BPG is committed to discovery and dissemination of knowledge
Brief Article Open Access
©2012 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Gastroenterol. Aug 28, 2012; 18(32): 4323-4334
Published online Aug 28, 2012. doi: 10.3748/wjg.v18.i32.4323
Screening Helicobacter pylori genes induced during infection of mouse stomachs
Aparna Singh, Nathaniel Hodgson, Ming Yan, Jungsoo Joo, Lei Gu, Hong Sang, Emmalena Gregory-Bryson, Yisheng Ni, Kimberly Smith, William G Coleman, Laboratory of Biochemistry and Genetics, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892, United States
William G Wood, Sharon H Jackson, Laboratory of Host Defenses, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, United States
Author contributions: Singh A, Hodgson N, Gu L, Sang H, Ni Y, Jackson SH and Coleman WG designed research; Singh A, Hodgson N, Yan M, Joo J, Gu L, Sang H, Gregory-Bryson E, Wood WG, Ni Y and Smith K performed research; Singh A, Hodgson N, Yan M and Coleman WG analyzed data; Singh A, Jackson SH and Coleman WG wrote the paper.
Supported by Intramural Research Program of the National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Disease; The Division of Intramural Research of the National Institute of Allergy and Infectious Diseases; An Inter-Agency Agreement (Y3-DK-3521-07) with the National Institute on Minority Health and Health Disparities
Correspondence to: Dr. William G Coleman, Senior Investigator, Laboratory of Biochemistry and Genetics, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bldg. 8, Room 2A02, 9000 Rockville Pike, Bethesda, MD 20892, United States. wc3z@nih.gov
Telephone: +1-301-4969108 Fax: +1-301-4020240
Received: June 9, 2012
Revised: July 30, 2012
Accepted: August 3, 2012
Published online: August 28, 2012

Abstract

AIM: To investigate the effect of in vivo environment on gene expression in Helicobacter pylori (H. pylori) as it relates to its survival in the host.

METHODS: In vivo expression technology (IVET) systems are used to identify microbial virulence genes. We modified the IVET-transcriptional fusion vector, pIVET8, which uses antibiotic resistance as the basis for selection of candidate genes in host tissues to develop two unique IVET-promoter-screening vectors, pIVET11 and pIVET12. Our novel IVET systems were developed by the fusion of random Sau3A DNA fragments of H. pylori and a tandem-reporter system of chloramphenicol acetyltransferase and beta-galactosidase. Additionally, each vector contains a kanamycin resistance gene. We used a mouse macrophage cell line, RAW 264.7 and mice, as selective media to identify specific genes that H. pylori expresses in vivo. Gene expression studies were conducted by infecting RAW 264.7 cells with H. pylori. This was followed by real time polymerase chain reaction (PCR) analysis to determine the relative expression levels of in vivo induced genes.

RESULTS: In this study, we have identified 31 in vivo induced (ivi) genes in the initial screens. These 31 genes belong to several functional gene families, including several well-known virulence factors that are expressed by the bacterium in infected mouse stomachs. Virulence factors, vacA and cagA, were found in this screen and are known to play important roles in H. pylori infection, colonization and pathogenesis. Their detection validates the efficacy of these screening systems. Some of the identified ivi genes have already been implicated to play an important role in the pathogenesis of H. pylori and other bacterial pathogens such as Escherichia coli and Vibrio cholerae. Transcription profiles of all ivi genes were confirmed by real time PCR analysis of H. pylori RNA isolated from H. pylori infected RAW 264.7 macrophages. We compared the expression profile of H. pylori and RAW 264.7 coculture with that of H. pylori only. Some genes such as cagA, vacA, lpxC, murI, tlpC, trxB, sodB, tnpB, pgi, rbfA and infB showed a 2-20 fold upregulation. Statistically significant upregulation was obtained for all the above mentioned genes (P < 0.05). tlpC, cagA, vacA, sodB, rbfA, infB, tnpB, lpxC and murI were also significantly upregulated (P < 0.01). These data suggest a strong correlation between results obtained in vitro in the macrophage cell line and in the intact animal.

CONCLUSION: The positive identification of these genes demonstrates that our IVET systems are powerful tools for studying H. pylori gene expression in the host environment.

Key Words: Helicobacter pylori; In vivo expression technology; Virulence genes; Mice; Infection



INTRODUCTION

Helicobacter pylori (H. pylori) is a gram-negative bacterium that infects a large percentage (50% to 90%) of the world’s population and is a causative agent for gastritis, ulcer disease and some gastric cancers. To date, the mechanism of H. pylori pathogenesis is not completely understood. H. pylori can infect and survive in the stomachs of mice and macrophages. H. pylori infection can last for a life-time, suggesting that the microbes successfully evade the host immune response to infection. Although previously considered an extracellular organism, several recent in vitro studies suggest that H. pylori may be a facultative intracellular bacterium[1]. The intracellular habitation offers a plausible explanation for the evasion of host immune response and thus a life-long persistence in the host.

Characterization of microbial genes that are specifically induced during infection is critical to the understanding of the mechanism by which microbial pathogens cause disease. Many different techniques have been developed to study bacterial genes that are expressed during growth in specific niches[2-4]. A useful tool for identifying genes involved in virulence is in vivo expression technology (IVET)[5,6]. IVET was designed to identify genes of pathogens that are preferentially expressed during infection and has been used extensively[7,8]. It is a promoter trapping strategy used for identifying bacterial promoters that are upregulated in the host by using an auxotrophic mutant strain or with various reporter systems. This technique allows the identification of genes that may be expressed only under in vivo conditions. Such genes are difficult to identify during growth under laboratory conditions, but are likely to play an important role in survival inside the host. This technology has not been exhaustively utilized in H. pylori because of limitations imposed by the genetic intractability of this bacterium. Recently, recombination-based IVET has been utilized to identify H. pylori genes important for host colonization[9]. In this study, we developed an antibiotic-based IVET tool (a variant of IVET[10]) that is specific for screening H. pylori genes that are specifically expressed in vivo in mice and macrophage hosts.

MATERIALS AND METHODS
Bacterial strains and growth media

All bacterial strains used in this study are listed in Table 1. The H. pylori strains used in this study were: Sydney strain 1 (SS1)[11] and strain HP1061[12]. The strains were grown for 16 h to 18 h at 37°C in a microaerophilic atmosphere in bisulfiteless Brucella broth (BLBB)[13] containing 5% fetal bovine serum (Hyclone, Logan, UT). For BLBB solid medium, 1.7% agar was added. Unless stated otherwise, the antibiotics used in BLBB solid or liquid medium were: kanamycin (kan) 15 mg/L, Glaxo Selective Supplement A (GSSA) (5 mg/L of Amphotericin-B, 20 mg/L of Bacitracin, 1.07 mg/L of Nalidixic acid, 0.33 mg/L of Polymyxin-B, and 10 mg/L of Vancomycin)[14]. BLBB 5-Bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) plates were supplemented with X-gal at 40 mg/L. Escherichia coli (E. coli) strains, TAM1λ pir and DH5αλ pir were grown in L broth (LB) medium[15].

