking region)intergenic block
rs5364350.42C_1587674_10155.3 (3’-flanking region)LOC391603
CLDN2rs44095250.34C_382795_10-23.3 (5’-flanking region)RIPPLY1, TBC1D8B
rs59170270.48C_11771710_10-1.0 (5’-flanking region)CLDN2, MORC4
rs120147620.21C_2013132_2020.0 (3’-flanking region)CLDN2, MORC4
CLDN4rs41313760.43C_26657639_10-56.9 (5’-flanking region)ABHD11, CLDN3, CLDN4, WBSCR27, WBSCR28
rs86290.18C_7493975_100.3 (exon 1)ABHD11, CLDN3, CLDN4, WBSCR27, WBSCR28
Genotyping

Allele discrimination was carried out using TaqMan SNP genotyping assays (Table 2) and TaqMan Genotyping Master Mix or TaqMan Fast Universal polymerase chain reaction (PCR) Master Mix without AmpErase UNG (Applied Biosystems), using either a 7300 Real-Time PCR System or a 7500 Fast Real-Time PCR System (Applied Biosystems). All genotype data were analyzed using the 7500 Fast System SDS Software version 1.3.1.21 (Applied Biosystems).

In addition, a nonsynonymous coding SNP in MORC4 (rs6622126; Applied Biosystems assay ID C_22273025_10) and two novel CLDN2 SNP markers (this study; rs62605981 and rs72466477) were genotyped. The two novel CLDN2 sequence variants were ordered as custom assays from Applied Biosystems. Primer and probe sequences are available from the authors upon request.

Resequencing of CLDN2

The promoter region, exon-intron boundaries and exons harbouring the 5’ untranslated region and protein coding region of CLDN2 were amplified by PCR and resequenced (Table 3). PCR amplifications were in accordance with the manufacturer’s recommendations, using HotStarTaq DNA polymerase (Qiagen, Hilden, Germany), 2.0 mmol/L MgCl2, and 0.2 μmol/L per PCR primer (Operon Biotechnologies GmbH, Cologne, Germany, and Scandinavian Gene Synthesis AB, Köping, Sweden). The following PCR cycle was repeated 45 times: 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 60 s. A total of 93 individuals (21 CD, 21 UC, 5 IBD-U, and 46 healthy; 60 females) were resequenced.

Table 3 Primers for polymerase chain reaction amplification and sequencing of Claudin-2.
Candidate geneExonForward primer1Reverse primer2Size of PCR-product
CLDN21GTAGGACCTGCTCTTTGAACTC23TGAATTTAAAAGGCAGCAACTA23708 bp
1TCAATCTTTCCCAGCCTCCA3TTTCTGTCAAAAACTCCACTCC3
2TTGTAGAGAATGGGGAGGTGTGC23TCAATTGCAGACTGAGGCCAAA2599 bp
2TGCAGACTGAGGCCAAACTG3
2CTAGGCCCCTGGAGATTCAAGA23TGTGCCCAAAAGCCCCAGAA23682 bp
2TTCCTTTCTCATGTGTTATTTCTAA3GAGAAAGGAAAAAAAAAACAAC3
2TGAGGGATTAGAGGTGTTCAA23GCAGCACCTTCTGACACGA23892 bp
2ATCCTACGGGACTTCTACTCA3ACTCCACCTGCTACCGCCACT3

All PCR products were purified in accordance with the QIAquick PCR purification kit protocol (Qiagen), and analyzed using the DNA 1000 assay on the Agilent 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA, United States). Cycle sequencing was carried out using the CEQ8800 system and accompanying sequencing reagents from Beckman Coulter (Fullerton, CA, United States) and conducted using half concentrated CEQ DTCS quick start kit, purification with an ethanol-precipitation protocol. Sequence data were analyzed with the heterozygote detection option activated in the software (version 8.0.52) and relative a reference sequence. New sequence variants were deposited in the NCBI SNP database (http://www.ncbi.nlm.nih.gov/projects/SNP/) and provided with rs-numbers.

Prediction of transcription factor binding sites

Transcription factor binding sites were predicted using the Alibaba 2.1 software[31] available through Biobase (http://www.gene-regulation.com), in conjunction with the Transfac database public release version 7.0[32] at Biobase.

Statistical analysis

Allelic OR with accompanying 95%CI, and P values based on χ2 statistics were calculated using a likelihood-based analysis for genetic association with the Unphased software version 3.0.13[33], both in the case-control approach and in the family-based study. In order to avoid bias due to genetic relatedness in the case-control study, one case per family was randomly selected from 191 Swedish IBD families. These random samplings of cases were repeated 15 times and the median OR was used as a representative measure of association. The case-control studies with respect to IBD, CD and UC were based on 191, 103 and 102 cases of IBD, CD, and UC, respectively, and 333 controls. No deviations from Hardy-Weinberg equilibrium were observed.

Since CLDN2-MORC4 are located in a non-pseudoautosomal region of the X-chromosome, males contribute one allele and females two alleles. Because the analysis did not identify sex as a confounder, males and females were analyzed jointly. Association to clinical features was tested for using a chi-square test for qualitative variables and one way ANOVA for quantitative variables, and carried out using the GraphPad Prism 4 software (GraphPad Software, La Jolla, CA, United States). For all statistical tests, two-sided P values < 0.05 were considered significant. Correction for multiple testing was not performed.

RESULTS
Genetic association - case-control approach

Based on a subset of Swedish IBD patients (73, 39 and 42 individuals with IBD, CD or UC, respectively) one marker per gene was selected for analysis in the full study material (Table 2). Allelic association between any of the three markers for the genetic regions of CLDN1, CLDN2 or CLDN4 and patients with IBD, CD or UC were investigated using a case-control study approach (Table 4). Significant associations were observed between the CLDN2 marker (rs12014762; associated C allele frequency of 0.776 among controls) and CD (P = 0.007), and the CLDN1 marker (rs7620166; associated T allele frequency of 0.470 among controls) and IBD (P = 0.025). No associations were observed for the CLDN4 marker (rs8629; C allele frequency of 0.772 among controls), neither to IBD, CD nor UC.

Table 4 Inflammatory bowel disease-phenotypes were investigated by performing family-based and case-control approach in genetic association studies.
rs7620166 (CLDN1)
rs12014762 (CLDN2)
rs8629 (CLDN4)
allelic OR (95%CI)P valueallelic OR (95%CI)P valueallelic OR (95%CI)P value
IBDSwedish case-control1.33 (1.04-1.72)0.0251.39 (0.95-2.01)0.0831.21 (0.89-1.65)0.225
Non-Swedish families0.87 (0.72-1.06)0.1771.25 (0.89-1.77)0.1951.09 (0.88-1.33)0.432
CDSwedish case-control1.17 (0.86-1.60)0.3191.98 (1.17-3.35)0.0071.25 (0.84-1.85)0.258
Non-Swedish families0.80 (0.64-1.00)0.0521.37 (0.91-2.07)0.1261.14 (0.89-1.46)0.287
UCSwedish case-control1.35 (0.98-1.84)0.0641.27 (0.80-2.02)0.3041.18 (0.80-1.73)0.409
Non-Swedish families1.19 (0.77-1.84)0.4360.91 (0.39-2.14)0.8271.15 (0.75-1.77)0.512
Genetic association - family-based approach

The same three SNP markers were further investigated using a family-based approach in non-Swedish families (Table 4). The significant associations identified in the case-control study were not confirmed (P = 0.126 and P = 0.177 for the CLDN2 and CLDN1 marker, respectively). The CLDN2 marker rs12014762 was not related to any demographic or disease characteristics in CD-patients (Table 5).

Table 5 Genotype-phenotype correlation between Claudin-2 marker (rs12014762) polymorphism and clinical characteristics of 677 patients with Crohn’s disease (all families).
rs12014762 Crohn’s diseaseAt least one CTP value
Sex
Male26547
Female35411
Age at diagnosis (yr)
Mean (SD)24.48 (12.11)24.36 (11.46)0.90
Median (range)22 (3-70)22 (8-63)
Location at onset:n = 583n = 54
Pure colonic disease7860.64
Pure ileal disease117140.31
Ileocolonic disease2743090.87
Any colonic disease414370.70
Any ileal disease424420.42
Upper digestive tract118120.73
Perineal disease147110.53
Granuloma237/47826/430.12
Penetrating disease218/47822/430.48
Strictures221/47815/430.15
Extra-digestive symptoms190/61915/580.44
Smoking habitsn = 505n = 51
Non-smoker272210.08
Smoker157210.14
Ex-smoker7690.62
Resequencing of CLDN2

Based on the most significant association (CD and the CLDN2 marker), CLDN2 was chosen for resequencing in an approach to identify novel sequence variants of putative importance for the risk of developing CD. Two novel non-coding sequence variants were identified for CLDN2 (Table 6).