Table 1 Strains and plasmids used in this study.
Strains or phenotypeRelevant genotype or plasmidsSource or reference
Helicobacter pylori
SS1Lee et al[11]
HP1061Goodwin et al[12]
Escherichia coli
DH5αλpir+λpir, supE44, ΔlacU169(φ80lacZΔM15), hsdR17, recA1, endA1, gyrA96, thi-1, relA1Stanley Maloy, San Diego State University
TAM1 λpir+Λpir, mcrA, ∆(mrrhsdRMSmcrBC), φ80lacZΔM15, ∆lacX74, recA1, ara∆139(ara-leu)7697, galU, rpsL, endA1, nupGActive Motif, Inc., Carlsbad, CA 92008
Plasmids
pIVET8Slauch et al[52]
pIVET9This study
pIVET10
pIVET11
pIVET12
Animal housing and diet

Mice were maintained in a National Institutesof Health (NIH) animal facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International (Rockville, MD).

They were maintained in a specific-pathogen-free animal care holding room and were confirmed to be free of the following microorganisms: cilium-associated respiratory bacillus, ectromelia, mouse rotavirus, mouse encephalomyelitis virus, lymphocytic choriomeningitis virus, murine cytomegalovirus, mouse hepatitis virus, mouse adenovirus, minute virus of mice, Mycoplasma pulmonis, parvovirus, polyomavirus, pneumonia virus of mice, reovirus, and Sendai virus. Mice were housed in 7.5- by 11.5- by 5-in. sterilized ventilated Thoren cages (Thoren Caging System, Inc., Hazleton, PA) on Tek Fresh bedding (Harlan Teklad, Madison, WI). Cages were changed weekly. The animal holding room was maintained under environmental conditions of 20  °C, 40% to 70% relative humidity, 15 air changes/h and a 12-h/12-h light-dark cycle. Mice were fed an autoclaved pelleted rodent diet (rodent NIH-31 autoclavable NA; Zeigler Brothers, Inc., Gardners, PA) ad libitum and provided sterilized individual water bottles for an ad libitum water source. Upon arrival, the mice were acclimated for a minimum of 7 d prior to being used in the experiments. Mice were identified by numerical stainless steel rodent ear tags (National Band and Tag Co., Newport, KY). This study was reviewed and approved by the NIH Institutional Animal Care and Use Committee. All procedures and use of animals were in compliance with the Public Health Service Guide for the Care and Use of Laboratory Animals[16].

Isolation of DNA from bacterial strains

Plasmid DNA was isolated from E. coli using the QIAprep Miniprep or QIAfilter plasmid maxi kit (QIAgen, United States) in accordance with manufacturer’s recommended protocols. Genomic DNA was extracted from H. pylori strains, SS1 and 1061 using the Wizard Genomic DNA Purification Kit (Promega, United States) as described by the manufacturer.

Plasmid construction

Two novel H. pylori specific plasmids, pIVET11 and pIVET12 (Figure 1.) were constructed by modifying plasmid pIVET8[10]. pIVET8 is a suicide vector containing oriR6K origin that requires, in trans, a host-encoded Pi protein for replication[17-19]. It also contains an ampicillin resistance gene and a promoterless cat and lacZY gene fusion. The gene encoding kanamycin resistance was amplified by PCR from pCRII (Stratagene), with primers KanF and KanR (Table 2). The amplified fragment was cloned at the AatII site of pIVET9. A BglII restriction site in the kanamycin sequence was removed by Quick change site-directed mutagenesis kit (Stratagene). In so doing, we produced pIVET 10 which contained the unique BglII cloning site immediately upstream of promoterless cat and lacZY genes. We produced pIVET11 by removing the mob RP4 sequence which accounted for the conjugal transfer functions necessary for mobilization. Finally, pIVET12 plasmid was generated by the removal of ampicillin gene by Bsph1 restriction and the transfer of the kanamycin gene from the AatII site to a unique BamHI site in pIVET11. The kanamycin gene sequence, inserted at the AatII site in pIVET11, disrupts lacZ gene without affecting its activity. H. pylori is sensitive to ampicillin and therefore we could not use this antibiotic in our system.

Figure 1
Figure 1 Construction of Helicobacter pylori specific antibiotic-based in vivo expression technology plasmids, pIVET11 and pIVET12. These plasmids are derivatives of plasmid pIVET8[10]. A: AatII; B: BamHI; Bg: BglII; bla: β-lactamase; kan: Kanamycin gene; mob: Plasmid mobilization; trpA: Tryptophan synthase α-subunit.
Table 2 Primers used in this study.
GenesPrimer sequences 5’-3’
HP1CTGGAGAGACTAAGCCCTCC
HP2AAACATTACTGACGCTGATTG
Kan AatII FGATTTAGACGTCTCAGGGCGCAAGGGCT
Kan AatIIRTTCCTTTGACGTCTCAGAAGAACTCGTCAA
Kan BglII F (Mut)AGG GGA TCA AGG TCA GAT CAA GAG A
Kan BglII R (Mut)TCT CTT GAT CTG ACC TTG ATC CCC T
MCS BamHI F (Mut)GTC GAC CGA CCC CAA GCT TCT AGA GGT ACC G
MCS BamHI R (Mut)CGG TAC CTC TAG AAG CTT GGG GTC GGT CGA C
Kan BamHI F (pIVET12)GAT TTA GGA TCC TCA GGG CGC AAG GGC T
Kan BamHI R (pIVET12)TTC CTT TGG ATC CTC AGA AGA ACT CGT CAA
CATCAA CGG TGG TAT ATC CAG
MCATGCC ATT GGG ATA TAT CAA CGG TGG TAT ATC C
NMCATCTC CAT TTT AGC TTC CTT AGC TCC TGA AAA TCT CG
CagA FGATGGCGTGATGTTTGTTGATT
CagA RCGTAGCACCCACACCCTTATC
CysS FTGTTATTCCCCCACCATGAAA
CysS RGCAAGCTCCACGCCAAAG
Flhf FTGTTGCCCTGAAGATTTGAATTT
Flhf RTAGCGCGCGGCTAATTTAG
FliA FAAGCAACAACACCACCATCAAG
FliA RGCTGGGCAAGCGCTCTT
FliM FCGCCAGGTGATGCAAATTT
FliM RAGCGACGATTTGGACCACAT
FucT FTGAATGTGCATGATTTCAACAACT
FucT RGCTTTCCCATCAAGGGTGTTT
HsdM FCTGGGACATTCAAATCAATTATGG
HsdM RCGTCTTGCAAGCGTTTAAGATCT
InfB FGAGTCGCTCACACGGAAGCT
InfB RCAATGAAAGACACCCATTTGTCA
LpxC FCAAGCCCATCATTTTGTCTTTAGTAA
LpxC RCAAGTAATTCACTTCTTGCAAAAACC
MinC FTGCGCAAACACCAGCTTTT
MinC RATGGCGCTCATAAATCGTTGT
MurC FGGCTCATGGAAAGAGCAGTATCA
MurC RGCCCCAATAATCGCTCCAA
MurD FGCGGCACTAACGGGAAAA
MurD RCCCACTCACAGCCTTAAAATCTTC
MurI FAAAAGCGACGATTCAATCCAA
MurI RAAGTAGCTAAATGCGAAATGTTCAAA
Nth FTGAATTATTGGTGGCGACCAT
Nth RTTGGGCGTTATTTGATTCACTCT
Omp26 FCAAATCGGCACCGTTACCA
Omp26 RCATGAAATCCCGCTAGAAGCA
Pgi FAGCCCACCACAGGGTGTTT
Pgi RCTCCAATATTGCTTGGTGAAATCTT
PriA FGGAGGAGCGCTAGGCAAAT
PriA RAGTTCGCACCTTTCTTGCAATT
RbfA FGCGAGTTGAATTCTTTAAGCGTTAC
RbfA RGACCCTCAGCTTTTTTCAATTTAGA
RecG FGCGATCAACAAAACGCCATTA
RecG RGCACCCCACATCGCCTATAA
SodB FTGCTAAAGACAGCATGGGAGATT
SodB RTTCACATAAGTTTGATGGTGTTTCC
TlpC FTGGTTAGCGCGATTTATACGAA
TlpC RGGGTAGGCGATTTTTGAATCC
TnpB FTTGGTGTTTAGAATGCGGGTATAG
TnpB RTTTCCTACCCCAAAAAGACTTAACC
TrxB FCGCCATTGCTTTGTGCAA
TrxB RTGATGCGGCTGAATTCTTTTT
Type II R / M FTTCTATAACAGCACCGCTGACATT
Type II R / M RCGCGTATATTTGTTAGAAGTGATGAAA
VacA FGGGTTATGCCAGACAAATGATTG
VacA RTCTTATGCTCTAAACTGGCTATGTTGTT
VirB4 FGACCATAGCCCTTATTTGTTTAATTTTC
VirB4 RCTCCTATAATCATGGTATGTCCCACTAC
Ycf5 FAGCGCTATCAATGAAATGAGCAT
Ycf5 RCCACACCCCGCCTAAGAAA
HP0423 FTCGCTCCTTAAGGTTACACGATT
HP0423 RTCAAAGCCACCATCAATAACAAA
HP0424 FCGCTGTTTTTAGTTTTAGAGGCTTTC
HP0424 RGGCTAGGGAAGTGGCTCAAA
HP0426 FTGCGGTATAGGCTTTCATGAACT
HP0426 RAAGGTGTTCAAAGACAGCAAAAAA
HP0427 FTTGCGGTGTGGGTTAATGAA
HP0427 RGCAACGCTACCATACTTTTATCACTT
Construction of genomic library