Table 6 Sequence variants identified by resequencing of selected gene regions.
Gene1Position of SNPrs-numberPart of gene/predicted consequenceVAF/control2VAF/patients2
CLDN2c.-178-678C>G (g.29466911)rs62605981Intron/5’ gene flanking region30.1750.139
c.-178-104_-103delAT (g.29467485_29467486delAT)rs72466477Intron/5’ gene flanking region30.1750.083
Prediction of transcription factor binding sites in the CLDN2 promoter and analysis of genetic association to the newly identified sequence variants

The two novel CLDN2 polymorphisms were located in a region corresponding to the CLDN2 promoter, as described by Sakaguchi et al[34] Analyzing the promoter region of CLDN2 for the presence of possible transcription factor binding sites, revealed that these new variants were located in a putative specificity protein 1 (Sp1) binding site/GC-box (rs62605981) and a putative upstream stimulatory factor (USF) binding site/E-box (rs72466477). The genotyping results of these two novel SNPs were based on 166, 89 and 89 cases of IBD, CD and UC, respectively, from the Swedish families and their 333 non-related controls (Table 1). Neither rs62605981 (C allele frequency of 0.860 among controls) nor rs72466477 (AT allele frequency of 0.842 among controls) showed any significant associations to IBD overall or to any sub-entities (Table 7).

Table 7 Genetic association between inflammatory bowel disease-phenotype and either newly discovered Claudin-2 promoter polymorphisms or a nonsynonymous coding polymorphisms in MORC4 was analyzed by performing case-control studies.
rs62605981 (CLDN2)
rs72466477 (CLDN2)
rs6622126 (MORC4)
allelic OR (95%CI)P valueallelic OR (95%CI)P valueallelic OR(95%CI)P value
IBD1.11 (0.71-1.73)0.6591.23 (0.79-1.91)0.3501.24 (0.91-1.70)0.179
CD0.83 (0.49-1.41)0.5011.16 (0.68-2.00)0.5841.61 (1.08-2.41)0.018
UC1.24 (0.69-2.26)0.4631.19 (0.68-2.06)0.5430.903 (0.61-1.33)0.606
MORC4 and genetic association

In addition to CLDN2, MORC4 is located on the same linkage block as the CD associated marker (rs12014762). A nonsynonymous coding SNP (rs6622126) was identified in the MORC4 gene using the NCBI SNP database, for which a high minor allele frequency (A allele = 0.440) was present in the non-related Swedish control samples. This SNP was investigated for genetic association to IBD overall and to sub-entities, using the same individuals as used for the two novel CLDN2 variants. A significant association was observed between the G allele (frequency of 0.560 among controls) and CD (P = 0.018), but not to UC or IBD (Table 7).

DISCUSSION

TJ proteins are considered key components in the regulation of paracellular permeability of both epithelial and endothelial cell linings[20,21], and due to their barrier-forming properties we considered claudin genes as candidate genes affecting a leaky gut phenotype of IBD.

Using the case-control approach, an association was identified between the CLDN2-MORC4 region (rs12014762) and the occurrence of CD. This SNP marker was associated with an overall increased risk of having CD, but not to any distinctive phenotypic pattern. This association was not confirmed in the family-based approach, where non-Swedish families were included. Such a regional heterogeneity may in part be explained by different genetic backgrounds. Substantial genetic heterogeneity due to geographic stratification has been demonstrated in genome-wide association studies[6]. A geographically homogenous population (this study) should be advantageous for unveiling regionally restricted genetic risk factors. The case of underrepresented NOD2 mutations in CD patients from the Nordic countries[35-37] together with our data on the presence of CLDN2 variants in Swedish patients add support for such an assumption taking into account that IBD, and especially CD, are polygenic disorders[2,3]. When we investigated a possible interaction between NOD2 and the CLDN2-MORC4 region (rs12014762) with individuals stratified on the basis of carrying none or at least one NOD2 mutant allele, no significant association was identified between these two genetic regions (data not shown).

Both CD and UC have been associated with an increase in intestinal permeability[9-11]. Experimental data reveal an altered expression of claudin-2, and other claudin proteins, in the intestinal epithelium of IBD patients, and such alterations affect the permeability characteristics[38]. Claudin-2 expression was increased in a cell culture of human colonic epithelial cells (HT-29/B6) in response to tumor necrosis factor-α (TNF-α)[38], a finding consistent with an increased expression of claudin-2 in the inflamed epithelium of CD patients[38,39]. Using another human colonic epithelial cell line (T84), Prasad et al[39] demonstrated an increase both in paracellular permeability and claudin-2 expression in response to interleukin-13, but not in response to interferon-γ/TNF-α treatment.

Within the resequenced parts of CLDN2 we identified two novel polymorphisms in the promoter region. These two sequence variants were located in different putative transcription factor binding sites, a Sp1 binding site/GC-box (rs62605981) and an USF binding site/E-box (rs72466477). It has been shown that the CLDN2 transcription is affected by several transcription factors[34], and both E-box binding[40-42] and Sp1 binding site[43,44] transcription factors have been identified as important determinants of claudin gene expression. However, neither of the two novel promoter variants were associated to CD.

MORC4 is present on the same linkage block as CLDN2 and the CD associated marker (rs12014762). It is therefore possible that the C allele of rs12014762 is a marker for a functional variant of MORC4 that results in an increased overall risk of developing CD. A significant association was observed between CD and the G allele of the nonsynonymous coding SNP in the MORC4 gene (rs6622126), resulting in a substitution of the more hydrophobic amino acid isoleucine at position 473, located immediately outside the region predicted to be a zinc finger (420-472), with threonine.

MORC4 encodes a member of the MORC family of CW-type zinc finger proteins, which contain a number of predicted domains and motifs suggestive of being transcription factors[45]. MORC4 exhibits a low-level mRNA expression in a variety of normal tissues, including the intestine. Using the SKI-like protein as bait in a two-hybrid screen, MORC4 has been identified as a putative interacting protein, linking MORC4 to the transforming growth factor-β (TGF-β) signaling pathway and the SMAD family of signal transduction proteins[46]. Increased intestinal expression of TGF-β has been observed in patients with CD[47] and, in monolayers of intestinal epithelial cells, TGF-β has been shown to preserve or enhance the paracellular barrier[48,49]. These two findings seem to contradict the increased intestinal permeability that has been associated to both CD and UC[9-11]. Possibly a genetic variant in the CLDN2-MORC4 region could disturb a TGF-β mediated signal that preserves or enhances the paracellular barrier, or exert an effect on CLDN2 expression that dominates a TGF-β mediated effect on paracellular permeability. In addition, a SMAD4-dependent, but TGF-β-independent, repression of CLDN1 transcription[50] and a ZEB2-mediated repression of CLDN4[42] support a role for the SMAD signal transduction pathway in the regulation of claudin genes.

An increased intestinal permeability has been associated with the CD susceptibility allele CARD15 3020insC[18], and TJ associated genes have been suggested as susceptibility genes for UC (e.g., GNA12[2]) and for both UC and CD (MAGI2[51]).

In conclusion, our findings add further support for a genetically impaired intestinal epithelial barrier as one predisposing factor in the etiology of CD, either directly through CLDN2 or indirect via a tentative link between MORC4, TGF-β/SMAD signalling and an effect on paracellular permeability. This putative genetic link between the CLDN2-MORC4 region, intestinal epithelial integrity and the risk of developing CD needs to be further explored.

ACKNOWLEDGMENTS

Laboratory technician Lena Svensson is gratefully acknowledged for excellent technical assistance with genotyping.

COMMENTS
Background

For chronic inflammatory bowel disease (IBD) - Crohn’s disease (CD), ulcerative colitis - a number of studies have demonstrated a substantial genetic predisposition. These inflammatory conditions have been associated with an increased intestinal permeability. Consistent with the phenotype of these diseases, several genetic association studies have implicated mainly components of the immune response, but also factors implicated in intestinal permeability. In order to further investigate intestinal permeability as a predisposing genetic risk factor for IBD, the authors have conducted genetic association studies on claudin genes (CLDN1, CLDN2 and CLDN4), key components in the regulation of permeability.

Research frontiers

Although large-scale genome-wide association studies have uncovered a large number of genetic susceptibility loci in relation to IBD these factors still explain only a minority of the total genetic risk for IBD. The genetic background regulating intestinal barrier functions largely remains unknown.

Innovations and breakthroughs

The barrier of epithelial cells is critical for the permeability properties of the intestine. The tight junction structure is a multicomponent protein complex that serves to seal and regulate permeability across the space between adjacent epithelial cells, with significant contribution from members of the claudin family. This is the first study to report genetic link between claudin gene (CLDN2) and the risk of developing CD.

Applications

In this study the authors have identified a genetic link between the CLDN2-MORC4 region and the risk of developing CD, and thereby highlighted claudins as therapeutic targets.