H. pylori Sydney strain 1 (SS1) genomic DNA was isolated using the Wizard Genomic DNA purification kit (Promega, United States). The genomic DNA was partially digested with Sau3AI. After agarose gel electrophoresis, fragments of 1-3kb were purified using QIAquick Gel Extraction Kit (Qiagen, United States) and ligated into BglII digested and dephosphorylated pIVET11 or pIVET12 using the Rapid DNA Ligation kit (Roche, United States). Ligation samples were transformed into DH5αλ pir competent cells which provided the Pi protein, in trans, for plasmid replication. Transformants were replica plated in a 6 × 8 pattern on LB agar plates containing kanamycin. Forty eight colonies from the replica plates were pooled in TE buffer, pH 8.0 and plasmid DNA purification was carried out using the QIAprep Miniprep kit (QIAGEN, United States).

Preparation of electro-competent H. pylori

An overnight-grown 100 mL H. pylori culture was chilled for 10 min on ice. The cells were pelleted at 4360 ×g for 5 min. The centrifugations and all subsequent procedures were done at 4˚ C. The pellets were washed three times, twice with 40 mL ice cold water and finally with 40 mL ice cold water containing 5% glycerol. The washed pellets were placed on ice, covered with 2 mL ice cold 10% glycerol, incubated for 10 min and later resuspended in the same solution. 200 μL samples were placed in cold screw capped tubes and after quickly freezing on dry ice samples were stored at -80  °C.

Electrotransformation of H. pylori and merodiploid selection

Electro-competent H. pylori strain 1061 was transformed with 0.5-2 μg recombinant plasmid DNA pools by electroporation (12.5 ms, 2.5 kV, 25 μF, 600 ohm, 0.4 cm gap, Bio-Rad gene pulser, United States). Electrotransformed H. pylori were screened for kanamycin resistance on BLBB GSSA Kan agar plates. Selection for kanamycin resistance requires the integration of the recombinant plasmids into the chromosome by homologous recombination, using the cloned Helicobacter DNA as the source of homology (wild type H. pylori does not have cat and lacZY genes). This integration event duplicates a small portion of the H. pylori genomic DNA leading to the generation of a merodiploid. Kanamycin resistant colonies/merodiploids were replica plated in a 6 × 8 pattern on BLBB GSSA Kan agar plates. After 72 h of microaerophilic incubation, forty eight colonies from the replica plates were pooled in 1 mL of BLBB, GSSA, and Kan. This suspension was inoculated in 10 mL BLBB, GSSA, Kan and grown under microaerophilic conditions. After 24 h of incubation, cultures were subcultured 1:100 in 10 mL of BLBB, GSSA, Kan and grown for 16-18 h under microaerophilic conditions. These resulting merodiploids were used to infect mice or macrophage cultures (see below).

Inoculation of mice with H. pylori merodiploids

Six to eight week old Helicobacter and pathogen-free female C57BL/6 mice (Jackson Laboratory Maine, United States) were used, in compliance with guidelines and protocol approved by the Animal Care and Use Committee of the National Institutes of Health, United States. Using a 20-gauge ball-point metal feeding tube (Harvard Apparatus, Inc., Holliston, MA), mice were inoculated intragastrically with 0.1 mL of H. pylori merodiploid pooled cultures (108 colony-forming-units per milliliter-CFU/mL) once a day every other day for a total of three inoculations. Each pair of mice was inoculated with a fresh 18 h culture. Control mice were inoculated with BLBB medium.

Isolation and analysis of DNA from fecal pellets

Five days post-infection, fecal pellets were collected from the infected and control mice. DNA was isolated from fecal pellets (2 pellets per mouse) by using the QIAamp DNA stool mini kit (QIAGEN, United States). DNA samples extracted from the fecal pellets were analyzed by PCR as done previously[20].

Selection for chloramphenicol resistant H. pylori in mice

Seven days post-infection, mice were treated with chloramphenicol. 100 μL chloramphenicol (0.9 g/L, apple flavored, Foer’s Pharmacy, United States) was given to each mouse by oral gavage twice a day for three days. Chloramphenicol was also added to the water in the mouse cages to a concentration of 0.1 g/L. Following the last chloramphenicol treatment, the mice were sacrificed, and the stomachs were excised.

H. pylori IVET selection in mouse stomachs

The excised stomach was cut into two longitudinal sections. One half was added to 1 mL BLBB medium containing 20% glycerol and frozen at -80  °C. The other half of the stomach was added to 1 mL BLBB Kan medium and homogenized with a sterile motorized Polytron homogenizer (Kinematica AG, United States). The resulting homogenate was spread on BLBB, GSSA, Kan plates at 10, 100 and 1000 fold dilutions. The plates were incubated under microaerophilic conditions at 37  °C for 3-4 d. Kanamycin resistant colonies were replica plated in a 6 × 8 pattern on BLBB GSSA Kan agar plates. Forty eight colonies from the replica plates were pooled and grown overnight for the second round of mice infections.

H. pylori IVET selection in macrophages

The IVET selection in macrophage was performed as described previously with some modifications[10]. The mouse macrophage cell line, RAW 264.7 was grown in Dulbecco’s modified Eagle medium (DMEM; Gibco-BRL) supplemented with 10 % heat-inactivated fetal calf serum (FCS; Gibco-BRL) and GSSA antibiotics at 37  °C in a 50 mL/L CO2 humidified atmosphere. The day before each in vivo selection assay RAW 264.7 cells were seeded in 24-well tissue culture plates to 2 × 105 cells per well. H. pylori merodiploid pools were grown for 16 h to 18 h under microaerophilic conditions at 37  °C in BLBB Kan medium. 30 μL of the bacterial cultures were added per 1 mL of DMEM medium. The monolayers were infected with 1 mL of the bacteria suspension and centrifuged for 5 min at 600 r/min to synchronize bacterial contact with the monolayers[21,22]. The infected macrophage monolayers were incubated for 2 h at 37  °C in a microaerophilic atmosphere. The monolayers were washed three times with phosphate buffered saline (PBS) and then were incubated with 2 mL of DMEM containing 100 mg/L gentamicin for 2 h at 37  °C in a microaerophilic atmosphere to kill extracellular bacteria. Following extracellular killing, the monolayers were washed three times with 2 mL of PBS and then the infected cells were incubated overnight in DMEM containing 1 mg gentamicin/L and 20 mg chloramphenicol/L. After the incubation period the macrophage-monolayers were washed three times with PBS and then lysed by adding 1 mL of sterile water per well. The resulting lysate was spread on BLBB, GSSA, Kan plates at 10, 100 and 1000 fold dilutions. The plates were incubated under microaerophilic conditions at 37  °C for 3-4 d and the kanamycin resistant colonies were pooled and grown overnight for the second round of infections.

Screening of chloramphenicol resistant H. pylori for β-galactosidase expression in vitro

Kanamycin resistant colonies recovered from the stomach homogenates and RAW 264.7 cell lysates were replica plated in a 6 × 8 pattern on BLBB GSSA Kan X-gal plates. These plates were then incubated under microaerophilic conditions at 37  °C for 24 h, and screened for blue or white color. White colonies were used to inoculate BLBB, GSSA medium for preparing genomic DNA.

Identification of ivi gene fusions

The genomic DNA samples prepared from white colonies were tested for the presence of H. pylori 16S DNA[20]. The presence of pIVET11/pIVET12 in the genome of co-integrate strains was confirmed by PCR analysis using KanF and KanR primers. To sequence regions of genomic DNA flanking the inserted plasmid, we performed Vectorette PCR according to the manufacturer’s instructions (Sigma-Genosys). Genomic DNA from the co-integrate strains was digested separately with EcoRI, BamHI and HinDIII. Following this, compatible vectorette linkers were ligated to the ends of the genomic DNA fragments and PCR was then performed using a primer (MCAT) homologous to the 5’ end of cat gene in pIVET11/pIVET12 and a primer unique to the vectorette linker. The resulting PCR products were sequenced using MCAT primer or cloned into pSC-A-amp/kan, PCR AU cloning vector (Stratagene, United States) and sequenced subsequently.

RNA isolation

RAW 264.7 macrophages were infected with H. pylori as described above and incubated for 2 h at 37  °C in a microaerophilic atmosphere. An identical amount of H. pylori was added to a flask without RAW 264.7 cells and incubated in the same way as the H. pylori-RAW 264.7 cell coculture. A non-infected flask of RAW 264.7 cells served as a negative control for RNA isolation to ensure that no contaminating signals derived from eukaryotic RNA were present. After 2 h of incubation, the H. pylori-RAW cell coculture was washed three times with 2 mL of PBS to remove extracellular H. pylori cells. Finally, the H. pylori infected RAW cell cultures were incubated in 2 mL of medium containing 100 mg/L gentamicin for 2 h at 37  °C in a microaerophilic atmosphere to kill extracellular bacteria. Following extracellular killing, the coculture was washed three times with 2 mL of PBS and then the infected cells were treated with the TRIzol reagent for RNA isolation as described by the manufacturer (Invitrogen, United States). Further RNA purification was performed with an RNeasy mini kit (Qiagen, United States). The culture containing only H. pylori was centrifuged and washed twice with phosphate buffered saline, and TRIzol was directly applied to the pellet and the preparation was subsequently treated in the same fashion as H. pylori and RAW cells coculture described above for RNA purification.

Separation of eukaryotic and prokaryotic mRNA

H. pylori RNA from coculture was enriched by removal of the eukaryotic 18S and 28S rRNAs and polyadenylated mRNAs using the MICROBEnrich kit (Ambion) according to manufacturer’s instructions.

Real time PCR

Primers were designed for 100-150 bp regions of in vivo induced genes obtained after sequencing (Table 3). Primer design was aided by Primer Express 3.0 software (Applied Biosystems, United States). Standard PCR was performed with H. pylori SS1 genomic DNA as the template to check that all the primer pairs resulted in the amplification of a single product. RNA was reverse transcribed using Superscript III first strand synthesis system for RT-PCR (Invitrogen, United States). Real-time PCR was done using Power SYBR Green PCR Master mix (Applied Biosystems, United States). 16s RNA was used in each set of reaction for normalization. Each reaction was repeated thrice with three independent RNA samples in an Applied Biosystems 7500 real time PCR system. Melt curve analysis was done to confirm the specificity of the amplified product. Relative expression levels were determined using the 2-deltadelta Ct method[23]. Results were expressed as fold induction of expression in H. pylori and RAW 264.7 coculture as compared to H. pylori only.

Table 3 Helicobacter pylori in vivo induced genes.
LocusFunction or enzymeRole in virulence
ivi-232flhFRegulation of flagella biosynthesisMotility
ivi-122fliAFlagellar motor switch protein
ivi-121fliMFlagella motor switch protein
ivi-364tlpcMethyl-accepting chemotaxis protein
ivi-11trxBThioredoxin reductaseOxidative stress protection
ivi-134nth1Endonuclease III
ivi-322ycf5Cytochrome C biogenesis protein
ivi-352sodBIron-dependent superoxide dismutaseAcid resistance
ivi-161hsdMDNA methyltransferaseNucleic acid metabolism
ivi-162hsdM/RType II restriction enzyme R and M protein
ivi-123recGATP-dependent DNA helicase
ivi-351priAPrimosome protein replication factor
ivi-361tnpBIS606 Transposase
ivi-171lpxCUDP-3-O-acyl N- acetylglucosamine deacetylaseCell envelope structures
ivi-172minCSeptum site directing protein
ivi-1722murDUDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthase
ivi-1721murCUDP-N-acetylmuramoyl alanine-D-glutamate ligase
ivi-363murIGlutamate racemase
ivi-321fucTAlpha 1, 3-fucosyltransferase
ivi-351omp26Outer membrane protein
ivi-112pgiGlucose-6-phosphate isomeraseSugar metabolism
ivi-1132rbfARibosome binding factor ATranslation and regulation
ivi-1131infBTranslation initiation factor IF-2
ivi-2721cysSCysteinyl-tRNA synthetaseProtein and peptide synthesis
ivi-110vacAVacuolating toxinVirulence factors
ivi-362cagACytotoxin-associated gene
ivi-192virB4Type IV secretion systemTransport cagA protein
ivi-241Predicted coding region HP0426H. pylori hypothetical protein
ivi-242Predicted coding region HP0427H. pylori hypothetical protein
ivi-3101Predicted coding region HP0423H. pylori hypothetical protein
ivi-3102Predicted coding region HP0424H. pylori hypothetical protein
Statistical analysis

Data were presented as mean ± SE in Microsoft Excel. Differences between the H. pylori alone, and H. pylori and RAW 264.7 co-culture group means were analyzed by the Student’s t test. The threshold significance level for the mean difference between groups was P < 0.05.