Terminology

The tight junction structure is critical for the permeability properties of the intestine. The structure is a multicomponent protein complex that serves to seal and regulate permeability across the paracellular space between adjacent epithelial cells.

Peer review

This is a small study on the importance of claudins (CLDN1, CLDN2 and CLDN4) in Swedish and non-Swedish case-control and family-based approach. A weak suggestive association was reported in the case-control setting, while this was not replicated in the non-Swedish sample. The paper is interesting and well written: its main limitation lies in the study design, comparing Swedish and non-Swedish individuals using two different approaches.

References
1.  Yang H, Taylor K D. Rotter J I. Inflammatory bowel disease. The genetic basis of common diseases, 2nd ed. New York: Oxford UP 2002; 266-297.  [PubMed]  [DOI]
2.  Anderson CA, Boucher G, Lees CW, Franke A, D’Amato M, Taylor KD, Lee JC, Goyette P, Imielinski M, Latiano A. Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nat Genet. 2011;43:246-252.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1132]  [Cited by in RCA: 1058]  [Article Influence: 70.5]  [Reference Citation Analysis (7)]
3.  Franke A, McGovern DP, Barrett JC, Wang K, Radford-Smith GL, Ahmad T, Lees CW, Balschun T, Lee J, Roberts R. Genome-wide meta-analysis increases to 71 the number of confirmed Crohn’s disease susceptibility loci. Nat Genet. 2010;42:1118-1125.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2176]  [Cited by in RCA: 2024]  [Article Influence: 126.5]  [Reference Citation Analysis (7)]
4.  Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, Albrecht M, Mayr G, De La Vega FM, Briggs J. A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. Nat Genet. 2007;39:207-211.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1575]  [Cited by in RCA: 1467]  [Article Influence: 77.2]  [Reference Citation Analysis (16)]
5.  Hugot JP, Chamaillard M, Zouali H, Lesage S, Cézard JP, Belaiche J, Almer S, Tysk C, O’Morain CA, Gassull M. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn’s disease. Nature. 2001;411:599-603.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4378]  [Cited by in RCA: 3928]  [Article Influence: 157.1]  [Reference Citation Analysis (3)]
6.  Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, Lee JC, Schumm LP, Sharma Y, Anderson CA. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature. 2012;491:119-124.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4202]  [Cited by in RCA: 3777]  [Article Influence: 269.8]  [Reference Citation Analysis (4)]
7.  Momozawa Y, Mni M, Nakamura K, Coppieters W, Almer S, Amininejad L, Cleynen I, Colombel JF, de Rijk P, Dewit O. Resequencing of positional candidates identifies low frequency IL23R coding variants protecting against inflammatory bowel disease. Nat Genet. 2011;43:43-47.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 151]  [Cited by in RCA: 158]  [Article Influence: 10.5]  [Reference Citation Analysis (0)]
8.  Rioux JD, Xavier RJ, Taylor KD, Silverberg MS, Goyette P, Huett A, Green T, Kuballa P, Barmada MM, Datta LW. Genome-wide association study identifies new susceptibility loci for Crohn disease and implicates autophagy in disease pathogenesis. Nat Genet. 2007;39:596-604.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1473]  [Cited by in RCA: 1383]  [Article Influence: 72.8]  [Reference Citation Analysis (4)]
9.  Almer S, Franzén L, Olaison G, Smedh K, Ström M. Increased absorption of polyethylene glycol 600 deposited in the colon in active ulcerative colitis. Gut. 1993;34:509-513.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 32]  [Cited by in RCA: 31]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
10.  Bjarnason I. Intestinal permeability. Gut. 1994;35:S18-S22.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 64]  [Article Influence: 2.0]  [Reference Citation Analysis (1)]
11.  Clayburgh DR, Shen L, Turner JR. A porous defense: the leaky epithelial barrier in intestinal disease. Lab Invest. 2004;84:282-291.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 382]  [Cited by in RCA: 358]  [Article Influence: 16.3]  [Reference Citation Analysis (8)]
12.  Hollander D. Permeability in Crohn’s disease: altered barrier functions in healthy relatives. Gastroenterology. 1993;104:1848-1851.  [PubMed]  [DOI]