RESULTS
Construction of H. pylori specific IVET vectors and vector validation with known H. pylori promoter

As a means to identify Helicobacter promoters specifically expressed under defined conditions, we have successfully developed two promoter trap vectors, pIVET11 and pIVET12 (Figure 1). These vectors are suicide vectors containing oriR6K origin that requires a host-encoded Pi protein, in trans, for replication. They contain two promoterless reporter genes, one encoding the cat gene and the other lacZY genes. These two genes are organized into a single transcription unit located immediately downstream from a unique BglII site, allowing for the cloning of promoter libraries. In Figure 2, we summarized an overview of the IVET strategy used in these studies. To validate the H. pylori specific promoter trap vector system, we placed the cat-lacZY fusion of pIVET11 under the control of the H. pylori vacA promoter. We transformed the resulting plasmid, pIVET11/vacA, through electroporation into electro-competent H. pylori strain 1061. Transformed H. pylori were screened for kanamycin resistance (See materials and Methods). Selection for kanamycin resistance requires the integration of the recombinant plasmid into the chromosome by homologous recombination, where the source of homology is the cloned helicobacter DNA vacA promoter sequence. The integrated sequences partially duplicate the H. pylori genomic DNA, leading to the generation of a merodiploid. With this merodiploid, one copy of the promoter drives the expression of cat-lacZY fusion, while the other promoter copy drives the expression of a wild-type ivi gene. Kanamycin resistant merodiploids were used to infect mice and macrophages. After infection, choramphenicol resistant colonies were recovered and subjected to blue or white screening to analyze β-galactosidase expression in vitro. We identified 728 cmR white colonies and analyzed their genomic DNA. The region of genomic DNA flanking the inserted plasmid was identified using the universal vectorette system as described by Sigma-Genosys. Sequence analysis of the PCR product showed the presence of the vacA promoter upstream of cat-lacZY fusion. These results indicate that the vacA promoter is capable of driving the expression of promoterless cat-lacZY genes in vivo. The expression results also serve to validate the efficacy of our promoter trap systems to detect and identify H. pylori promoters expressed in vivo.

Figure 2
Figure 2 Helicobacter pylori specific in vivo expression technology strategy. H. pylori: Helicobacter pylori; B: BamHI; Bg: BglII; kan: Kanamycin gene.
IVET selection in mouse model

We generated IVET vectors that contained a library of Sau3AI digested H. pylori chromosomal DNA. These IVET vectors were transformed into H. pylori 1061 to generate a library of merodiploid (co-integrated) strains. These strains are plasmid recombinants characterized by integration into different loci of the H. pylori genome through homologous recombination. The recombinant strains along with wild type H. pylori strain were used to infect mice. Infected mice were then subjected to chloramphenicol treatment. Chloramphenicol effectively kills the intragastric wild type H. pylori strain. The surviving chloramphenicol resistant H. pylori are merodiploid which were recovered from the stomachs of mice infected with these strains. We pooled the resistant colonies and repeated the second round of infection in mice. Of a total of 702 merodiploid strains that survived chloramphenicol challenge, 38 (approximately 6%) were found to be negative for β-galactosidase activity during in vitro screens. In the pre-selection pool, 15% (86/596) of the H. pylori genomic DNA cat-lacZY fusions were LacZ+in vitro (light blue) and 85% (510/596) were LacZ- (white). In contrast, after two rounds of the antibiotic selection, 94% (664/702) were LacZ+, and 6% (38/702) were LacZ-. These LacZ- strains presumably carried gene fusions that expressed chloramphenicol transacetylase in vivo in order to survive the systemic antibiotic treatment. However, the enzyme was expressed poorly when theses strains were grown in vitro on BLBB Kan X-gal medium. Operating on this premise, we focused our efforts on the characterization of these gene fusions because they may represent genes that are specifically induced in vivo (ivi genes).

IVET selection in cultured macrophages

RAW 264.7 macrophages were infected with H. pylori as described in the methods section. Chloramphenicol resistant bacteria were recovered from the lysates of RAW cells infected with merodiploid strains, but not from those infected with the wild type H. pylori. Chloramphenicol resistant colonies were pooled and the pools were used for the second round of infection of RAW 264.7 cells. Of a total of 231 merodiploid strains that survived chloramphenicol challenge, 15 (approximately 7%) were found to be inactive in β-galactosidase in vitro screens. In the pre-selection pool, 20% (41/206) of the cat-lacZY fusions were LacZ+in vitro (light blue) and 80% (165/206) were LacZ- (white). In contrast, after two rounds of chloramphenicol selection, 93% (216/231) were LacZ+ and 7% (15/231) were LacZ-. These strains likely contain fusions of cat-lacZY to H. pylori promoters which are active in macrophages but were not induced during in vitro growth.

Functional validation of IVET

To validate that the in vivo expressed pIVET11 and 12 proteins were under the control of H. pylori promoters, we analyzed the nucleotide sequences and real time PCR results from infected mice (38 clones) and from infected RAW cells (15 clones). These clones contain the cat-lacZY reporter genes that are fused with genes in the H. pylori genome. The reporter genes should express in the host but not in vitro. Genomic DNA isolated from these clones was digested with EcoRI, BamHI and HinDIII and ligated to the compatible vectorette linkers. To sequence regions of genomic DNA flanking the inserted plasmid, we performed PCR using a primer homologous to the 5’ end of cat gene in the IVET vectors and a primer unique to the vectorette linker. The resulting PCR products were sequenced directly or cloned and then sequenced.

Based on analysis of the nucleotide sequences of the individual inserts and comparison with the annotated genes of H. pylori in the GenBank database, we identified 31 genes. The list of the genes is shown in Table 3. The 31 genes included genes for virulence, cell envelope structures, motility, oxidative stress, nucleic acid and sugar metabolism, translation, protein synthesis and type IV secretion system. Four ivi conserved gene sequences did not show significant homology with any known genes in the Genbank database.

The real time PCR primers used to screen for ivi genes were tested using standard PCR conditions. Using H. pylori SS1 genomic DNA as the template, we found that only single PCR products resulted from each primer set. RNA was isolated from: (1) RAW 264.7 and H. pylori coculture; (2) H. pylori only; and (3) RAW 264.7 cells only. No product was obtained with the RNA of RAW 264.7 cells alone, confirming that there was no cross-reactivity that might have confounded the interpretation of data. Using 16s RNA as an internal control, we compared the expression profile of H. pylori and RAW 264.7 coculture with that of H. pylori only. The expression levels of genes differed from those observed in mice. We observed a 2-20 fold upregulation in cagA, vacA, lpxC, murI, tlpC, trxB, sodB, tnpB, pgi, rbfA and infB (Figure 3). In contrast, hsdM, hsdM/R, fucT, virB4, HP0426 and HP0427 were not upregulated. The expression levels of the remaining ivi genes remained the same.