13.  Munkholm P, Langholz E, Hollander D, Thornberg K, Orholm M, Katz KD, Binder V. Intestinal permeability in patients with Crohn’s disease and ulcerative colitis and their first degree relatives. Gut. 1994;35:68-72.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 151]  [Cited by in RCA: 134]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
14.  Söderholm JD, Olaison G, Lindberg E, Hannestad U, Vindels A, Tysk C, Järnerot G, Sjödahl R. Different intestinal permeability patterns in relatives and spouses of patients with Crohn’s disease: an inherited defect in mucosal defence. Gut. 1999;44:96-100.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 149]  [Cited by in RCA: 138]  [Article Influence: 5.1]  [Reference Citation Analysis (1)]
15.  Teahon K, Smethurst P, Levi AJ, Menzies IS, Bjarnason I. Intestinal permeability in patients with Crohn’s disease and their first degree relatives. Gut. 1992;33:320-323.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 120]  [Cited by in RCA: 124]  [Article Influence: 3.6]  [Reference Citation Analysis (1)]
16.  May GR, Sutherland LR, Meddings JB. Is small intestinal permeability really increased in relatives of patients with Crohn’s disease. Gastroenterology. 1993;104:1627-1632.  [PubMed]  [DOI]
17.  Thjodleifsson B, Sigthorsson G, Cariglia N, Reynisdottir I, Gudbjartsson DF, Kristjansson K, Meddings JB, Gudnason V, Wandall JH, Andersen LP. Subclinical intestinal inflammation: an inherited abnormality in Crohn’s disease relatives. Gastroenterology. 2003;124:1728-1737.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 117]  [Cited by in RCA: 113]  [Article Influence: 4.9]  [Reference Citation Analysis (0)]
18.  Buhner S, Buning C, Genschel J, Kling K, Herrmann D, Dignass A, Kuechler I, Krueger S, Schmidt HH, Lochs H. Genetic basis for increased intestinal permeability in families with Crohn’s disease: role of CARD15 3020insC mutation. Gut. 2006;55:342-347.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 285]  [Cited by in RCA: 262]  [Article Influence: 13.1]  [Reference Citation Analysis (6)]
19.  Büning C, Geissler N, Prager M, Sturm A, Baumgart DC, Büttner J, Bühner S, Haas V, Lochs H. Increased small intestinal permeability in ulcerative colitis: rather genetic than environmental and a risk factor for extensive disease. Inflamm Bowel Dis. 2012;18:1932-1939.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 75]  [Cited by in RCA: 71]  [Article Influence: 5.1]  [Reference Citation Analysis (4)]
20.  Förster C. Tight junctions and the modulation of barrier function in disease. Histochem Cell Biol. 2008;130:55-70.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 490]  [Cited by in RCA: 463]  [Article Influence: 25.7]  [Reference Citation Analysis (4)]
21.  Furuse M. Molecular basis of the core structure of tight junctions. Cold Spring Harb Perspect Biol. 2010;2:a002907.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 336]  [Cited by in RCA: 315]  [Article Influence: 19.7]  [Reference Citation Analysis (0)]
22.  Furuse M, Furuse K, Sasaki H, Tsukita S. Conversion of zonulae occludentes from tight to leaky strand type by introducing claudin-2 into Madin-Darby canine kidney I cells. J Cell Biol. 2001;153:263-272.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 633]  [Cited by in RCA: 585]  [Article Influence: 23.4]  [Reference Citation Analysis (5)]
23.  Inai T, Kobayashi J, Shibata Y. Claudin-1 contributes to the epithelial barrier function in MDCK cells. Eur J Cell Biol. 1999;78:849-855.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 236]  [Cited by in RCA: 205]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
24.  Van Itallie CM, Fanning AS, Anderson JM. Reversal of charge selectivity in cation or anion-selective epithelial lines by expression of different claudins. Am J Physiol Renal Physiol. 2003;285:F1078-F1084.  [PubMed]  [DOI]
25.  Lo D, Tynan W, Dickerson J, Scharf M, Cooper J, Byrne D, Brayden D, Higgins L, Evans C, O’Mahony DJ. Cell culture modeling of specialized tissue: identification of genes expressed specifically by follicle-associated epithelium of Peyer’s patch by expression profiling of Caco-2/Raji co-cultures. Int Immunol. 2004;16:91-99.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 60]  [Cited by in RCA: 57]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
26.  Tamagawa H, Takahashi I, Furuse M, Yoshitake-Kitano Y, Tsukita S, Ito T, Matsuda H, Kiyono H. Characteristics of claudin expression in follicle-associated epithelium of Peyer’s patches: preferential localization of claudin-4 at the apex of the dome region. Lab Invest. 2003;83:1045-1053.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 54]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