Figure 3
Figure 3 Gene expression of Helicobacter pylori induced by phagocytosis. Up-regulation and down-regulation of Helicobacter pylori in vivo induced genes expressed by macrophage engulfed bacteria.
DISCUSSION

Characterization of microbial genes that are specifically induced during infection is important to the understanding of the mechanisms by which microbial pathogens cause disease. Intracellular pathogens have to evolve strategies to overcome the unfavorable environment met inside the host, which is very different in a culture broth outside the host. H. pylori colonizes the gastric mucosa during infection and synthesizes defense molecules to survive in the acidic gastric environment. Therefore, it is important to identify the genes of H. pylori that are upregulated in the intracellular environment of the host.

IVET has previously been attempted in Salmonella typhimurium, Vibrio cholerae and Pseudomonas aeruginosa[5,10,24-27]. In the present investigation, an antibiotic-based IVET has been applied in H. pylori for the first time. Novel H. pylori specific plasmids, pIVET11and pIVET12 (Figure 1), were constructed by modifying the plasmid pIVET8[10] and then used to construct the H. pylori library. Although this library does not contain the entire H. pylori genome, it will likely give insight into the type of genes upregulated and hence necessary for the bacterium to evade host immune defenses. On the basis of chloramphenicol selection, 31 genes were identified (Table 3). These include genes responsible for a broad and varied group of cellular structures and functions: virulence, cell envelope structures, motility, oxidative stress, nucleic acid and sugar metabolism, translation, protein synthesis, type IV secretion system and few conserved and hypothetical proteins. Virulence genes such as cagA and vacA were induced and upregulated in vivo. CagA is translocated into gastric epithelial cells and induces numerous alterations in cellular signaling[28-30]. Several H. pylori factors are known to interact directly with immune cells and modulate immune responses to H. pylori. One of these factors is vacA which alters the function of T lymphocytes, B cells, macrophages and mast cells[31,32].

H. pylori null mutant strains defective in the production of flagella are unable to colonize animal models[33]. Flagella facilitate bacterial motility resulting in bacterial penetration of the mucus layer. Hence, upregulation of flhf, a global regulator of flagella biosyntheis and fliA, fliM, flagella motor switch proteins and tlpC, a methyl accepting chemotaxis protein is significant.

During host infection, animal pathogens are exposed to reactive oxygen species, such as superoxides, hydrogen peroxides, or organic peroxides, as a result of the release of lysosomal contents within inflammatory cells[34]. In our IVET screen, proteins involved in oxidative stress protection, trxB, thioredoxin reductase, sodB, iron-dependent superoxide dismutase, nth1, endonuclease III and ycf5, cytochrome c biogenesis were upregulated. Thioredoxins have been implicated in a variety of physiological processes and biological pathways. In addition, they play a role in defense against oxidative stress, either by reducing protein disulfide bonds produced by various oxidants or by scavenging reactive oxygen species[35]. Superoxide dismutase has been demonstrated to play an important role in oxidative stress defense mechanisms to counter iron-promoted DNA damage in H. pylori[27].

Bacterial surface structures (adhesins, pilins, lipopolysaccharide, capsules) are often involved in direct contact with host cells, signaling molecules, and or immune defenses (e.g., antibody). Hence the production and/or modification of many of these surface structures in vivo is often hypervariable in order to facilitate dissemination and to avoid immune defense mechanisms[36]. In our system, several cell envelope structure-related proteins were identified. These included fucT, lpxC, minC, murD, murC, murI, and omp26.

Our IVET screening revealed the host-induced expression of several genes involved in nucleic acid metabolism, including hsdM/R, hsdM, recG, priA and tnpB (encodes the H. pylori IS606 transposase). This class of host-induced genes is involved in DNA synthesis and modification. Bacterial type II restriction-modification systems involve a restriction endonuclease and, a methyltransferase[37,38]. The coordinated action of these enzymes mimics primitive immune defense mechanisms and protects bacterial cells from foreign DNA invasion[39,40]. In addition, DNA methylation may play a role in gene regulation by inhibiting the interaction between regulatory proteins and their target DNA sequences[41]. It may also be involved in the regulation of chromosomal DNA replication and gene expression[42], transposon movement[43], or DNA mismatch repair[44]. A potential role for recG in recombination and in the rescue of stalled replication forks has been suggested[45-47]. Additionally, recent studies suggest that recG provides a more general defense against pathological DNA replication[19]. Cells lacking priA show a reduced viability and an increased sensitivity to DNA damage, phenotypes that are generally attributed to the deficiency in rescuing stalled or damaged forks[48]. Genes involved in transposition have been upregulated in microorganisms during interaction with a eukaryotic host. IS600 and tnpF genes were upregulated during interaction of S. flexneri with epithelial cells and HeLa monolayer respectively[49,50].

Our IVET screens showed that genes involved in sugar metabolism (pgi), translation and regulation (rbfA and infB), as well as, protein and peptide synthesis (cysS) were also upregulated. We also detected upregulation of four hypothetical proteins: HP0426, HO0427, HP0423 and HP0424. These genes encode putative proteins with unknown functions and do not show significant homology to known proteins. This finding has been observed in most genome-wide analyses, including IVET studies[7]. In a recent IVET study of V. cholerae, the largest class of ivi genes was found to encode hypothetical proteins[51]. These results indicate that the function of many genes required for growth and survival in complex niches remain uncharacterized and additional functional analyses of these genes are needed.

Transcription profiles of all ivi genes were confirmed by real time PCR of H. pylori RNA isolated from H. pylori infected RAW 264.7 macrophages. These experiments were conducted to determine how well in vitro ivi genes in macrophages mirror in vivo ivi genes inside the host. The expression levels of several ivi genes in macrophages varied from the levels observed in mice. For example, cagA, vacA, lpxC, murI, tlpC, trxB, sodB, tnpB, pgi, rbfA and infB showed a 2-20 fold upregulation (Figure 3). However, hsdM, hsdM/R, fucT, virB4, HP0426 and HP0427 were not upregulated in the macrophage cell line, and there was no change in the expression of the remaining ivi genes. These data suggest a strong correlation between results obtained in vitro in the macrophage cell line and in the intact animal. Thus, the macrophages are suitable for the study of initial stages of host cell and bacterium interaction. However, the in vivo animal IVET screenings provide a broader and more comprehensive picture of ivi genes necessary for infection and colonization. In this study, we identified novel H. pylori in vivo induced genes that belonged to several functional gene families, including several well known virulence factors that are expressed by bacterium in infected mouse stomachs. The positive identification of these genes demonstrates that our IVET systems are powerful tools for studying H. pylori gene expression in the host environment, and points to potential H. pylori specific targets that allow H. pylori to circumvent host immune defenses.

ACKNOWLEDGMENTS

We would like to acknowledge Stephanie Marshall for her contribution in the construction of pIVET9 and pIVET10 plasmids.

COMMENTS
Background

Helicobacter pylori (H. pylori) chronically infect 50% to 90% of the world’s population. Gastritis and ulcers are seen in 15% to 20 % of the infected population and gastric cancers occur in 1% to 2% of the same group. Identification of bacterial genes (virulence factors) accounting for H. pylori survival in the host is fundamental to understanding the mechanisms of pathogenesis.

Research frontiers

Several methods such as signature-tagged mutagenesis, selective capture of transcribed sequences, differential fluorescence induction and microarray analyses have been used to study bacterial genes that are expressed during infection of animal hosts. These strategies are often limited by their inability to reproduce the complex environments encountered by pathogens in their hosts. To overcome these limitations, in vivo expression technology (IVET) has been developed. IVET has resulted in the identification of bacterial genes involved in infection, survival and pathogenesis.

Innovations and breakthroughs

IVET has been utilized extensively in Salmonella typhimurium, Vibrio cholerae and Pseudomonas aeruginosa to identify potential virulence factors. This technology has not been exhaustively utilized in H. pylori because of limitations imposed by the genetic intractability of this bacterium. Recombination-based in vivo expression technology (RIVET) approach has been used with Vibrio cholerae, Lactobacillus plantarum, Staphylococcus aureus, Mycobacterium tuberculosis, and Bordetella pertussis. RIVET is a variant of the original IVET in which a promoter transcriptional event is captured permanently as a conversion of the infecting strain from antibiotic resistant to antibiotic sensitive. Recently, RIVET has been utilized to identify H. pylori genes important for host colonization. In this study, authors have developed IVET approach for screening H. pylori genes that are specifically expressed in vivo.

Applications

The study results suggest that this IVET approach may provide powerful tools for studying H. pylori gene expression in the host environment. Identification of H. pylori in vivo induced genes will provide an improved understanding of metabolic, physiological, and genetic factors that contribute to survival and virulence of this pathogen. It may also lead to the identification of possible vaccine targets.

Terminology

IVET is a genetic method used to determine which bacterial genes are upregulated when bacteria invade the stomach of a host.

Peer review

This study demonstrated the efficacy of in vivo expression technology for screening H. pylori genes that are expressed in vivo in mice and macrophage hosts. In this study, genes responsible for a broad group of functions were identified. Although no screen of this type can provide an exhaustive account of all genes induced in vivo, it will likely give insight into the type of genes upregulated and hence necessary for the survival of H. pylori in gastric mucosa.