27.  Gullberg E, Söderholm JD. Peyer’s patches and M cells as potential sites of the inflammatory onset in Crohn’s disease. Ann N Y Acad Sci. 2006;1072:218-232.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 65]  [Cited by in RCA: 65]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
28.  Lesage S, Zouali H, Cézard JP, Colombel JF, Belaiche J, Almer S, Tysk C, O’Morain C, Gassull M, Binder V. CARD15/NOD2 mutational analysis and genotype-phenotype correlation in 612 patients with inflammatory bowel disease. Am J Hum Genet. 2002;70:845-857.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 775]  [Cited by in RCA: 724]  [Article Influence: 30.2]  [Reference Citation Analysis (0)]
29.  De La Vega FM, Isaac HI, Scafe CR. A tool for selecting SNPs for association studies based on observed linkage disequilibrium patterns. Pac Symp Biocomput. 2006;487-498.  [PubMed]  [DOI]
30.  Maniatis N, Collins A, Xu CF, McCarthy LC, Hewett DR, Tapper W, Ennis S, Ke X, Morton NE. The first linkage disequilibrium (LD) maps: delineation of hot and cold blocks by diplotype analysis. Proc Natl Acad Sci U S A. 2002;99:2228-2233.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 130]  [Cited by in RCA: 130]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
31.  Grabe N. AliBaba2: context specific identification of transcription factor binding sites. In Silico Biol. 2002;2:S1-15.  [PubMed]  [DOI]
32.  Matys V, Kel-Margoulis OV, Fricke E, Liebich I, Land S, Barre-Dirrie A, Reuter I, Chekmenev D, Krull M, Hornischer K. TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes. Nucleic Acids Res. 2006;34:D108-D110.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1769]  [Cited by in RCA: 1726]  [Article Influence: 86.3]  [Reference Citation Analysis (0)]
33.  Dudbridge F. Likelihood-based association analysis for nuclear families and unrelated subjects with missing genotype data. Hum Hered. 2008;66:87-98.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 514]  [Cited by in RCA: 515]  [Article Influence: 28.6]  [Reference Citation Analysis (0)]
34.  Sakaguchi T, Gu X, Golden HM, Suh E, Rhoads DB, Reinecker HC. Cloning of the human claudin-2 5’-flanking region revealed a TATA-less promoter with conserved binding sites in mouse and human for caudal-related homeodomain proteins and hepatocyte nuclear factor-1alpha. J Biol Chem. 2002;277:21361-21370.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 138]  [Cited by in RCA: 142]  [Article Influence: 5.9]  [Reference Citation Analysis (0)]
35.  Vind I, Vieira A, Hougs L, Tavares L, Riis L, Andersen PS, Locht H, Freitas J, Monteiro E, Christensen IJ. NOD2/CARD15 gene polymorphisms in Crohn’s disease: a genotype-phenotype analysis in Danish and Portuguese patients and controls. Digestion. 2005;72:156-163.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 25]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
36.  Törkvist L, Noble CL, Lördal M, Sjöqvist U, Lindforss U, Nimmo ER, Russell RK, Löfberg R, Satsangi J. Contribution of CARD15 variants in determining susceptibility to Crohn’s disease in Sweden. Scand J Gastroenterol. 2006;41:700-705.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 22]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
37.  Törkvist L, Halfvarson J, Ong RT, Lördal M, Sjöqvist U, Bresso F, Björk J, Befrits R, Löfberg R, Blom J. Analysis of 39 Crohn’s disease risk loci in Swedish inflammatory bowel disease patients. Inflamm Bowel Dis. 2010;16:907-909.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 16]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
38.  Zeissig S, Bürgel N, Günzel D, Richter J, Mankertz J, Wahnschaffe U, Kroesen AJ, Zeitz M, Fromm M, Schulzke JD. Changes in expression and distribution of claudin 2, 5 and 8 lead to discontinuous tight junctions and barrier dysfunction in active Crohn’s disease. Gut. 2007;56:61-72.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1048]  [Cited by in RCA: 981]  [Article Influence: 51.6]  [Reference Citation Analysis (4)]
39.  Prasad S, Mingrino R, Kaukinen K, Hayes KL, Powell RM, MacDonald TT, Collins JE. Inflammatory processes have differential effects on claudins 2, 3 and 4 in colonic epithelial cells. Lab Invest. 2005;85:1139-1162.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 412]  [Cited by in RCA: 390]  [Article Influence: 18.6]  [Reference Citation Analysis (0)]