References
1.  Dubois A, Borén T. Helicobacter pylori is invasive and it may be a facultative intracellular organism. Cell Microbiol. 2007;9:1108-1116.  [PubMed]  [DOI]
2.  Falkow S. Perspectives series: host/pathogen interactions. Invasion and intracellular sorting of bacteria: searching for bacterial genes expressed during host/pathogen interactions. J Clin Invest. 1997;100:239-243.  [PubMed]  [DOI]
3.  Lee SH, Butler SM, Camilli A. Selection for in vivo regulators of bacterial virulence. Proc Natl Acad Sci USA. 2001;98:6889-6894.  [PubMed]  [DOI]  [Full Text]
4.  Valdivia RH, Falkow S. Fluorescence-based isolation of bacterial genes expressed within host cells. Science. 1997;277:2007-2011.  [PubMed]  [DOI]
5.  Mahan MJ, Slauch JM, Mekalanos JJ. Selection of bacterial virulence genes that are specifically induced in host tissues. Science. 1993;259:686-688.  [PubMed]  [DOI]
6.  Rainey PB, Preston GM. In vivo expression technology strategies: valuable tools for biotechnology. Curr Opin Biotechnol. 2000;11:440-444.  [PubMed]  [DOI]
7.  Rediers H, Rainey PB, Vanderleyden J, De Mot R. Unraveling the secret lives of bacteria: use of in vivo expression technology and differential fluorescence induction promoter traps as tools for exploring niche-specific gene expression. Microbiol Mol Biol Rev. 2005;69:217-261.  [PubMed]  [DOI]
8.  Angelichio MJ, Camilli A. In vivo expression technology. Infect Immun. 2002;70:6518-6523.  [PubMed]  [DOI]
9.  Castillo AR, Woodruff AJ, Connolly LE, Sause WE, Ottemann KM. Recombination-based in vivo expression technology identifies Helicobacter pylori genes important for host colonization. Infect Immun. 2008;76:5632-5644.  [PubMed]  [DOI]
10.  Mahan MJ, Tobias JW, Slauch JM, Hanna PC, Collier RJ, Mekalanos JJ. Antibiotic-based selection for bacterial genes that are specifically induced during infection of a host. Proc Natl Acad Sci USA. 1995;92:669-673.  [PubMed]  [DOI]
11.  Lee A, O'Rourke J, De Ungria MC, Robertson B, Daskalopoulos G, Dixon MF. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology. 1997;112:1386-1397.  [PubMed]  [DOI]
12.  Goodwin A, Kersulyte D, Sisson G, Veldhuyzen van Zanten SJ, Berg DE, Hoffman PS. Metronidazole resistance in Helicobacter pylori is due to null mutations in a gene (rdxA) that encodes an oxygen-insensitive NADPH nitroreductase. Mol Microbiol. 1998;28:383-393.  [PubMed]  [DOI]
13.  Hawrylik SJ, Wasilko DJ, Haskell SL, Gootz TD, Lee SE. Bisulfite or sulfite inhibits growth of Helicobacter pylori. J Clin Microbiol. 1994;32:790-792.  [PubMed]  [DOI]
14.  McColm AA, Mobley HLT. Nonprimate animal model for H. pylori infection. Methods of molecular medicine, Helicobacter pylori protocols. Totowa: Humana Press 1997; 235-251.  [PubMed]  [DOI]
15.  Luria SE, Burrous JW. Hybridization between Escherichia coli and Shigella. J Bacteriol. 1957;74:461-476.  [PubMed]  [DOI]
16.  Institute of Laboratory Animal Resources Guide for the care and use of laboratory animals. 7th ed. Washington DC: National Academy Press 1996; .  [PubMed]  [DOI]
17.  Germino J, Bastia D. Interaction of the plasmid R6K-encoded replication initiator protein with its binding sites on DNA. Cell. 1983;34:125-134.  [PubMed]  [DOI]
18.  Miller VL, Mekalanos JJ. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol. 1988;170:2575-2583.  [PubMed]  [DOI]
19.  Rudolph CJ, Upton AL, Lloyd RG. Replication fork collisions cause pathological chromosomal amplification in cells lacking RecG DNA translocase. Mol Microbiol. 2009;74:940-955.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 40]  [Cited by in RCA: 50]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
20.  Nyan DC, Welch AR, Dubois A, Coleman WG. Development of a noninvasive method for detecting and monitoring the time course of Helicobacter pylori infection. Infect Immun. 2004;72:5358-5364.  [PubMed]  [DOI]
21.  Allen LA. Rate and extent of Helicobacter pylori phagocytosis. Methods Mol Biol. 2008;431:147-157.  [PubMed]  [DOI]
22.  Elsinghorst EA. Measurement of invasion by gentamicin resistance. Methods Enzymol. 1994;236:405-420.  [PubMed]  [DOI]
23.  Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-408.  [PubMed]  [DOI]
24.  Wang J, Lory S, Ramphal R, Jin S. Isolation and characterization of Pseudomonas aeruginosa genes inducible by respiratory mucus derived from cystic fibrosis patients. Mol Microbiol. 1996;22:1005-1012.  [PubMed]  [DOI]
25.  Camilli A, Mekalanos JJ. Use of recombinase gene fusions to identify Vibrio cholerae genes induced during infection. Mol Microbiol. 1995;18:671-683.  [PubMed]  [DOI]
26.  Heithoff DM, Conner CP, Hanna PC, Julio SM, Hentschel U, Mahan MJ. Bacterial infection as assessed by in vivo gene expression. Proc Natl Acad Sci USA. 1997;94:934-939.  [PubMed]  [DOI]
27.  Wang G, Conover RC, Olczak AA, Alamuri P, Johnson MK, Maier RJ. Oxidative stress defense mechanisms to counter iron-promoted DNA damage in Helicobacter pylori. Free Radic Res. 2005;39:1183-1191.  [PubMed]  [DOI]
28.  Asahi M, Azuma T, Ito S, Ito Y, Suto H, Nagai Y, Tsubokawa M, Tohyama Y, Maeda S, Omata M. Helicobacter pylori CagA protein can be tyrosine phosphorylated in gastric epithelial cells. J Exp Med. 2000;191:593-602.  [PubMed]  [DOI]
29.  Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T, Asaka M, Hatakeyama M. SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science. 2002;295:683-686.  [PubMed]  [DOI]
30.  Odenbreit S, Gebert B, Püls J, Fischer W, Haas R. Interaction of Helicobacter pylori with professional phagocytes: role of the cag pathogenicity island and translocation, phosphorylation and processing of CagA. Cell Microbiol. 2001;3:21-31.  [PubMed]  [DOI]
31.  Boncristiano M, Paccani SR, Barone S, Ulivieri C, Patrussi L, Ilver D, Amedei A, D'Elios MM, Telford JL, Baldari CT. The Helicobacter pylori vacuolating toxin inhibits T cell activation by two independent mechanisms. J Exp Med. 2003;198:1887-1897.  [PubMed]  [DOI]
32.  Gebert B, Fischer W, Weiss E, Hoffmann R, Haas R. Helicobacter pylori vacuolating cytotoxin inhibits T lymphocyte activation. Science. 2003;301:1099-1102.  [PubMed]  [DOI]
33.  Eaton KA, Suerbaum S, Josenhans C, Krakowka S. Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes. Infect Immun. 1996;64:2445-2448.  [PubMed]  [DOI]
34.  Buettner GR. The pecking order of free radicals and antioxidants: lipid peroxidation, alpha-tocopherol, and ascorbate. Arch Biochem Biophys. 1993;300:535-543.  [PubMed]  [DOI]
35.  Rocha ER, Tzianabos AO, Smith CJ. Thioredoxin reductase is essential for thiol/disulfide redox control and oxidative stress survival of the anaerobe Bacteroides fragilis. J Bacteriol. 2007;189:8015-8023.  [PubMed]  [DOI]
36.  Morschhäuser J, Köhler G, Ziebuhr W, Blum-Oehler G, Dobrindt U, Hacker J. Evolution of microbial pathogens. Philos Trans R Soc Lond B Biol Sci. 2000;355:695-704.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 51]  [Cited by in RCA: 45]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
37.  Wilson GG, Murray NE. Restriction and modification systems. Annu Rev Genet. 1991;25:585-627.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 477]  [Cited by in RCA: 511]  [Article Influence: 14.6]  [Reference Citation Analysis (0)]
38.  Roberts R, Ja H. Type II restriction endonucleases. Nucleases. Plainview: Cold Spring Harbor Lab Press 1993; 35-88.  [PubMed]  [DOI]
39.  Arber W, Dussoix D. Host specificity of DNA produced by Escherichia coli. I. Host controlled modification of bacteriophage lambda. J Mol Biol. 1962;5:18-36.  [PubMed]  [DOI]
40.  Kong H, Lin LF, Porter N, Stickel S, Byrd D, Posfai J, Roberts RJ. Functional analysis of putative restriction-modification system genes in the Helicobacter pylori J99 genome. Nucleic Acids Res. 2000;28:3216-3223.  [PubMed]  [DOI]
41.  Low DA, Weyand NJ, Mahan MJ. Roles of DNA adenine methylation in regulating bacterial gene expression and virulence. Infect Immun. 2001;69:7197-7204.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 259]  [Cited by in RCA: 256]  [Article Influence: 10.2]  [Reference Citation Analysis (0)]
42.  Heithoff DM, Sinsheimer RL, Low DA, Mahan MJ. An essential role for DNA adenine methylation in bacterial virulence. Science. 1999;284:967-970.  [PubMed]  [DOI]
43.  Roberts D, Hoopes BC, McClure WR, Kleckner N. IS10 transposition is regulated by DNA adenine methylation. Cell. 1985;43:117-130.  [PubMed]  [DOI]
44.  Modrich P. Methyl-directed DNA mismatch correction. J Biol Chem. 1989;264:6597-6600.  [PubMed]  [DOI]
45.  Briggs GS, Mahdi AA, Weller GR, Wen Q, Lloyd RG. Interplay between DNA replication, recombination and repair based on the structure of RecG helicase. Philos Trans R Soc Lond B Biol Sci. 2004;359:49-59.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 50]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
46.  Rudolph C, Shurer KA, Kramer W.  Facing stalled replication forks: the intricacies of doing the right thing. Heidelberg: Springer 2006; 105-152.  [PubMed]  [DOI]
47.  Sharples GJ, Ingleston SM, Lloyd RG. Holliday junction processing in bacteria: insights from the evolutionary conservation of RuvABC, RecG, and RusA. J Bacteriol. 1999;181:5543-5550.  [PubMed]  [DOI]
48.  Heller RC, Marians KJ. Replisome assembly and the direct restart of stalled replication forks. Nat Rev Mol Cell Biol. 2006;7:932-943.  [PubMed]  [DOI]
49.  Bartoleschi C, Pardini MC, Scaringi C, Martino MC, Pazzani C, Bernardini ML. Selection of Shigella flexneri candidate virulence genes specifically induced in bacteria resident in host cell cytoplasm. Cell Microbiol. 2002;4:613-626.  [PubMed]  [DOI]
50.  Runyen-Janecky LJ, Payne SM. Identification of chromosomal Shigella flexneri genes induced by the eukaryotic intracellular environment. Infect Immun. 2002;70:4379-4388.  [PubMed]  [DOI]
51.  Lombardo MJ, Michalski J, Martinez-Wilson H, Morin C, Hilton T, Osorio CG, Nataro JP, Tacket CO, Camilli A, Kaper JB. An in vivo expression technology screen for Vibrio cholerae genes expressed in human volunteers. Proc Natl Acad Sci USA. 2007;104:18229-18234.  [PubMed]  [DOI]
52.  Slauch JM, Mahan MJ, Mekalanos JJ. In vivo expression technology for selection of bacterial genes specifically induced in host tissues. Methods Enzymol. 1994;235:481-492.  [PubMed]  [DOI]
Footnotes

Peer reviewer: Hikaru Nagahara, MD, PhD, Professor, Department of Gastroenterology, Aoyama Hospital, Tokyo Women’s Medical University, 2-7-13 Kita-Aoyama, Minatoku, Tokyo 107-0061, Japan

S- Editor Gou SX L- Editor A E- Editor Zhang DN

Write to the Help Desk