40.  Ikenouchi J, Matsuda M, Furuse M, Tsukita S. Regulation of tight junctions during the epithelium-mesenchyme transition: direct repression of the gene expression of claudins/occludin by Snail. J Cell Sci. 2003;116:1959-1967.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 481]  [Cited by in RCA: 515]  [Article Influence: 22.4]  [Reference Citation Analysis (5)]
41.  Martínez-Estrada OM, Cullerés A, Soriano FX, Peinado H, Bolós V, Martínez FO, Reina M, Cano A, Fabre M, Vilaró S. The transcription factors Slug and Snail act as repressors of Claudin-1 expression in epithelial cells. Biochem J. 2006;394:449-457.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 234]  [Cited by in RCA: 239]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
42.  Vandewalle C, Comijn J, De Craene B, Vermassen P, Bruyneel E, Andersen H, Tulchinsky E, Van Roy F, Berx G. SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell-cell junctions. Nucleic Acids Res. 2005;33:6566-6578.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 387]  [Cited by in RCA: 430]  [Article Influence: 20.5]  [Reference Citation Analysis (4)]
43.  Dufresne J, Cyr DG. Activation of an SP binding site is crucial for the expression of claudin 1 in rat epididymal principal cells. Biol Reprod. 2007;76:825-832.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 26]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
44.  Honda H, Pazin MJ, Ji H, Wernyj RP, Morin PJ. Crucial roles of Sp1 and epigenetic modifications in the regulation of the CLDN4 promoter in ovarian cancer cells. J Biol Chem. 2006;281:21433-21444.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 113]  [Cited by in RCA: 118]  [Article Influence: 5.9]  [Reference Citation Analysis (1)]
45.  Liggins AP, Cooper CD, Lawrie CH, Brown PJ, Collins GP, Hatton CS, Pulford K, Banham AH. MORC4, a novel member of the MORC family, is highly expressed in a subset of diffuse large B-cell lymphomas. Br J Haematol. 2007;138:479-486.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 30]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
46.  Colland F, Jacq X, Trouplin V, Mougin C, Groizeleau C, Hamburger A, Meil A, Wojcik J, Legrain P, Gauthier JM. Functional proteomics mapping of a human signaling pathway. Genome Res. 2004;14:1324-1332.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 229]  [Cited by in RCA: 237]  [Article Influence: 10.8]  [Reference Citation Analysis (0)]
47.  Burke JP, Mulsow JJ, O’Keane C, Docherty NG, Watson RW, O’Connell PR. Fibrogenesis in Crohn’s disease. Am J Gastroenterol. 2007;102:439-448.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 200]  [Cited by in RCA: 224]  [Article Influence: 11.8]  [Reference Citation Analysis (4)]
48.  Howe KL, Reardon C, Wang A, Nazli A, McKay DM. Transforming growth factor-beta regulation of epithelial tight junction proteins enhances barrier function and blocks enterohemorrhagic Escherichia coli O157: H7-induced increased permeability. Am J Pathol. 2005;167:1587-1597.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 192]  [Cited by in RCA: 185]  [Article Influence: 8.8]  [Reference Citation Analysis (4)]
49.  Planchon S, Fiocchi C, Takafuji V, Roche JK. Transforming growth factor-beta1 preserves epithelial barrier function: identification of receptors, biochemical intermediates, and cytokine antagonists. J Cell Physiol. 1999;181:55-66.  [PubMed]  [DOI]  [Full Text]
50.  Shiou SR, Singh AB, Moorthy K, Datta PK, Washington MK, Beauchamp RD, Dhawan P. Smad4 regulates claudin-1 expression in a transforming growth factor-beta-independent manner in colon cancer cells. Cancer Res. 2007;67:1571-1579.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 58]  [Cited by in RCA: 65]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
51.  McGovern DP, Taylor KD, Landers C, Derkowski C, Dutridge D, Dubinsky M, Ippoliti A, Vasiliauskas E, Mei L, Mengesha E. MAGI2 genetic variation and inflammatory bowel disease. Inflamm Bowel Dis. 2009;15:75-83.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 39]  [Cited by in RCA: 38]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
52.  Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21:263-265.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12288]  [Cited by in RCA: 11835]  [Article Influence: 563.6]  [Reference Citation Analysis (4)]
Footnotes

P- Reviewers Deaglio S, Lakatos PL, TanakaT S- Editor Zhai HH L- Editor A E- Editor Ma S

Write to the Help Desk